PubMed Health⌕ Search

Biomedical subjects

Sumiko Inouye

Publications and source records attributed to Sumiko Inouye.

At least 19 recordsLinked to original sources
PubMed2006

A novel regulation on developmental gene expression of fruiting body formation in Myxobacteria.

Myxobacteria are Gram-negative soil microorganisms that prey on other microorganisms. Myxobacteria have significant potential for applications in biotechnology because of their extraordinary ability to produce natural products such as secondary metabolites. Myxobacteria also stand out as model organisms for the study of cell-cell interactions and multicellular development during their complex life cycle. Cellular morphogenesis during multicellular development in myxobacteria is very similar to that in the eukaryotic soil amoebae. Recent studies have started uncovering molecular mechanisms directing the myxobacterial life cycle. We describe recent studies on signal transduction and gene expression during multicellular development in the myxobacterium Myxococcus xanthus. We provide our current model for signal transduction pathways mediated by a two-component His-Asp phosphorelay system and a Ser/Thr kinase cascade.

Gene Expression Regulation, Bacterial↗
PubMed2006

A protein Ser/Thr kinase cascade negatively regulates the DNA-binding activity of MrpC, a smaller form of which may be necessary for the Myxococcus xanthus development.

The developmental process of Myxococcus xanthus is achieved by the expression of a specific set of genes under the influence of developmental signals. MrpC is a member of the CRP family of transcription regulators, essential for fruA expression during development. The Pkn8-Pkn14 protein kinase cascade negatively regulates mrpC expression (H. Nariya and S. Inouye, 2005. Mol Microbiol 58: 367-379). Elevated levels of mrpC in pkn8 and pkn14 deletion strains (Deltapkn8 and Deltapkn14) induce untimely FruA production during vegetative growth resulting in significantly faster fruiting body development. mrpC expression is presumably activated by MrpA and MrpB which belong to a two-component His-Asp phosphorelay system and is proposed to require MrpC on the basis of the genetic analysis. In the present study, we demonstrate that MrpC binds to at least eight sites in the upstream region of its promoter. Based on analysis of MrpC binding sites in the mrpC and fruA promoter regions, there are two types of MrpC-specific binding sequences. Importantly, MrpC-binding activity was greatly reduced upon its phosphorylation by Pkn14. MrpC2, a transcription activator for fruA expression, lacks the N-terminal 25 residues of MrpC and exhibited four- and eightfold greater binding activity to the mrpC and fruA promoter regions respectively. Pkn14 was not able to phosphorylate MrpC2 and phosphorylates MrpC at Thr residue(s), thus Thr-21 and/or Thr-22 is (are) the likely site(s) of MrpC phosphorylation. MrpC2 was not detected in a lonD mutant in which fruA expression is low. Thus, the LonD protease essential for development may play an important role for the activation of MrpC-binding activity through its proteolytic processing to MrpC2, required for developmental progression. MrpC2, only detectable during development in DZF1, was present at high levels during vegetative growth in Deltapkn8 and Deltapkn14, thus MrpC phosphorylation may inhibit its proteolytic processing. Based on these results, we propose a mechanism by which two transcription factors essential to development, MrpC and FruA, are regulated during the M. xanthus life cycle.

Amino Acid Sequence↗
PubMed2005

Identification of a gene involved in polysaccharide export as a transcription target of FruA, an essential factor for Myxococcus xanthus development.

