Biomedical subjects
Publications and source records attributed to Stephen Neidle.
A series of G-quadruplex stabilizing compounds have been prepared via click chemistry employing the Cu(I)-catalyzed Huisgen reaction. These compounds were shown to bind tightly to G-quadruplex DNA even in the presence of competing high concentrations of duplex DNA. Furthermore, a modified TRAP assay has shown that some of these compounds also inhibit telomerase at low micromolar concentration.
We describe the identification of small-molecule G-quadruplex ligands using a direct ELISA screen of a one-bead-one-compound library of unnatural polyamides displayed on a branched linker with a biotin tag. This general purpose parallel screen for small molecule-oligonucleotide interactions was validated by surface plasmon resonance and ELISA of resynthesized compounds. Linear polyamides displayed similar rankings in their affinity for quadruplex as their branched counterparts. Quadruplex affinity as judged by these surface based techniques was a useful predictor of the ability of the ligands to stabilize the quadruplex to thermal unfolding in solution.
G-quadruplexes are higher-order DNA and RNA structures formed from G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential quadruplex sequences have been identified in G-rich eukaryotic telomeres, and more recently in non-telomeric genomic DNA, e.g. in nuclease-hypersensitive promoter regions. The natural role and biological validation of these structures is starting to be explored, and there is particular interest in them as targets for therapeutic intervention. This survey focuses on the folding and structural features on quadruplexes formed from telomeric and non-telomeric DNA sequences, and examines fundamental aspects of topology and the emerging relationships with sequence. Emphasis is placed on information from the high-resolution methods of X-ray crystallography and NMR, and their scope and current limitations are discussed. Such information, together with biological insights, will be important for the discovery of drugs targeting quadruplexes from particular genes.
A number of amide-linked oligopyrroles based on distamycin molecules have been synthesized by solid-state methods, and their interactions with a human intramolecular G-quadruplex have been measured by a melting procedure. Several of these molecules show an enhanced ratio of quadruplex vs. duplex DNA binding compared to distamycin itself, including one with a 2,5-disubstituted pyrrole group. Quadruplex affinity increases with the number of pyrrole groups, and it is suggested that this is consistent with a mixed groove/G-quartet stacking binding mode.
The utility of the two docking programs DOCK and AutoDock in studying the binding of small molecules to the minor groove of B-DNA is examined. The AutoDock program is found to be more effective in both pose prediction and ranking of known binders over random compounds, and this superior performance is shown to be because of the scoring functions rather than the sampling algorithms.
The c-kit gene encodes a receptor tyrosine kinase, whose engagement by its ligand triggers signals leading to cell proliferation. c-kit activity is elevated in gastrointestinal stromal tumors (GISTs), and its therapeutic inhibition by small molecules such as imatinib is clinically validated. We identified a putative quadruplex forming 21-nucleotide sequence upstream of the c-kit transcription initiation site (c-kit21), on the G-rich strand, which occupies a site required for core promoter activity. Here, we show by nuclear magnetic resonance (NMR), circular dichroism (CD), and ultraviolet (UV) spectroscopic methods that c-kit21 forms quadruplexes under physiological conditions. Mutational analysis of c-kit21 has provided insights into its structural polymorphism. In particular, one mutated form appears to form a single quadruplex species that adopts a parallel conformation. The quadruplex-forming sequence shows a high level of sequence conservation across human, mouse, rat, and chimpanzee. The small variation in sequence between the quadruplex in human/chimpanzee as compared to the rat/mouse was examined more closely by biophysical methods. Despite a variation in the sequence and length of loop 2, the quadruplexes showed both comparable CD spectra, indicative of parallel quadruplexes, and also similar thermal-stability profiles, suggesting conservation of biophysical characteristics. Collectively, the evidence suggests that this quadruplex is a serious target for a detailed functional investigation at the cell-biology level.
