Biomedical subjects

Shogo Ozawa

Publications and source records attributed to Shogo Ozawa.

At least 19 recordsLinked to original sources

PubMed2007

Pharmacokinetics of gemcitabine in Japanese cancer patients: the impact of a cytidine deaminase polymorphism.

PURPOSE: Gemcitabine is rapidly metabolized to its inactive metabolite, 2',2'-difluorodeoxyuridine (dFdU), by cytidine deaminase (CDA). We previously reported that a patient with homozygous 208A alleles of CDA showed severe adverse reactions with an increase in gemcitabine plasma level. This study extended the investigation of the effects of CDA genetic polymorphisms on gemcitabine pharmacokinetics and toxicities. PATIENTS AND METHODS: Genotyping of CDA was performed by a direct sequencing of DNA obtained from the peripheral blood of Japanese gemcitabine-naïve cancer patients (n = 256). The patients recruited to the association study received a 30-minute intravenous infusion of gemcitabine at a dose of either 800 or 1,000 mg/m2, and eight blood samples were periodically collected (n = 250). Plasma levels of gemcitabine and dFdU were measured by high-performance liquid chromatography. Plasma CDA activities toward cytidine and gemcitabine were also measured (n = 121). RESULTS: Twenty-six genetic variations, including 14 novel ones and two known nonsynonymous single nucleotide polymorphisms (SNPs), were detected. Haplotypes harboring the nonsynonymous SNPs 79A>C (Lys27Gln) and 208G>A (Ala70Thr) were designated *2 and *3, respectively. The allelic frequencies of the two SNPs were 0.207 and 0.037, respectively. Pharmacokinetic parameters of gemcitabine and plasma CDA activities significantly depended on the number of haplotype *3. Haplotype *3 was also associated with increased incidences of grade 3 or higher neutropenia in the patients who were coadministered fluorouracil, cisplatin, or carboplatin. Haplotype *2 showed no significant effect on gemcitabine pharmacokinetics. CONCLUSION: Haplotype *3 harboring a nonsynonymous SNP, 208G>A (Ala70Thr), decreased clearance of gemcitabine, and increased incidences of neutropenia when patients were coadministered platinum-containing drugs or fluorouracil.

Adult↗

PubMed2006

Impact of the haplotype CYP3A4*16B harboring the Thr185Ser substitution on paclitaxel metabolism in Japanese patients with cancer.

OBJECTIVE: Paclitaxel is one of the most important anticancer drugs for the treatment of various tumors such as non-small cell lung cancer. We investigated the association between CYP3A4 haplotypes and pharmacokinetic parameters of paclitaxel metabolism. METHODS: This study enrolled 235 Japanese patients with cancer who were receiving paclitaxel. These patients were screened for CYP3A4 gene polymorphisms by either direct sequencing or pyrosequencing. Plasma concentrations of paclitaxel and its 3 metabolites were determined by HPLC in 229 patients. RESULTS: Median values of paclitaxel clearance, normalized for body surface area, were lower in the high-dose group (>or=175 mg/m2, n = 199) than in the low-dose group (<or=100 mg/m2, n = 30), suggesting nonlinearity of pharmacokinetics caused by Cremophor EL. Therefore we mainly used the patients in the high-dose group for further analysis. The median value of the area under the curve (AUC) ratio of 3'-p-hydroxypaclitaxel to paclitaxel was 20% greater (95% confidence interval, 2.4% to 41.7%) in the women than in the men (P = .01). Although no significant difference in paclitaxel clearance was observed among the CYP3A4 haplotypes, 16B-bearing (1/16B) patients (n = 8) showed a 20% lower (95% confidence interval, -58.5 to -11.5%) median AUC ratio of 3'-p-hydroxypaclitaxel to paclitaxel (P = .04) and a 2.4-fold higher median AUC ratio of 6alpha-hydroxypaclitaxel to paclitaxel (P < .001) compaed with those in the wild-type (1/1) patients (n = 180). In contrast, no significant differences were seen between 1/1 and 18B/1 (n = 10) patients for the pharmacokinetic parameters examined. CONCLUSIONS: Our results suggest that CYP3A416B is associated with both reduced 3'-p-hydroxylation of paclitaxel and probably increased levels of 6alpha-hydroxypaclitaxel.

