PubMed Health⌕ Search

Biomedical subjects

S S Potter

Publications and source records attributed to S S Potter.

At least 19 recordsLinked to original sources
PubMed1992

Dominant mutation of the murine Hox-2.2 gene results in developmental abnormalities.

Genes carrying the homeobox were originally identified in Drosophila, in which they are now known to play key roles in establishing segmentation patterns and in determining segment identities. A number of genes with striking homology to the Drosophila homeobox genes have now been found in the mouse genome, and mutational analysis is beginning to shed light on their function in mammalian development. To understand better the developmental significance of the murine Hox-2.2 gene, we have generated gain of function mutants by using the chicken beta-actin promoter to drive ubiquitous expression in transgenic mice. The resulting Hox-2.2 misexpression produces early postnatal lethality as well as craniofacial and axial skeletal perturbations that include open eyes at birth, cleft palate, micrognathia, microtia, skull bone deficiencies, and structural and positional alterations in the vertebral column. We repeatedly observe complete or partial absence of the supraoccipital bone and malformations of the exoccipital and the basioccipital bones. These results suggests a role for the Hox-2.2 gene in specifying positional identity along the anterior-posterior axis.

Abnormalities, Multiple↗
PubMed1992

A novel murine homeobox gene isolated by a tissue specific PCR cloning strategy.

We have identified a novel homeobox gene, designated K-2, using a reverse transcription PCR cloning strategy. Sequence analysis reveals that the homeobox of K-2 is 77.6% homologous at the nucleotide level and 97% identical at the amino acid sequence level to another murine gene, S8. Homeodomain sequence comparisons indicate that K-2 and S8 represent a distinct subclass of paired type homeobox genes. Northern blot analysis of RNA from murine embryos and adult tissues identified multiple transcripts that are expressed in a developmentally specific and tissue restricted manner. Alternate splicing of K-2 at the 3-coding region leads to the inclusion of a chain terminating sequence. In addition, the developmental expression pattern of this gene at day 12 of gestation was determined by in situ hybridization. Expression was observed in diverse mesenchymal cells in craniofacial, pericardial, primitive dermal, prevertebral, and genital structures.

Alternative Splicing↗
PubMed1992

Lens structures exist transiently in development of transgenic mice carrying an alpha-crystallin-diphtheria toxin hybrid gene.

The development of lens structures in transgenic mice (lnl mice) which carry the diphtheria toxin A chain-coding sequence under the control of the alpha-crystallin promoter is examined here in detail. The initial stages of lens development during embryonic days 10.5 to 12.5 (E10.5-E12.5), including the invagination of the surface ectoderm to form a lens vesicle, closure of the vesicle to form a lens cup, and initial appearance of the lens itself, appeared identical in histologic analyses of lnl mice and genotypically wild-type littermate controls. However, by E12.5, cells in the central posterior lens of developing lnl mice appeared to be vacuolated and undergoing necrosis. This necrosis was quite prominent at E14.5 and the overall lens size was significantly reduced. The lenses of lnl mice continued to be present but were significantly smaller throughout embryonic development. The cells of these lenses were capable of undergoing biochemical differentiation, reacting with antibodies to both alpha- and beta-/gamma-crystallin. alpha-Crystallin expression was initiated at the appropriate time (E10.5) and maintained in most cells of lnl lenses. The expression of beta-/gamma-crystallins was surprising as these crystallins are expressed later in lens development after normal expression of alpha-crystallin and after the anticipated time of expression of the diphtheria toxin transgene. Despite extensive necrosis and cell death, lens structures persisted in lnl mice and disappeared only in the early postnatal period between days 3 and 6. Throughout the perinatal period, the remaining lens cells expressed both alpha- and beta-/gamma-crystallins. Prenatal development of the retina and ciliary body was relatively normal although the eye was significantly reduced in overall size. Some additional developmental defects were noted including persistent hyaloid artery and thickened cornea. In the perinatal period the rapidly expanding retina filled the entire eye leaving essentially no anterior or posterior chamber. These results clearly indicate that lens cells which are the target of diphtheria toxin-mediated cell ablation techniques persist for a significant time during development and thus place limitations on the interpretations of results obtained using this technique.