Combining structure-specific recognition of nucleic acids with limited sequence reading is a promising method to reduce the size of the recognition unit required to achieve the necessary selectivity and binding affinity to control function. It has been demonstrated recently that G-quadruplex DNA structures can be targeted by organic cations in a structure-specific manner. Structural targets of quadruplexes include the planar end surfaces of the G-tetrad stacked columns and four grooves. These provide different geometries and functional groups relative to duplex DNA. We have used surface plasmon resonance and isothermal titration calorimetry to show that binding affinity and selectivity of a series of quadruplex end-stacking molecules to human telomeric DNA are sensitive to compound shape as well as substituent type and position. ITC results indicate that binding is largely enthalpy driven. Circular dichroism was also used to identify a group of structurally related compounds that selectively target quadruplex grooves.
Two new alkylamine-substituted nickel(II)-salphen complexes have been prepared and their interactions with DNA investigated. FRET studies have shown that these complexes have a remarkable ability to stabilize G-quadruplex DNA. Furthermore, TRAP/Taq assays have shown that these complexes inhibit telomerase at low micromolar concentrations.
The topology of DNA quadruplexes depends on the nature and number of the nucleotides linking G-quartet motifs. To assess the effects of a three-nucleotide TTT linker, the crystal structure of the DNA sequence d(G(4)T(3)G(4)) has been determined at 1.5 A resolution, together with that of the brominated analogue d(G(4)(Br)UTTG(4)) at 2.4 A resolution. Both sequences form bimolecular intermolecular G-quadruplexes with lateral loops. d(G(4)(Br)UTTG(4)) crystallized in the monoclinic space group P2(1) with three quadruplex molecules in the asymmetric unit, two associating together as a head-to-head stacked dimer, and the third as a single head-to-tail dimer. The head-to-head dimers have two lateral loops on the same G-quadruplex face and form an eight-G-quartet stack, with a linear array of seven K(+) ions between the quartets. d(G(4)T(3)G(4)) crystallized in the orthorhombic space group C222 and has a structure very similar to the head-to-tail dimer in the P2(1) unit cell. The sequence studied here is able to form several different folds; however, all four quadruplexes in the two structures have lateral loops, in contrast to the diagonal loops reported for the analogous quadruplex with T(4) loops. A total of seven independent T(3) loops were observed in the two structures. These can be classified into two discrete conformational classes, suggesting that these represent preferred loop conformations that are independent of crystal-packing forces.
We have used a combination of simulated annealing (SA), molecular dynamics (MD) and locally enhanced sampling (LES) methods in order to predict the favourable topologies and loop conformations of dimeric DNA quadruplexes with T2 or T3 loops. This follows on from our previous MD simulation studies on the influence of loop lengths on the topology of intramolecular quadruplex structures [P. Hazel et al. (2004) J. Am. Chem. Soc., 126, 16 405-16 415], which provided results consistent with biophysical data. The recent crystal structures of d(G4T3G4)2 and d(G4BrUT2G4) (P. Hazel et al. (2006) J. Am. Chem. Soc., in press) and the NMR-determined topology of d(TG4T2G4T)2 [A.T. Phan et al. (2004) J. Mol. Biol., 338, 93-102] have been used in the present study for comparison with simulation results. These together with MM-PBSA free-energy calculations indicate that lateral T3 loops are favoured over diagonal loops, in accordance with the experimental structures; however, distinct loop conformations have been predicted to be favoured compared to those found experimentally. Several lateral and diagonal loop conformations have been found to be similar in energy. The simulations suggest an explanation for the distinct patterns of observed dimer topology for sequences with T3 and T2 loops, which depend on the loop lengths, rather than only on G-quartet stability.
We describe new methodology for the synthesis of symmetric bis-benzimidazoles carrying 2-aryl moieties, including 2-[4-(3'-aminopropoxy)phenyl] and 2-[4-(3'-aminopropanamido)phenyl] substituents, together with the synthesis of novel hybrid molecules comprising bis-benzimidazoles in ester and amide combination with the N-mustard chlorambucil. The in vitro activities of these compounds against five cancer cell lines are also provided.