Adult↗

PubMed2006

Frequency distribution of phenol sulfotransferase 1A1 activity in platelet cells from healthy Japanese subjects.

AIMS: To determine the distribution of sulfotransferase 1A1 (SULT1A1) activities, we used trans-4-hydroxytamoxifen (OHT) as a substrate to test samples from a Japanese population to examine whether the SULT1A1*2 allele can account for the wide distribution of OHT sulfating activity. We also studied genetic mutations other than the SULT1A1*2 allele to determine the cause of differences in SULT1A1 protein expression and activity. METHODS: The subjects were 103 healthy Japanese adults. Identification of SULT1A1 genotypes was performed using a polymerase chain reaction-restriction fragment length polymorphism method. SULT1A1 activity in platelet cytosol was assayed using OHT as a substrate. SULT1A1 protein was detected using Western blotting analysis. Mutations other than SULT1A1*2 in the SULT1A1 gene were detected using sequencing analysis. RESULTS: SULT1A1*2 allele frequency was found to be 16.5%, while SULT1A1 activity ranged from 63 to 1860pmol sulfated/h/mg platelet protein (260+/-241pmol sulfated/h/mg platelet protein, median+/-S.D.) using OHT as a substrate. The median values in subjects with SULT*1/*2 (221+/-113pmol sulfated/h/mg platelet protein, range 63-442, n=26) and SULT*2/*2 (124+/-66pmol sulfated/h/mg platelet protein, range 74-231, n=4) were significantly lower than that in subjects with SULT*1/*1 (303+/-267pmol sulfated/h/mg platelet protein, range 97-1859, n=73). A novel G148C mutation was found in one subject, who showed the lowest OHT sulfating activity, for a frequency of 0.49%. CONCLUSION: There was wide variety of OHT sulfating activities found among the present healthy Japanese subjects. The SULT1A1*2 allele was found to be a common variant allele and was associated with decreased OHT sulfating activity. These observations may be related to inter-individual variations of OHT pharmacokinetics and the pharmacologic effects of tamoxifen seen in Japanese patients with breast cancer.

Adult↗

PubMed2006

A T3587G germ-line mutation of the MDR1 gene encodes a nonfunctional P-glycoprotein.

The human multidrug resistance gene 1 (MDR1) encodes a plasma membrane P-glycoprotein (P-gp) that functions as an efflux pump for various structurally unrelated anticancer agents. We have identified two nonsynonymous germ-line mutations of the MDR1 gene, C3583T MDR1 and T3587G MDR1, in peripheral blood cell samples from Japanese cancer patients. Two patients carried the C3583T MDR1 allele that encodes H1195Y P-gp, whereas a further two carried T3587G MDR1 that encodes I1196S P-gp. Murine NIH3T3 cells were transfected with pCAL-MDR-IRES-ZEO constructs carrying either wild-type (WT), C3583T, or T3587G MDR1 cDNA and selected with zeocin. The resulting zeocin-resistant mixed populations of transfected cells were designated as 3T3/WT, 3T3/H1195Y, and 3T3/I1196S, respectively. The cell surface expression of I1196S P-gp in 3T3/I1196S cells could not be detected by fluorescence-activated cell sorting, although low expression of I1196S P-gp was found by Western blotting. H1195Y P-gp expression levels in 3T3/H1195Y cells were slightly lower than the corresponding WT P-gp levels in 3T3/WT cells. By immunoblotting analysis, both WT P-gp and H1195Y P-gp were detectable as a 145-kDa protein, whereas I1196S P-gp was visualized as a 140-kDa protein. 3T3/I1196S cells did not show any drug resistance unlike 3T3/H1195Y cells. Moreover, a vanadate-trap assay showed that the I1196S P-gp species lacks ATP-binding activity. Taken together, we conclude from these data that T3587G MDR1 expresses a nonfunctional P-gp and this is therefore the first description of such a germ-line mutation. We contend that the T3587G MDR1 mutation may affect the pharmacokinetics of MDR1-related anticancer agents in patients carrying this allele.