Animals↗
PubMed1992

Ectopic expression of Hox-2.3 induces craniofacial and skeletal malformations in transgenic mice.

To better understand the role of the Hox-2.3 murine homeobox gene during development, a dominant gain-of-function mutation was generated. The developmental malformations that resulted when the chicken beta-actin promoter was used to direct widespread expression of the Hox-2.3 gene in transgenic mice included early postnatal death as well as craniofacial abnormalities, including open eyes and cleft palate. Ventricular septal defects were also observed in the hearts of three transgenic mice. Skeletal malformations were seen in the bones of the craniocervical transition, with the occipital, basisphenoid, and atlas bones deficient or misshapen. Interestingly, one mutant exhibited an extra pair of ribs as well as alterations in cervical vertebrae identities. Some of the malformations observed in Hox-2.3 gain-of-function mutants overlap with those seen in Hox-1.1 and Hox-2.2 misexpression mutants which suggests functional similarities between paralogous homeobox genes. The results of these experiments are consistent with a role for Hox-2.3 in specifying positional information during development.

Abnormalities, Multiple↗
PubMed1992

Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression.

We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the AP-1, TCF-1 alpha, mu E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.

Adenosine Deaminase↗
PubMed1991

Identification of 10 murine homeobox genes.

In Drosophila a number of genes important in establishing segmentation patterns and in determining segment identities have been shown to carry the homeobox sequence. Over 30 murine homeobox genes have been cloned, many on the basis of sequence homology to Drosophila prototypes. Here we report the cloning and sequencing of 10 new and 6 previously known homeobox genes by screening a murine genomic library with a 768-fold degenerate oligonucleotide corresponding to the most conserved 8-amino acid motif in the recognition helix of the homeodomain. Eight of these new homeobox genes have been chromosomally mapped. Four genes do not belong to any of the known homeobox gene clusters but instead map to new locations on chromosome 1 (single gene) and chromosome 5 (three genes). Sequence comparisons indicate that two of these are very closely related and represent a distinct new category of homeobox genes. The remaining four mapped genes reside in previously established murine homeobox gene clusters. Specifically, two map to the cluster HOX-1 on chromosome 6 and one each to HOX-3 and HOX-4 on chromosome 15 and 2, respectively. The ratio of newly identified homeobox genes to the previously characterized murine homeobox genes suggests that there remain several uncharacterized homeobox genes in the murine genome.

Amino Acid Sequence↗
PubMed1991

A functional c-myb gene is required for normal murine fetal hepatic hematopoiesis.

The c-myb proto-oncogene encodes a sequence-specific DNA-binding protein. To better understand its normal biological function, we have altered the c-myb gene by homologous recombination in mouse embryonic stem cells. Resulting homozygous c-myb mutant mice displayed an interesting phenotype. At day 13 of gestation these mice appeared normal, suggesting that c-myb is not essential for early development. By day 15, however, the mutant mice were severely anemic. Analysis indicated that embryonic erythropoiesis, which occurs in the yolk sac, was not impaired by the c-myb alteration. Adult-type erythropoiesis, which first takes place in the fetal liver, was greatly diminished in c-myb mutants, however. Additional hematopoietic lineages were similarly affected. These results are compatible with a role for c-myb in maintaining the proliferative state of hematopoietic progenitor cells.

Animals↗
PubMed1991

Evaluating the human engineering of microprocessor-controlled operating room devices.