Fruiting body development in Myxococcus xanthus is a multicellular event that is coordinated by exchanging intercellular signals. FruA is a transcription factor essential for fruiting body development and is thought to play a key role in the C-signal pathway. Here we present the first identification of a gene regulated by FruA. The gene was isolated from a genomic library via in vitro selection in a DNA binding assay by using the DNA-binding domain of FruA tagged with His(8) at the C-terminal end (FruA-DBD-H(8)). The gene, named fdgA (FruA-dependent gene A), encodes a protein homologous to the outer-membrane auxiliary family protein involved in the polysaccharide export system. FruA-DBD-H(8) bound the upstream promoter region of the fdgA gene from nucleotide -89 to nucleotide -64 with respect to the transcription initiation site, which was required for the induction of fdgA expression during development. fdgA mRNA induced during development was absent in a fruA deletion strain. The deletion of fdgA resulted in defective fruiting body formation and reduced sporulation efficiency (1% that of the parent strain). Moreover, FruA was required for the developmental expression of sasA, which is also involved in the biosynthesis of the lipopolysaccharide O-antigen and is required for fruiting body development. Furthermore, the expression of both fdgA and sasA was partially dependent on the C-signal. These findings expand our understanding of the signal transduction pathway mediated by FruA during development in M. xanthus.

Amino Acid Sequence↗
PubMed2005

Modulating factors for the Pkn4 kinase cascade in regulating 6-phosphofructokinase in Myxococcus xanthus.

Myxococcus xanthus, a Gram-negative developmental bacterium, contains a large number of protein Ser/Thr kinases (PSTKs). Among these PSTKs, Pkn4 has been shown to be 6-phosphofructokinase (PFK) kinase. PFK associates with the regulatory domain of Pkn4 (Pkn4RD) and is activated by Pkn4-mediated phosphorylation. The activation of PFK is required to consume glycogen accumulated during early development and is essential for efficient sporulation. Using the yeast two-hybrid screen, we identified three new factors, MkapA, MkapB and MkapC, that interact with Pkn4 and each contains well-known protein-protein interaction domains. MkapB contains eight tandem repeats of the TPR (tetratrico peptide repeat) domain and its interaction with Pkn4RD was phosphorylation-dependent. MkapB remained associated with Pkn4RD. As a result, Pkn4 did not interact with PFK and its activation was inhibited. While deletion of the pfk-pkn4 operon did not inhibit fruiting body formation, the spore yield was low. In contrast, a mkapB deletion mutant exhibited a 24 h delay in fruiting body formation, accumulated less glycogen in the stationary phase and gave rise to 3.2% spore formation as opposed to 100% attained with DZF1. In addition to Pkn4, MkapA associated with other membrane-associated PSTKs, Pkn1, Pkn2, Pkn8 and Pkn9, while MkapB associated with Pkn8 and Pkn9, and MkapC with Pkn8. These results indicate that there are complex PSTK networks in M. xanthus that share common modulating factors.

Amino Acid Sequence↗
PubMed2005

Identification of a protein Ser/Thr kinase cascade that regulates essential transcriptional activators in Myxococcus xanthus development.

Pkn8 is a membrane-associated protein Ser/Thr kinase (PSTK) of Myxoccocus xanthus that was previously found to associate with a novel cytoplasmic kinase, Pkn14. In the present study, MrpC, an essential transcription factor for fruA expression during fruiting body development, was identified using a genomic yeast two-hybrid screen with Pkn14 as bait. Our biochemical studies demonstrated that purified Pkn8 and Pkn14 are active kinases and that Pkn8 is able to phosphorylate Pkn14 that forms a tetramer via its C-terminal 41 residues. Moreover, Pkn14 phosphorylated purified MrpC, indicating that Pkn8 is a Pkn14 kinase and Pkn14 is an MrpC kinase. The pkn8 and pkn14 deletion strains (Deltapkn8 and Deltapkn14) developed into fruiting bodies significantly faster than that of the parent strain, DZF1. While mrpC expression was at a low level in DZF1 during vegetative growth, it was highly elevated in Deltapkn8 and Deltapkn14 during vegetative growth and development. Furthermore, FruA, usually induced at 6 h of development, was instead detected at the early stationary phase and accumulated faster during development in Deltapkn8 and Deltapkn14. Therefore, the developmental phenotype of Deltapkn8 and Deltapkn14 seems to be due to untimely FruA production mediated by elevated levels of MrpC in Deltapkn8 and Deltapkn14 during vegetative growth. As pkn14 expression was increased at the mid- and late-log. phases in DZF1 but decreased during development, the Pkn8-Pkn14 kinase cascade appears to negatively regulate mrpC expression by phosphorylating MrpC during vegetative growth. This is the first demonstration of a functional PSTK cascade in prokaryotes. mrpC expression has been proposed to be activated by MrpA and MrpB which belong to a two-component His-Asp phosphorelay signal transduction system and that MrpC autoregulate its own expression (Sun H. and Shi W., 2001 J Bacteriol 183: 4786-4795). Therefore, M. xanthus seems to utilize both eukaryotic PSTK cascade and prokaryotic His-Asp phosphorelay system to precisely regulate mrpC expression with specific timing during development.