3T3 Cells↗

PubMed2006

Gene expression property of high-density three-dimensional tissue of HepG2 cells formed in radial-flow bioreactor.

In our previous study, we examined three-dimensional culture using 5-ml radial-flow bioreactor (RFB) and showed that genes encoding cell cycle related proteins were suppressed in a stable phase. In this study, we analyzed the gene expression profiles of RFB-cultivated HepG2 cells and found that vascular endothelial growth factor (VEGF) production was strongly induced in the stable phase compared with the growth phase or static two-dimensional culture. When human umbilical vein endothelial cells (HUVECs) were grown under the conditioned medium of the stable phase, it was found that the formation of new blood vessels was induced in the angiogenesis model. DNA microarray analysis showed that the expression levels of both genes related to cell cycle arrest and which are known as tumor markers have increased in the stable phase. This result suggests that HepG2 cells in the stable phase maintain an active tumor phenotype. In addition, the expression of genes induced in the hypoxic condition was also induced in the stable phase. When the culture was carried out under a higher dissolved oxygen (DO) concentration, VEGF production did not decrease significantly and the new blood-vessel-forming ability of the conditioned medium was not suppressed. This suggests that the induction of VEGF production in a stable phase is not affected by DO during the tested level. These results suggest that the RFB cell culture system may be used to assess tumor progression mechanism under three-dimensional condition in vitro.

Biomarkers, Tumor↗

PubMed2006

Genetic variation and haplotype structure of the ABC transporter gene ABCG2 in a Japanese population.

The ATP-binding cassette transporter, ABCG2, which is expressed at high levels in the intestine and liver, functions as an efflux transporter for many drugs, including clinically used anticancer agents such as topotecan and the active metabolite of irinotecan (SN-38). In this study, to elucidate the linkage disequilibrium (LD) profiles and haplotype structures of ABCG2, we have comprehensively searched for genetic variations in the putative promoter region, all the exons, and their flanking introns of ABCG2 from 177 Japanese cancer patients treated with irinotecan. Forty-three genetic variations, including 11 novel ones, were found: 5 in the 5'-flanking region, 13 in the coding exons, and 25 in the introns. In addition to 9 previously reported nonsynonymous single nucleotide polymorphisms (SNPs), 2 novel nonsynonymous SNPs, 38C>T (Ser13Leu) and 1060G>A (Gly354Arg), were found with minor allele frequencies of 0.3%. Based on the LD profiles between the SNPs and the estimated past recombination events, the region analyzed was divided into three blocks (Block -1, 1, and 2), each of which spans at least 0.2 kb, 46 kb, and 13 kb and contains 2, 24, and 17 variations, respectively. The two, eight, and five common haplotypes detected in 10 or more patients accounted for most (>90%) of the haplotypes inferred in Block -1, Block 1, and Block 2, respectively. The SNP and haplotype distributions in Japanese were different from those reported previously in Caucasians. This study provides fundamental information for the pharmacogenetic studies investigating the relationship between the genetic variations in ABCG2 and pharmacokinetic/pharmacodynamic parameters.

ATP Binding Cassette Transporter, Subfamily G, Mem↗

PubMed2006

Sequence-based analysis of the CYP2D636-CYP2D610 tandem-type arrangement, a major CYP2D6*10 haplotype in the Japanese population.