Although human engineering features are widely appreciated as a potential cause of operating room incidents, evaluating the human engineering features of devices is not widely understood. Standards, guidelines, laboratory and field testing, and engineering discipline are all proposed methods for improving the human engineering of devices. New microprocessor technology offers designers great flexibility in the design of devices, but this flexibility is often coupled with complexity and more elaborate user interaction. Guidelines and standards usually do not capture these features of new equipment, in part because technology improvements occur faster than meaningful guidelines can be developed. Professional human engineering of new devices relies on a broad, user-centered approach to design and evaluation. Used in the framework of current knowledge about human operator performance, these techniques offer guidance to new equipment designers and to purchasers and users of these devices.

Anesthesiology↗
PubMed1991

legless insertional mutation: morphological, molecular, and genetic characterization.

Limb morphogenesis is an excellent model system to study pattern formation during vertebrate development. The legless (lgl) insertional mutation can serve as a tool to analyze specific events in limb development at the embryologic, genetic, and molecular levels. Hemizygous mice of this transgenic line are phenotypically normal, but homozygous mutants are inviable and exhibit limb, brain, and craniofacial malformations, as well as situs inversus. By morphological analysis of mutant hindlimb buds we show absence of a normal apical ectodermal ridge, a structure required for limb bud outgrowth, and an unusually high degree of mesenchymal and ectodermal cell death. Mutant embryos are extremely sensitive to retinoic acid, a known teratogen with a proposed role in limb development. The hindlimb malformations in legless mutants are less severe when bred into the BALB/c background, suggesting the involvement of other strain-specific genes. Molecular analysis of the disrupted region indicates two tightly linked insertion sites. Sequences flanking the transgene insertions have been cloned and mapped to chromosome 12, near the iv (situs inversus viscerum) locus. Consistent with this, complementation tests confirm allelism of lgl and iv and suggest that the transgene insertion may have disrupted more than one gene. Phylogenetically conserved sequences flanking the transgene insertions were identified and used to isolate candidate lgl and iv cDNAs.

Alleles↗
PubMed1990

Phenotypic characterization of the transgenic mouse insertional mutation, legless.

In this report, we describe the dysmorphologic phenotype associated with the transgenic insertional mutation legless. This autosomal recessive, perinatally lethal mutation results in an interesting pleiotropic array of congenital malformations. The phenotype of the legless mutation in homozygous perinatal mutants is compared to wild-type nontransgenic and heterozygous siblings. Skeletal, craniofacial, and visceral malformations are characterized. We have observed by skeletal analysis a consistent loss of distal hindlimb structures, as well as the loss of distal forelimb structures with a predilection for the preaxial side of the developing forelimb. Craniofacial malformations commonly observed appear to represent a range of severity of affect, with the mildest manifestation evident as apparently shallow lateral clefts of the upper lip and mild midfacial clefts accompanied by clefts of the secondary palate. At the severe end of the spectrum, the midline clefts of the face (and secondary palate) are very wide, with obvious accompanying frontonasal encephaloceles and overt lateral clefts of the upper lip. Examination of the mutant brain has demonstrated marked defects in the anterior structures, particularly the olfactory lobes and cerebrum, in greater than 90% of the brains studied. Observation of the internal viscera has identified transposition of thoracic and abdominal organs in approximately 50% of the mutant offspring. The limb, head, and visceral defects were not observed in the wild-type nontransgenic or heterozygous siblings. Transgenic insertional mutations leading to congenital malformations are useful because the transgene sequence may serve as a tag to facilitate molecular retrieval. Analysis of the flanking DNA sequences will allow the identification of the interrupted gene. A complete description of the mutant phenotype will assist in the understanding of this genetic locus.

Animals↗
PubMed1990

Cis-acting sequences from a human surfactant protein gene confer pulmonary-specific gene expression in transgenic mice.

