Biomedical subjects
Publications and source records attributed to T A Casey.
A mother and son, each showing the characteristic features of the Weill-Marchesani syndrome, are described. It is suggested that this family provides further evidence for genetic heterogeneity in this condition.
Colony hybridizations with 4 enterotoxins (STaP, STaH, STb, and LT) and 1 adherence factor (K99) gene probes were done on Escherichia coli isolated from calves. Agreement between the K99 probing and a serologic assay to detect the K99 antigen was 99% for the identification of K99+ and K99- isolates. Ninety-five of the isolates (22%) hybridized with at least 1 enterotoxin gene probe (Ent+ isolates), and 82 (19%), with the K99 gene probe. The majority of Ent+ isolates (85%) reacted with probes for STaP and K99 genes. The STaP gene was present by itself in 4 of the Ent+ isolates (4%) and with the STb gene in 6 of the Ent+ isolates (6%). Five of the Ent+ isolates (5%) carried the STb and LT genes, and none (0%) of the isolates carried the STaH gene. All but 2 of the isolates with the K99 gene also had the STaP gene. Twenty-eight isolates shown to produce STa enterotoxin in previous studies failed to hybridize with any of the enterotoxin gene probes. These 28 isolates were also phenotypically negative when the tests for enterotoxin production were repeated. These isolates probably lost their genes for enterotoxin production during storage in the laboratory.
The distribution of G + C-rich sequences in the genome of varicella-zoster virus (VZV) was investigated by partial denaturation, equilibrium sedimentation and Southern blot analyses. Portions of the IRS and TRS repeat sequences bounding the US region of the DNA were found to have a G + C content 10 to 20% greater than the overall 47% G + C content of the VZV genome. A stretch of DNA (approx. 1500 base pairs) at the UL-IRS junction and repeated at the terminus of the TRS sequences was found to be about 64% G + C, based on sedimentation equilibrium measurements. We also report the cloning of a novel fragment containing sequences from both the UL and TRS termini of the VZV genome. Our ability to clone this fragment suggests that unusual forms of VZV DNA including closed circular molecules and molecules with an inverted UL region can be packaged into nucleocapsids.
A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for the observed variation in mobilities of restriction fragments from this region of VZV DNA. The variable region sequence shares some homology with tandemly repeated regions in the a and c sequences of herpes simplex virus type 1 and probably exists in a noncoding region of the VZV genome.
The genome of varicella-zoster virus (VZV) is a linear, double-stranded molecule of DNA composed of a long (L) region covalently linked to a short (S) region. The S region is capable of inverting relative to a fixed orientation of the L region, giving rise to two equimolar populations. We have investigated other forms of the VZV genome which are present in infected cells and packaged into nucleocapsids. That a small proportion of nucleocapsid DNA molecules also possess inverted L regions has been verified by the identification of submolar restriction fragments corresponding to novel joints and novel ends generated by such an inversion. The presence of circular molecules has been investigated by agarose gel electrophoresis. Bands corresponding to circular forms were present in small amounts in both VZV-infected cell DNA and nucleocapsid DNA. Southern blot analysis verified that these bands contained VZV sequences. We therefore conclude that the VZV genome may occasionally contain an inverted L region or exist in a circular configuration.
The septum orbitale is an important landmark in ptosis surgery. It is structure that is difficult to identify and very easy to damage. In a series of 34 ptosis operations using a modified transcutaneous approach, we have shown that the septum orbitale can be readily identified, dissected and re-sutured after resection of the aponeurosis of the levator palpebrae superioris muscle.
Varicella-zoster virus (VZV) DNA was cleaved with restriction endonuclease EcoRI, and most of the resulting fragments were successfully cloned in the phage vector lambda gtWES . lambda B. Double digestions of cloned fragments with EcoRI and BamHI and hybridizations to blot-transferred BamHI digests of VZV DNA were used to construct a physical map of the genome. The molecular termini of the DNA were identified by restriction enzyme analysis after exonuclease III digestion. The data indicate that VZV DNA exists in two isomeric forms that differ by inversion of one short terminal genome segment. Electron microscopic studies revealed that the short genome segment consists of a terminal revealed that the short genome segment consists of a terminal sequence of about 3.4 X 10(6) daltons that is separated from an internal inverted repeat of itself by a 5.8 X 10(60)-dalton unique DNA segment.
Varicella-zoster virus (VZV) DNA was prepared from nucleocapsids and from enveloped virions of a laboratory strain (Ellen) and directly from the vesicle fluids of patients with zoster infections. VZV Ellen nucleocapsid DNA was cleaved with 11 different restriction endonucleases and electrophoresed in agarose gels. The restriction profiles of the nucleocapsid DNA were identical to those of the DNA recovered from purified virions, but differed from those of another VZV strain (KM). In vitro-labeled VZV K.M. DNA purified directly from vesicle fluid yielded a distinct restriction pattern which appeared to be unchanged after several tissue culture passages of the isolate from that fluid. Restriction endonuclease analysis (EcoRI or BglII) of VZV DNA revealed the presence of four cleavage fragments with a molar ratio of approximately 0.5. No individual fragments with molar ratios of 0.25 were noted. This observation suggests that the VZV genome may contain one invertible segment. Comparison of the electrophoretic migrations of VZV DNA fragments relative to those of DNAs of known size permitted calculation of the VZV genome size to be 72 X 10(6) to 80 X 10(6) daltons. These results were confirmed by electron microscopy which demonstrated a genome size of about 76 X 10(6) daltons for passaged and unpassaged VZV DNA. Electron microscopy also revealed that some of the DNA molecules recovered from nucleocapsids or directly from vesicle fluids were superhelical circles.
We designed a corneal trephine that permits a full view of the cornea while cutting. The drive mechanism of the trephine enables the surgeon to keep the central cutting axis of the instrument stable while the trephine is rotated. The instrument accepts variable sizes of disposable trephine blades, making it versatile and economical. We also devised a lamellar dissector with two blades to negate the splitting force that occurs during a closed lamellar dissection. It enables the surgeon to perform a closed lamellar dissection with minimal force applied to the globe and minimal risk of perforation.
Explore the source record for details and available documents.
Seven cases with posterior polymorphous changes of the cornea are reported. After clinical and pathological examination of the above cases, as well as a short review of the literature, the following points are made: (1) Some cases are congenital, being either familial or sporadic, but others are acquired. (2) The term "posterior polymorphous keratopathy" covers all the variants of the condition and is preferred to the traditional "posterior polymorphous dystrophy". (3) The congenital type is a mild variant of the mesodermal dysplasia, whereas the acquired type follows local disease. (4) The condition can be static, but over 50% of cases are slowly progressive, calling for penetrating keratoplasty.
A series of 200 cases of full-thickness corneal allografts have been followed to determine whether HLA and ABO incompatibility influence prognosis of the grafts. 85% of patients with avascular corneas had clear, functioning grafts one year after transplantation. Only 33% of patients with severely vascularised corneas had successful grafts one year after transplantation. A significant association was found between severe vascularisation of the patient's cornea and irreversible graft rejection. In this group of patients, the proportion of grafts functioning was found to be ranked according to the number of HLA antigens shared by graft donor and recipient. Patients receiving grafts matching for 2 HLA antigens showed a failure-rate due to irreversible rejection of 26% at one year, in comparison with 57% and 62% of grafts matching for 1 or 0 HLA antigens respectively. ABO incompatibility or ABO phenotype of the recipient did not influence graft prognosis. The results indicate that patients with severely vascularised corneas should receive HLA-matched corneal grafts. The institution of HLA-typed cornea "banks" for treatment of such patients is advocated.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.