The frequency of the CYP2D6*10 allele (100C>T) in the Japanese is relatively high (0.3-0.4), and the two *10-related genes, Ch1 (currently *10B) and Ch2 (*36), and their tandem arrangement Ch(2)-Ch(1) (*36-*10B) have been reported. Although the tandem form of *36-*10 is assumed to be a major form, no detailed information has been reported for its intervening and flanking regions. Thus in this study, the tandem-type *36-*10B and the single-type *10 were analyzed by long-range PCR and sequencing of the subsequent nested PCR products. The sequence of the entire *36-*10 region confirmed the recombination of CYP2D6*10 with CYP2D7P. Also, we found that most of the *10B-harboring haplotypes have the upstream *36 gene and that the majority of the remaining haplotypes are the single-type *10B. Haplotype frequencies of the single-type *10 and *36-*10B were 0.06 and 0.30, respectively, in the subjects analyzed. Additionally, several novel single nucleotide polymorphisms (SNPs) were found in the *36 region and several *36 haplotypes were identified. This sequence information is an important addition to the CYP2D6 sequence data that was obtained by the human genome project.

3' Flanking Region↗

PubMed2006

Thirty novel genetic variations in the SLC29A1 gene encoding human equilibrative nucleoside transporter 1 (hENT1).

Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803_-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703_1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.051 for IVS8+169G>A, 0.012 for -7,947G>A, 0.006 for IVS1+141G>A and 1,703_1,704delGT, 0.004 for -8,166G>A, -8,110A>G, -3,548G>C, -1,355T>C, -34C>G, IVS8+44T>C, and 1,812C>T, and 0.002 for the other 19 variations. Among them, 177C>G and 1,288G>A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations.

5' Flanking Region↗

PubMed2006

Diverse structures of chimeric CYP-REP7/6-containing CYP2D6 and a novel defective CYP2D6 haplotype harboring single-type *36 and CYP-REP7/6 in Japanese.

Chimeric REP7/6 has been used as a marker of CYP2D6 deletion, such as for CYP2D6*5. However, the CYP2D6*10D (*10D) haplotype found in a Japanese population consist of CYP2D6*10B, CYP2D7P-derived 3'-flanking region, and a chimeric repetitive sequence, CYP-REP7/6 (REP7/6) (Ishiguro et al. Clin. Chim. Acta. 2004: 347, 217-221). From our analysis, REP7/6 was found in 26 out of 254 Japanese subjects. Thus, the REP7/6-containing CYP2D6 genes (2D6-REP7/6) were analyzed in detail. In order to specifically detect the 2D6-REP7/6 structure, primers were designed in CYP2D6 intron 6 and the REP7/6 3'-flanking region. Among 26 subjects analyzed by PCR, 5 had 2D6-REP7/6. The other 21 subjects were confirmed to have *5 by another *5-specific primer set. Three out of five subjects with 2D6-REP7/6 had the *10D structure. However, further analysis by PCR and sequencing revealed that their haplotypes were further divided into tandem-type *36-*10D (n=2) and single-type *10D (n=1). The remaining two subjects had a novel type of a *36-containing defective structure that consists of CYP2D6*36 and 3'-flanking REP7/6 (single-type *36-REP7/6). Then, REP7/6 sequences in *5, *10D, *36-*10D, and single-type *36 were determined and classified into 5 types: types A to D for *5, type E for *10D and *36-*10D, and type F for *36. These findings could be useful for accurate determination of *5 and REP7/6-harboring aberrant CYP2D6 haplotypes.

Asian People↗

PubMed2006

Fourteen novel genetic variations and haplotype structures of the TYMS gene encoding human thymidylate synthase (TS).