We have recently described an engineered zinc finger protein (Gq1) that binds with high specificity to the intramolecular G-quadruplex formed by the human telomeric sequence 5'-(GGTTAG)(5)-3', and that inhibits the activity of the enzyme telomerase in vitro. Here we report site-directed mutagenesis, biophysical, and molecular modeling studies that provide new insights into quadruplex recognition by the zinc finger scaffold. We show that any one finger of Gq1 can be replaced with the corresponding finger of Zif268, without significant loss of quadruplex affinity or quadruplex versus duplex discrimination. Replacement of two fingers, with one being finger 2, of Gq1 by Zif268 results in significant impairment of quadruplex recognition and loss of discrimination. Molecular modeling suggests that the zinc fingers of Gq1 can bind to the human parallel-stranded quadruplex structure in a stable arrangement, whereas Zif268-quadruplex models show significantly weaker binding energy. Modeling also suggests that an important role of the key protein finger residues in the Gq1-quadruplex complex is to maintain Gq1 in an optimum conformation for quadruplex recognition.
The synthesis is reported of a group of 3,6,9-trisubstituted acridine compounds as telomeric quadruplex-stabilizing ligands with systematic variations at the 3-, 6-, and 9-positions. A new microwave-assisted methodology has been developed for trisubstituted acridine synthesis. Structure-activity relationships are reported using surface plasmon resonance and a fluorescence melting assay to examine quadruplex binding, together with a telomerase inhibition assay. These reveal relationships between G-quadruplex stabilization and telomerase inhibition and optimal 3,6- and 9-substituent side-chain lengths for maximal activity. Qualitative molecular modeling using molecular dynamics simulations has been undertaken on four quadruplex-DNA complexes. Long-term exposure of MCF7 cancer cells to a subset of the most active compounds, at doses lower than the IC(50) values, showed that one compound produced a marked decrease in population growth, accompanied by senescence, which is consistent with telomere targeting by this agent.
The interaction of the natural alkaloid berberine with various G-quadruplex DNA structures and its ability to inhibit telomerase have been examined and compared with those of a synthetic piperidino derivative and the related compound coralyne. The results show that these molecules have selectivity for G-quadruplex compared to duplex DNA, and that their aromatic moieties play a dominant role in quadruplex binding.
DB921 and DB911 are benzimidazole-biphenyl isomers with terminal charged amidines. DB911 has a central meta-substituted phenyl that gives it a shape similar to those of known minor groove binding compounds. DB921 has a central para-substituted phenyl with a linear conformation that lacks the appropriate radius of curvature to match the groove shape. It is thus expected that DB911, but not DB921, should be an effective minor groove binder, but we find that DB921 not only binds in the groove but also has an unusually high binding constant in SPR experiments (2.9 x 10(8) M(-)(1), vs 2.1 x 10(7) M(-)(1) for DB911). ITC thermodynamic analysis with an AATT sequence shows that the stronger binding of DB921 is due to a more favorable binding enthalpy relative to that of DB911. CD results support minor groove binding for both compounds but do not provide an explanation for the binding of DB921. X-ray crystallographic analysis of DB921 bound to AATT shows that an induced fit structural change in DB921 reduces the twist of the biphenyl to complement the groove, and places the functional groups in position to interact with bases at the floor of the groove. The phenylamidine of DB921 forms indirect contacts with the bases through a bound water. The DB921-water pair forms a curved binding module that matches the shape of the minor groove and provides a number of strong interactions that are not possible with DB911. This result suggests that traditional views of compound curvature required for minor groove complex formation should be reevaluated.
The crystal structure of the DNA minor groove biphenyl benzimidazole diamidine ligand DB819 has been determined, bound to the DNA sequence d(CGCGAATTCGCG)(2), at a resolution of 1.36 Angstrom. Conditions for reliable in silico docking that reproduce the observed position of the ligand in the minor groove have been determined.
The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.
We report here the results of a systematic search for the existence and prevalence of potential intramolecular G-quadruplex forming sequences in the human genome. We have also examined the tendency for particular sequences of 'loop' regions to occur in particular positions with respect to the G-tracts in a quadruplex. Using arithmetic ratio and probability techniques we have discovered frequent and systematic occurrence of certain sequence types, the most prominent being a potential quadruplex containing CCTGT in the first 'loop' position. Being able to highlight types of potential quadruplex sequences in G-rich regions is an important step in searching for biologically relevant sequences and finding their function.