Pulmonary surfactant is produced in late gestation by developing type II epithelial cells lining the alveolar epithelium of the lung. Lack of surfactant at birth is associated with respiratory distress syndrome in premature infants. Surfactant protein C (SP-C) is a highly hydrophobic peptide isolated from pulmonary tissue that enhances the biophysical activity of surfactant phospholipids. Like surfactant phospholipid, SP-C is produced by epithelial cells in the distal respiratory epithelium, and its expression increases during the latter part of gestation. A chimeric gene containing 3.6 kilobases of the promoter and 5'-flanking sequences of the human SP-C gene was used to express diphtheria toxin A. The SP-C-diphtheria toxin A fusion gene was injected into fertilized mouse eggs to produce transgenic mice. Affected mice developed respiratory failure in the immediate postnatal period. Morphologic analysis of lungs from affected pups showed variable but severe cellular injury confined to pulmonary tissues. Ultrastructural changes consistent with cell death and injury were prominent in the distal respiratory epithelium. Proximal components of the tracheobronchial tree were not severely affected. Transgenic animals were of normal size at birth, and structural abnormalities were not detected in nonpulmonary tissues. Lung-specific diphtheria toxin A expression controlled by the human SP-C gene injured type II epithelial cells and caused extensive necrosis of the distal respiratory epithelium. The absence of type I epithelial cells in the most severely affected transgenic animals supports the concept that developing type II cells serve as precursors to type I epithelial cells.

Animals↗
PubMed1989

Complete foldback transposable elements encode a novel protein found in Drosophila melanogaster.

An apparently complete foldback (FB) transposable element homologous to FB white-crimson (FBwc) was analyzed. A complete FB element could encode one or more proteins required for regulation of FB transposition. The central DNA region (the loop) and the junctions between the loop and the inverted terminal repeats were sequenced. Three open reading frames (ORFs) are present in the loop, and a novel 308 bp inverted repeat is present at the junctions. No significant homologies were found when the DNA sequences of the loop region and the novel inverted repeat were screened against the Gene data bank. Antibodies were prepared in guinea-pigs against a peptide present near the amino terminus of ORF1, the longest ORF. A 71,000 dalton protein was isolated from an extract of Drosophila melanogaster early-stage embryos on an anti-ORF1 peptide-affinity column. Immunohistochemical studies of adult flies demonstrate localization of this protein in egg chambers.

Amino Acid Sequence↗
PubMed1989

Analysis of possible repressor elements in the 5'-flanking region of the human beta-globin gene.

Human beta-globin gene expression is confined predominantly to the adult with little or no expression of this gene occurring during embryonic or fetal life. The lack of expression of this gene in embryonic and fetal erythroid tissue could be due to the absence of required positive regulatory factors in these cells or the presence of negative regulatory factors which prevent expression of the adult globin gene. To test the repressor model, we have used a gel electrophoretic mobility shift assay to identify regions in the human beta-globin gene which bind proteins found in K562 cells, a cell line that expresses embryonic and fetal globins but not adult beta-globin. DNA fragments comprising the entire human beta-globin gene were assayed using nuclear proteins from K562 cells, and four regions were found that bind proteins. These are located within the 5'-flanking region, within the first and second introns, and at the 3'-flanking region of the gene. Previous studies have suggested the presence of potential repressor sites 5' of exon 2. For this reason, we examined whether the lack of the binding regions in the 5'-flanking sequence allow expression of the human beta-globin gene in transgenic mice during embryonic life. beta-globin gene expression was confined to adult life, indicating that if a transcriptional repressor is responsible for inactivating this gene in embryonic tissue, it is not regulated solely by sequences upstream from -122 bp in the 5'-flanking region of the human beta-globin gene.

Animals↗
PubMed1989

Targeted ablation of alpha-crystallin-synthesizing cells produces lens-deficient eyes in transgenic mice.