Forty genetic variations including 14 novel ones were found in the human TYMS gene, which encodes thymidylate synthase, in 263 Japanese cancer patients who received 5-fluorouracil (FU)-based chemotherapy. Three novel variations were located within the 28-bp tandem repeat sequence in the 5'-untranslated region (UTR) and were designated 5Rc, 3Rc-ins and 4Rc. Allele frequencies were 0.021 for 5Rc, 0.006 for 3Rc-ins and 0.002 for 4Rc. Other novel variations included -133G>C and -125G>C in the 5'-UTR; IVS1-278G>A, IVS2-68C>T, IVS2-23T>C, IVS4+122_+123insATTG, IVS4-141G>A, IVS5-100A>T and IVS6-111G>A in the introns; and 1244(*302)A>G and 1264(*322)G>A in the 3'-UTR. The allele frequencies were 0.34 for IVS4+122_+123insATTG, 0.042 for -133G>C, 0.011 for IVS4-141G>A, 0.006 for -125G>C, 0.004 for IVS1-278G>A, IVS2-68C>T, 1244(*302)A>G and 1264(*322)G>A, and 0.002 for IVS2-23T>C, IVS5-100A>T and IVS6-111G>A. Using the detected polymorphisms, linkage disequilibrium (LD) analysis was performed, which divided the TYMS gene into three LD blocks. The 28-bp tandem repeat sequence in the 5'-UTR was assigned as Block 2 with a total of 7 alleles. In Blocks 1 and 3, 7 and 19 haplotypes were determined/inferred, respectively. Our findings provide fundamental and useful information for genotyping TYMS in the Japanese and probably other Asian populations.

3' Untranslated Regions↗

PubMed2005

Functional analysis of three CYP1A2 variants found in a Japanese population.

Human cytochrome P450 1A2 (CYP1A2) catalyzes the metabolism of many important drugs and environmental chemicals. We previously reported three naturally occurring genetic polymorphisms (125C>G, Pro42Arg, CYP1A2*15; 1130G>A, Arg377Gln, *16; and 1367G>A, Arg456His, *8) found in a Japanese population. In this study, these variant enzymes were expressed in Chinese hamster V79 cells, and their mRNA and protein expression levels as well as catalytic activities were determined. All three variant enzymes showed reduced protein expression levels (66% for Pro42Arg and approximately 30% for Arg377Gln and Arg456His) compared with that of the wild type (WT) without any change in mRNA expression levels. Kinetic analysis for 7-ethoxyresorufin O-deethylation revealed that V(max) and V(max)/K(m) of all three variants were less than 3 and 1% of the WT, respectively, although the K(m) value was significantly increased only in the Arg377Gln variant (approximately a 9-fold increase). Markedly reduced activities of the three variants were also observed for phenacetin O-deethylation. In the reduced CO difference spectral analysis using recombinant proteins produced in the Sf21/baculovirus system, the peak at 450 nm seen in the WT protein was hardly observed in the three variants, suggesting marked reductions in their hemoprotein formation. These results suggest that Pro42, Arg377, and Arg456 are critical amino acids for the production of catalytically active CYP1A2 holoenzyme.

Animals↗

PubMed2005

Functional characterization of three naturally occurring single nucleotide polymorphisms in the CES2 gene encoding carboxylesterase 2 (HCE-2).

Twelve single nucleotide polymorphisms (SNPs) in the human CES2 gene, which encodes a carboxylesterase, hCE-2 [human carboxylesterase 2 (EC 3.1.1.1)], have been reported in the Japanese. In this report, we have examined functional alterations of three SNPs, a nonsynonymous SNP (100C>T, R34W), an SNP at the splice acceptor site in intron 8 (IVS8-2A>G), and one newly discovered nonsynonymous SNP (424G>A, V142M). For the two nonsynonymous SNPs, the corresponding variant cDNAs were expressed in COS-1 cells. Both the R34W and V142M variants showed little esterase activities toward the anticancer agent irinotecan and two typical carboxylesterase substrates, p-nitrophenol acetate and 4-methylumbelliferyl acetate, although increased levels of cDNA-mediated protein expression were observed by Western blotting as compared with the wild type. To investigate a possible splicing aberration in IVS8-2A>G, an in vitro splicing assay was utilized and transcripts derived from CES2 gene fragments of the wild type and IVS8-2A>G were compared. Sequence analysis of the cloned transcripts revealed that IVS8-2A>G yielded mostly aberrantly spliced transcripts, including a deleted exon or a 32-bp deletion proximal to the 5' end of exon 9, which resulted in truncated hCE-2 proteins. These results suggested that 100C>T (R34W), 424G>A (V142M), and IVS8-2A>G are functionally deficient SNPs.