Amino Acid Sequence↗
PubMed2005

Characterization of a small heat shock protein, Mx Hsp16.6, of Myxococcus xanthus.

A number of heat shock proteins in Myxococcus xanthus were previously identified by two-dimensional (2D) gel electrophoresis. One of these protein was termed Mx Hsp16.6, and the gene encoding Mx Hsp16.6 was isolated. Mx Hsp16.6 consists of 147 amino acid residues and has an estimated molecular weight of 16,642, in accordance with the apparent molecular mass in the 2D gel. An alpha-crystallin domain, typically conserved in small heat shock proteins, was found in Mx Hsp16.6. Mx Hsp16.6 was not detected during normal vegetative growth but was immediately induced after heat shock. Expression of the hsp16.6 gene was not induced by other stresses, such as starvation, oxidation, and high osmolarity. Mx Hsp16.6 was mostly localized in particles formed after heat shock and precipitated by low-speed centrifugation. Furthermore, Mx Hsp16.6 was detected in highly electron-dense particles in heat-shocked cells by immunoelectron microscopy, suggesting that it forms large complexes with heat-denatured proteins. An insertion mutation in the hsp16.6 gene resulted in lower viability during heat shock and lower acquired thermotolerance. Therefore, it is likely that Mx Hsp16.6 plays critical roles in the heat shock response in M. xanthus.

Amino Acid Sequence↗
PubMed2005

SigF, a new sigma factor required for a motility system of Myxococcus xanthus.

A new sigma factor, SigF, was identified from the social and developmental bacterium Myxococcus xanthus. SigF is required for fruiting body formation during development as well as social motility during vegetative growth. Analysis of gene expression indicates that it is possible that the sigF gene is involved in regulation of an unidentified gene for social motility.

Amino Acid Sequence↗
PubMed2005

Factors that modulate the Pkn4 kinase cascade in Myxococcus xanthus.

Myxococcus xanthus, a gram-negative developmental bacterium, contains a large number of protein Ser/Thr kinases (PSTKs). Among these PSTKs, Pkn4 is shown to be 6-phosphofructokinase (PFK) kinase. PFK associates with the regulatory domain of Pkn4 (Pkn4RD) and is activated 2.7-fold upon phosphorylation at Thr-226 by Pkn4. The activation of PFK is required to consume glycogen accumulated during early development and is essential for efficient sporulation. Three new factors, MkapA, MkapB and MkapC have been identified that associate with Pkn4 by the yeast two-hybrid screen and each contains well-known protein-protein interaction domains. MkapB interacts with Pkn4 in a phosphorylation-dependent manner and remains associated with Pkn4 after its phosphorylation. Binding of MkapB to Pkn4 prevents the interaction of Pkn4 with PFK and consequently PFK phosphorylation and activation. A pfk-pkn4 deletion mutant accumulates glycogen at a rate two folds higher than the parent strain, DZF1, at the stationary phase and early development stage, it is unable to consume glycogen during development and produces only 3.4% of the DZF1 spore yield. In contrast, an mkapB deletion mutant exhibits a 24 h delay in fruiting body formation, accumulates less glycogen in the stationary phase and gives rise to 6.4% of the DZF1 spore yield. In addition to Pkn4, MkapA associates with other membrane-associated PSTKs, Pkn1, Pkn2, Pkn8 and Pkn9, while MkapB associates with Pkn8 and Pkn9, and MkapC with Pkn8. These results indicate that there are complex PSTK networks in M. xanthus sharing common modulating factors.