Genetic ablation techniques were used to study the role of the lens in mammalian eye development. Ablation was accomplished by microinjecting murine eggs with chimeric DNA constructs in which the alpha A-crystallin gene regulatory sequence (-366 to +46) was fused to the highly cytotoxic diphtheria toxin gene coding sequence. For genetic ablation to be successful the promoter regulating expression should be specific and completely silent in cells necessary for normal mouse development. In this report, we describe the generation and analysis of transgenic mice with this readily discernible phenotype: aphakia or eyes without lens. Of the 109 live-born pups, eight carried the transgene and could be grouped according to the apparent severity of eye malformations. Lines 4, 5 and 6 founder (F0) mice had the most severe phenotype. Histological analysis revealed: marked reduction in eye size, total absence of lens, increased retinal cell density and extensive whorling of the retinal fibre layers. The line 1 F0 mouse displayed a distinct lens opacity and lines 2, 3 and 8 F0 mice were mosaics with a relatively mild, but most unusual phenotype. Their eyes contained a small, highly vacuolated lens. The progeny of these mosaics that inherited the transgene, however, again exhibited the severe phenotype. The aberrant structures of the eyes in which complete genetic ablation of the lens has been achieved suggest that the lens plays a pivotal role in the development of multiple components of the murine eye.

Animals↗
PubMed1988

Overlapping transcriptional units on the same strand within the murine beta-glucuronidase gene complex.

We have identified and partially characterized a complex transcriptional unit within the murine beta-glucuronidase gene complex on chromosome 5. On the same strand and within the first intron of the beta-glucuronidase structural gene, Gus-s, we observe an RNA polymerase II promoter motif. That sequences within this carefully defined region can promote RNA polymerase II transcription is supported by results of in vitro transcriptional runoff assays and by expression of a linked reporter gene in both cultured cells and transgenic mice. Results of RNA blot hybridization and S1 nuclease protection studies reveal a 2.2-kilobase processed liver transcript which is initiated just downstream of the promoter motif and sharing little, if any, sequence with the 2.7-kilobase beta-glucuronidase mRNA. Both RNA species are found in liver where beta-glucuronidase is known to be expressed in all cell types. To our knowledge, this is the first description of eukaryotic mRNAs from overlapping transcription units which share the same strand yet exhibit little, if any, sequence similarity. A possible regulatory relationship between these overlapping structural genes is discussed.

Animals↗
PubMed1988

Legless, a novel mutation found in PHT1-1 transgenic mice.

In this report it is shown that the PHT1-1 line of transgenic mice exhibited a pattern of developmental abnormalities when the mice were homozygous for the transgene insertion. Hindlimbs were uniformly truncated at the distal end of the femur, resulting in a "legless" appearance. Forelimbs lacked anterior structures including digits and the radius. The brains had many defects, particularly in the anterior structures of the cerebrum, including the olfactory lobes. Craniofacial malformations in the form of facial clefts also commonly occurred. Furthermore, heterozygotes of this line, with only one copy of the DNA insertion, and other transgenic lines carrying the same DNA construct appeared normal, suggesting that in the PHT1-1 line a gene significant in mammalian development has been disrupted.

Animals↗
PubMed1988

Distinct subfamilies of primate L1Gg retroposons, with some elements carrying tandem repeats in the 5' region.

Two subfamilies of L1 elements, differing dramatically in the first 1.2 kb of sequence at their 5' ends, were identified in the prosimian primate, Galago garnetti. Interesting patterns of sequence similarity were observed between the galago subfamilies, and with the L1s from human and from another prosimian, the slow loris. Furthermore, members of one of the subfamilies have six to eight tandemly repeated units of 73 bp, starting about 730 bp from their 5' ends. Such tandem repeats have not been reported in other primate L1s, but a striking sequence similarity was found between the galago tandem repeats and those previously described at the 5' termini of some mouse L1s [Loeb, D. D. et al. Mol. Cell. Biol. 6, 168-182, 1986]. Although the similar sequence indicates a shared, conserved function, the galago repeats are sub-terminal and therefore cannot serve as portable RNA polymerase II promoters, as has been suggested for the mouse tandem repeats.

Animals↗