Animals↗

PubMed2005

Functional analysis of four naturally occurring variants of human constitutive androstane receptor.

The human constitutive androstane receptor (CAR, NR1I3) is a member of the orphan nuclear receptor superfamily that plays an important role in the control of drug metabolism and disposition. In this study, we sequenced all the coding exons of the NR1I3 gene for 334 Japanese subjects. We identified three novel single nucleotide polymorphisms (SNPs) that induce non-synonymous alterations of amino acids (His246Arg, Leu308Pro, and Asn323Ser) residing in the ligand-binding domain of CAR, in addition to the Val133Gly variant, which was another CAR variant identified in our previous study. We performed functional analysis of these four naturally occurring CAR variants in COS-7 cells using a CYP3A4 promoter/enhancer reporter gene that includes the CAR responsive elements. The His246Arg variant caused marked reductions in both transactivation of the reporter gene and in the response to 6-(4-chlorophenyl)imidazo[2,1-b][1,3]thiazole-5-carbaldehyde O-(3,4-dichlorobenzyl)oxime (CITCO), which is a human CAR-specific agonist. The transactivation ability of the Leu308Pro variant was also significantly decreased, but its responsiveness to CITCO was not abrogated. The transactivation ability and CITCO response of the Val133Gly and Asn323Ser variants did not change as compared to the wild-type CAR. These data suggest that the His246Arg and Leu308Pro variants, especially His246Arg, may influence the expression of drug-metabolizing enzymes and transporters that are transactivated by CAR.

Animals↗

PubMed2005

Polymorphic tandem repeat sequences of the thymidylate synthase gene correlates with cellular-based sensitivity to fluoropyrimidine antitumor agents.

PURPOSE: Thymidylate synthase (TS) is one of the target molecules for the antitumor effects of fluoropyrimidine drugs. The cellular thymidylate synthase level is one of the determining factors for the antitumor activity of fluoropyrimidines. TYMS, which encodes TS, has been reported to possess 28-bp tandem repeat sequences in its 5'-untranslated region, the number of which varies. In addition, single nucleotide polymorphisms have also been shown in a triple repeat sequence. In this study, correlation between the polymorphic tandem repeat sequences of the TYMS gene and the antitumor activities of 5-fluorouracil (5-FU) and 5-fluoro-2'-deoxyuridine (FUdR) were investigated with 30 established human cell lines derived from solid tumors. METHODS: A reporter assay system was developed in order to compare the ability of the transactivation mediated by the double (2R) and triple (c- or g-type, 3Rc or 3Rg, respectively) repeat sequences using a human colon cancer cell line, DLD-1. The 50% inhibitory concentration (IC(50)) of cell growth by 5-FU and FUdR was measured with 30 different established cell lines of human solid tumors. Genotypes based on the number of the 28-bp TYMS tandem repeat for the above cell lines were determined by electrophoretical analysis of PCR products containing the repeat sequences and nucleotide sequencing. RESULTS: The reporter activity mediated by the 3Rg sequence was significantly higher than that by the 2R and 3Rc sequences. Activities mediated by the 2R and 3Rc sequences were comparable. According to the reporter assay, 2R and 3Rc were judged as low TS expression alleles and 3Rg as a high TS expression allele. On the basis of IC(50) values, cells possessing the 2R/2R and 2R/3R repeat of TYMS were significantly more sensitive to FUdR than those with the 3R/3R repeat. Cells possessing 3Rg/3Rg (a high TS expression genotype) were significantly less sensitive to FUdR than cells with 2R/2R, 2R/3Rc, and 3Rc/3Rc (low TS expression genotypes). CONCLUSIONS: Our results of the reporter assays using 2R, 3Rc, and 3Rg repeat sequences prompted us to classify 3Rg as a high TS expression allele, and 2R and 3Rc as low TS expression alleles. The cells with low TS expression alleles were shown to exhibit significantly higher FUdR sensitivity than the cells with high TS expression alleles for the first time. These results were consistent with numerous previous in vitro and in vivo findings that tumors showing high TS expression were less sensitive to fluoropyrimidines. These results support the idea that genotyping the tandem repeat sequences of TYMS in the 5'-untranslated region is useful for individualized therapy involving fluoropyrimidine antitumor drugs.