Bacterial Proteins↗
PubMed2004

Complex formation between a putative 66-residue thumb domain of bacterial reverse transcriptase RT-Ec86 and the primer recognition RNA.

Reverse transcriptases (RT) are found in a minor population of Escherichia coli and are responsible for the synthesis of multicopy single-stranded DNA. These RTs specifically recognize RNA structures in their individual primer-template RNAs to initiate cDNA synthesis from the 2'-OH group of a specific internal G residue (branching G residue). Here, we purified the 66-residue, C-terminal fragment of RT-Ec86, RT from E. coli, which is responsible for the synthesis of multicopy single-stranded DNA-Ec86. This fragment, RT-Ec86-(255-320), was found to consist mainly of alpha-helical structures on the basis of its CD spectrum, which is consistent with the prediction of this region as the thumb domain from the structural alignment of RT-Ec86 with human immunodeficiency virus-1 RT. RT-Ec86-(255-320) was able to bind to a 28-base synthetic RNA consisting of the 5'-end single-stranded RNA containing the branching G residue and the recognition stem-loop structure in the RT-Ec86 primer-template RNA with a Kd value of 5 x 10(-8) M. By stepwise shortening of the 5'-end single-stranded region of the RNA, RT-Ec86-(255-320) was found still to be able to form a stable complex with only the stem-loop structure consisting of an 8-bp stem and a 3-base loop. In this stem-loop structure, the UUU loop was essential for the complex formation. RT-Ec73-(251-316) from another E. coli RT could not bind to the 28-base RNA for RT-Ec86 but could bind to its own stem-loop structure having a 3-base AGU loop. These results support the notion that the highly diverse C-terminal regions of bacterial RTs play an important role in recognizing their own specific primer-template RNA structure for the cDNA priming reaction.

Amino Acid Sequence↗
PubMed2003

Identification of an activator protein required for the induction of fruA, a gene essential for fruiting body development in Myxococcus xanthus.

Myxococcus xanthus exhibits social behavior and multicellular development. FruA is an essential transcription factor for fruiting body development in M. xanthus. In the present study, the upstream promoter region was found to be necessary for the induction of fruA expression during development. A cis-acting element required for the induction was identified and was located between nucleotides -154 and -107 with respect to the transcription initiation site. In addition, it was found that two binding sites exist within this element of the fruA promoter. By using DNA affinity column chromatography containing the cis-acting element, a fruA promoter-binding protein was purified. The purified protein was shown by N-terminal sequence analysis to be identical to MrpC, a protein identified previously by transposon insertion mutagenesis as an essential locus for fruiting body development [Sun, H. & Shi, W. (2001) J. Bacteriol. 183, 4786-4795]. Furthermore, fruA mRNA was not detectable in the mrpC::km strain, demonstrating that MrpC is essential for fruA expression. Moreover, mutational analysis of the binding sites for MrpC in the fruA promoter indicates that binding of MrpC activates transcription of fruA in vivo. This report provides evidence for a direct molecular interaction involved in temporally regulated gene expression in M. xanthus.

Amino Acid Sequence↗
PubMed2003

An effective sporulation of Myxococcus xanthus requires glycogen consumption via Pkn4-activated 6-phosphofructokinase.