Antimetabolites, Antineoplastic↗

PubMed2005

Functional analysis of six human aryl hydrocarbon receptor variants in a Japanese population.

Aryl hydrocarbon receptor (AhR) is an important transcriptional regulator involved in the induction of CYP1A1, CYP1A2, CYP1B1, UGT1A1, and UGT1A6. In this study, functional properties of four novel naturally occurring human AhR variants (K401R, N487D, I514T, and K17T/R554K) were examined along with the single variants K17T and R554K. The luciferase reporter assay using the CYP1A1 promoter reporter in HeLa cells treated with beta-naphthoflavone or 3-methylcholanthrene, which are known as typical agonists for AhR, showed that reporter activities of the K401R and N487D variants were reduced to 40 to 58% of those of wild-type (WT) but not of the other variants. Similarly, the K401R and N487D variants also reduced the omeprazole-induced reporter activities to approximately 56 and 74% of those of the WT, respectively. The reduced activities of the two variants were probably caused by the reduced protein expression levels, since the protein levels of the K401R and N487D variants were approximately 52 and 47% of the WT, respectively, without any changes in their mRNA levels. The reduced protein levels were recovered by treatment with a proteasome inhibitor MG132 [N-benzoyloxycarbonyl (Z)-Leu-Leu-leucinal], suggesting that the reduced protein levels were caused by the accelerated proteasomal degradation by a proteasome. Together, the current data demonstrate that the K401R and N487D variants reduce their apparent transcriptional activities, both ligand-induced and omeprazole-induced activation, probably through reduced protein expression. Thus, these two variants may influence drug metabolism through reduced induction of CYP1A1 and other target enzymes.

Genes, Reporter↗

PubMed2005

Severe drug toxicity associated with a single-nucleotide polymorphism of the cytidine deaminase gene in a Japanese cancer patient treated with gemcitabine plus cisplatin.

PURPOSE: We investigated single-nucleotide polymorphisms of the cytidine deaminase gene (CDA), which encodes an enzyme that metabolizes gemcitabine, to clarify the relationship between the single-nucleotide polymorphism 208G>A and the pharmacokinetics and toxicity of gemcitabine in cancer patients treated with gemcitabine plus cisplatin. EXPERIMENTAL DESIGN: Six Japanese cancer patients treated with gemcitabine plus cisplatin were examined. Plasma gemcitabine and its metabolite 2',2'-difluorodeoxyuridine were measured using an high-performance liquid chromatography method, and the CDA genotypes were determined with DNA sequencing. RESULTS: One patient, a 45-year-old man with pancreatic carcinoma, showed severe hematologic and nonhematologic toxicities during the first course of chemotherapy with gemcitabine and cisplatin. The area under the concentration-time curve value of gemcitabine in this patient (54.54 microg hour/mL) was five times higher than the average value for five other patients (10.88 microg hour/mL) treated with gemcitabine plus cisplatin. The area under the concentration-time curve of 2',2'-difluorodeoxyuridine in this patient (41.58 microg hour/mL) was less than the half of the average value of the five patients (106.13 microg hour/mL). This patient was found to be homozygous for 208A (Thr70) in the CDA gene, whereas the other patients were homozygous for 208G (Ala70). CONCLUSION: Homozygous 208G>A alteration in CDA might have caused the severe drug toxicity experienced by a Japanese cancer patient treated with gemcitabine plus cisplatin.

Aged↗

PubMed2005

Functional characterization of five novel CYP2C8 variants, G171S, R186X, R186G, K247R, and K383N, found in a Japanese population.

Cytochrome P450 2C8 is one of the primary enzymes responsible for the metabolism of a wide range of drugs such as paclitaxel, cerivastatin, and amiodarone. We have sequenced the CYP2C8 gene from 201 Japanese subjects and found five novel nonsynonymous single nucleotide polymorphisms (SNPs): 511G>A (G171S), 556C>T (R186X; X represents the translational stop codon), 556C>G (R186G), 740A>G (K247R), and 1149G>T (K383N), with the allele frequency of 0.0025. The CYP2C8 variants were heterologously expressed in COS-1 cells and functionally characterized in terms of expression level, paclitaxel 6alpha-hydroxylase activity, and intracellular localization. The prematurely terminated R186X variant was undetectable by Western blotting and inactive toward paclitaxel 6alpha-hydroxylation. The G171S, K247R, and K383N variants exhibited properties similar to those of the wild-type CYP2C8. Paclitaxel 6alpha-hydroxylase activity of the R186G transfectant was only 10 to 20% that of wild-type CYP2C8. Furthermore, the R186G variant displayed a lower level of protein expression in comparison to the wild type, which was restored by the addition of a proteasome inhibitor (MG-132; Z-Leu-Leu-Leu-aldehyde). The reduced CO-difference spectral analysis using recombinant proteins from an insect cell/baculovirus system revealed that the R186G variant has a minor peak at 420 nm in addition to the characteristic Soret peak at 450 nm, suggesting the existence of improperly folded protein. These results indicate that the novel CYP2C8 SNPs, 556C>T (R186X) and 556C>G (R186G), could influence the metabolism of CYP2C8 substrates such as paclitaxel and cerivastatin.

Animals↗

PubMed2005

Haplotype structures of EPHX1 and their effects on the metabolism of carbamazepine-10,11-epoxide in Japanese epileptic patients.

OBJECTIVE: Microsomal epoxide hydrolase (mEH) is an enzyme that detoxifies reactive epoxides and catalyzes the biotransformation of carbamazepine-10,11-epoxide (CBZ-epoxide) to carbamazepine-10,11-diol (CBZ-diol). Utilizing single nucleotide polymorphisms (SNPs) of the EPHX1 gene encoding mEH, we identified the haplotypes of EPHX1 blocks and investigated the association between the block haplotypes and CBZ-epoxide metabolism. METHODS: SNPs of EPHX1 were analyzed by means of polymerase chain reaction amplification and DNA sequencing using DNA extracted from the blood leukocytes of 96 Japanese epileptic patients, including 58 carbamazepine-administered patients. The plasma concentrations of CBZ and its four metabolites were determined using high-performance liquid chromatography. RESULTS: From sequencing all 9 exons and their surrounding introns, 29 SNPs were found in EPHX1. The SNPs were separated into three blocks on the basis of linkage disequilibrium, and the block haplotype combinations (diplotypes) were assigned. Using plasma CBZ-diol/CBZ-epoxide ratios (diol/epoxide ratios) indicative of the mEH activity, the effects of the diplotypes in each EPHX1 block were analyzed on CBZ-epoxide metabolism. In block 2, the diol/epoxide ratios increased significantly depending on the number of haplotype *2 bearing Y113H (P=0.0241). In block 3, the ratios decreased depending on the number of haplotype *2 bearing H139R (P=0.0351). Also, an increasing effect of a *1 subtype, *1c, was observed on the ratio. CONCLUSION: These results show that some EPHX1 haplotypes are associated with altered CBZ-epoxide metabolism. This is the first report on the haplotype structures of EPHX1 and their potential in vivo effects.

Adolescent↗