6-Phosphofructokinase (PFK) is a key enzyme for glycolysis in both prokaryotes and eukaryotes. Previously, it was found that the activity of Myxococcus xanthus PFK increased 2.7-fold upon phosphorylation at Thr-226 by the Ser/Thr kinase Pkn4. The pkn4 gene is located 18 bp downstream of the pfk gene forming an operon, and both genes are expressed during vegetative growth and development. Here, we show that glycogen, which accumulates during stationary phase and early in development, is consumed during sporulation. A pfk-pkn4 deletion strain accumulated glycogen at a higher level than the wild-type strain, was unable to consume glycogen during developmental progression and exhibited a poor spore yield. From genetic complementation analysis of the pfk-pkn4 deletion strain with the pfk and pkn4 genes, it was found that glycogen consumption and a high spore yield require not only the pfk gene but also the pkn4 gene. Furthermore, phosphorylation is critical for glycogen consumption because the pfk gene engineered to express the mutant PFK (Thr-226-Ala) did not complement a pfk mutant. We propose that glycogen metabolism in M. xanthus is regulated in a similar manner to that in eukaryotes requiring a protein Ser/Thr kinase.

Bacterial Proteins↗
PubMed2003

Novel developmental genes, fruCD, of Myxococcus xanthus: involvement of a cell division protein in multicellular development.

Myxococcus xanthus is a gram-negative soil bacterium that undergoes multicellular development upon nutrient starvation. In the present study, two novel developmental genes, fruC and fruD, of M. xanthus were identified and characterized. The FruD protein has significant amino acid sequence similarity to the DivIVA proteins of many bacteria including Bacillus subtilis. Vegetative cells of the fruD mutant exhibited a filamentous phenotype. The fruC and fruD mutants displayed similar delayed-development phenotypes. The formation of tightly aggregated mounds by fruC and fruD mutants was slower than that by the wild-type strain. Spore formation by the fruC and fruD mutants initiated after 30 h poststarvation, whereas wild-type M. xanthus initiated spore formation after 18 h. The fruCD genes were constitutively expressed as an operon during vegetative growth and development. S1 mapping revealed that transcription initiation sites of the fruCD operon were located 114 (P1) and 55 bp (P2) upstream of the fruC initiation codon. Only the P1 promoter was active during vegetative growth, while both the P1 and P2 promoters were active during development. The FruD protein was produced as a cytoplasmic protein and formed an oligomer during vegetative growth and development.

Amino Acid Sequence↗
PubMed2003

Regulation of FRUA expression during vegetative growth and development of Myxococcus xanthus.

Expression of the fruA gene, encoding a putative transcription factor essential for fruiting body formation of Myxococcus xanthus, is specifically activated during development. In the present study, we have analyzed the mechanism of the transcriptional regulation of fruA expression. From gel retardation and footprinting assays using various fruA regulatory regions as probes and competitors, a protein designated factor X was found to specifically bind to a sequence (xbs) located downstream of the transcription-initiation site (+78 to +94) of the fruA gene. Factor X activity was present during vegetative growth and decreased during early development. Analysis of promoter activities of various segments of the fruA regulatory region using the lacZ reporter gene in vivo indicated that a DNA segment extending 45-bp upstream from the transcription-initiation site was required for developmentally regulated fruA expression at a low level. In addition, cis-acting regulatory regions located upstream and downstream of the fruA promoter region and including C-box and xbs, were found to be involved in regulation of fruA expression during development. When inserted into the vegA gene, the xbs element inhibited vegA expression during vegetative growth. Together with previously reported results, our studies reveal that fruA expression is regulated by both positive and negative mechanisms during the M. xanthus life cycle.

Bacterial Proteins↗
PubMed2002

A partial copy of msDNA from a new retron element is likely a retrotransposed DNA found in the myxobacterium Nannocystis exedens.

Retrons are reverse transcriptase (RT) encoding genetic elements usually located on the chromosome of a wide variety of mostly Gram-negative bacteria. Here we describe a new retron, designated Ne144, found in the chromosome of the myxobacterium Nannocystis exedens. This element codes for a 515-amino-acid RT that is most closely related to those found in other myxobacterial retrons. The RT is responsible for the production of a small satellite DNA called msDNA. This msDNA is composed of a 144 base, single-stranded DNA that is linked to a 72 base single-stranded RNA. The RNA strand is joined to the 5' end of the DNA chain via a 2'-5' linkage that occurs from the 2' position of an internal guanosine residue in the RNA. In addition to the retron element, the chromosome of N. exedens also contains several partial copies of the msDNA sequence as revealed by DNA hybridization experiments using msDNA as a probe. One of these partial copies was characterized from a chromosome restriction fragment and found to contain a sequence that matches the last 82 bases of the DNA strand and five bases of the RNA strand in msDNA-Ne144. This partial copy of msDNA is very likely a retrotransposed sequence that was generated by reverse transcription using an RNA (the primer-template RNA for msDNA) as a template and the 3' end of a nick in the chromosome as a primer, followed by incorporation into an open reading frame. The presence of this truncated copy of msDNA is strong evidence of retrotransposition in N. exedens causing an alteration in the bacterial genome.

Amino Acid Sequence↗
PubMed2002

Role of fruA and csgA genes in gene expression during development of Myxococcus xanthus. Analysis by two-dimensional gel electrophoresis.

Two genes, fruA and csgA, encoding a putative transcription factor and C-factor, respectively, are essential for fruiting body formation of Myxococcus xanthus. To investigate the role of fruA and csgA genes in developmental gene expression, developing cells as well as vegetative cells of M. xanthus wild-type, fruA::Tc, and csgA731 strains were pulse-labeled with [(35)S]methionine, and the whole cell proteins were analyzed using two-dimensional immobilized pH gradient/SDS-PAGE. Differences in protein synthesis patterns among more than 700 protein spots were detected during development of the three strains. Fourteen proteins showing distinctly different expression patterns in mutant cells were analyzed in more detail. Five of the 14 proteins were identified as elongation factor Tu (EF-Tu), Dru, DofA, FruA, and protein S by immunoblot analysis and mass spectroscopy. A gene encoding DofA was cloned and sequenced. Although both fruA and csgA genes regulate early development of M. xanthus, they were found to differently regulate expression of several developmental genes. The production of six proteins, including DofA and protein S, was dependent on fruA, whereas the production of two proteins was dependent on csgA, and one protein was dependent on both fruA and csgA. To explain the present findings, a new model was presented in which different levels of FruA phosphorylation may distinctively regulate the expression of two groups of developmental genes.

Amino Acid Sequence↗
PubMed2002

Activation of 6-phosphofructokinase via phosphorylation by Pkn4, a protein Ser/Thr kinase of Myxococcus xanthus.

Myxococcus xanthus is a Gram-negative bacterium that exhibits a communal lifestyle during vegetative growth and multicellular development, forming fruiting bodies filled with spores. It contains at least 13 eukaryotic-like protein Ser/Thr kinases (PSTKs from Pkn1 to Pkn13). In the present report, we demonstrate that Pkn4, the gene located 18 bp downstream of the gene for 6-phosphofructokinase (PFK), is a PSTK for M. xanthus PFK (Mx-PFK), the key regulatory enzyme in glycolysis. Both Pkn4 and Mx-PFK were expressed in Escherichia coli and purified. Mx-PFK was found to be phosphorylated by Pkn4 at Thr-226, which is presumed to be located in the allosteric effector site of the PFK. The phosphorylation of Mx-PFK enhanced its activity 2.7-fold, indicating that Pkn4 plays an important role in glucose metabolism. Although PFKs from other organisms are known to be tetrameric enzymes, Mx-PFK is composed of an octamer and is dissociated to tetramers in the presence of phosphoenolpyruvate (PEP), an allosteric inhibitor for PFK. Furthermore, phosphorylation of PFK by Pkn4 is almost completely inhibited by PEP. Mx-PFK is associated with the regulatory domain of Pkn4, and this association is inhibited by PEP. This is the first demonstration that a prokaryotic PFK is regulated by phosphorylation by PSTK in prokaryotes.

Amino Acid Sequence↗
PubMed2002

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Amino Acid Sequence↗