PubMed Health⌕ Search

Biomedical subjects

T Hashimoto-Gotoh

Publications and source records attributed to T Hashimoto-Gotoh.

At least 19 recordsLinked to original sources
PubMed2000

A set of temperature sensitive-replication/-segregation and temperature resistant plasmid vectors with different copy numbers and in an isogenic background (chloramphenicol, kanamycin, lacZ, repA, par, polA).

A set of plasmid vectors conferring chloramphenicol resistance (Cm(R)), 3064bp in size, or kanamycin resistance (Km(R)), 2972bp in size, were developed, having multiple cloning sites in lacZ' genes for alpha-complementation. pTH18cs1, pTH19cs1, pTH18ks1 and pTH19ks1 are temperature-sensitive (ts) in DNA replication (ts-Rep); pTH18cs5, pTH19cs5, pTH18ks5 and pTH19ks5 are ts in plasmid segregation (ts-Seg); and pTH18cr, pTH19cr, pTH18kr and pTH19kr are temperature resistant (tr) in both. They are based on the pSC101 replicon consisting merely of the replication origin and repA gene, compatible with ColE1/pMB1/p15-derived plasmids, and thus do not require polA function of host cells. The copy numbers of the ts-Rep, tr and ts-Seg plasmids were 14, 5 and 1 per chromosome at 30 degrees C, respectively. These plasmids are fairly stable when inherited at 30 degrees C, but not above 37 degrees C or 41.5 degrees C, depending on the repA mutations and host strains. They are isogenic apart from the ts mutations in the repA gene, and thus provide with useful tools for having appropriate controls in various experiments including bacterial gene-targeting, transposon mutagenesis, toxic gene expression, differential substitution on host functions, gene dosage analysis and so on.

Bacterial Proteins↗
PubMed1998

An improved system for selection of forward mutations in an Escherichia coli supF gene carried by plasmids.

An improved system to examine forward mutations that occurred in the supF gene of Escherichia coli carried on a multicopy plasmid is described. The system was validated by measuring spontaneous mutations of supF plasmids propagated in wild-type, recA- and mutM- mutY- E. coli strains, the mutation frequencies of which were 1.3 x 10(-7), 6.3 x 10(-7) and 1.5 x 10(-6), respectively. Sequence analysis of the supF mutant plasmids revealed that G:C-->T:A and G:C-->C:G transversions dominated. This improved system allows rapid scoring and sequencing forward mutations in the supF gene, thus permitting its use as a genetic target for repair and mutagenesis studies in bacteria and mammalian cells.

Escherichia coli↗
PubMed1997

Bone mass loss due to estrogen deficiency is compensated in transgenic mice overexpressing human osteoblast stimulating factor-1.

Osteoblast stimulating factor-1 (OSF-1) stimulates in vitro proliferation and differentiation of osteoblastic cells, and its gene is expressed in the bone and brain tissues in mammals and amphibians. To evaluate the in vivo function of OSF-1 in bone metabolism, transgenic mice overexpressing the human osf-1 gene driven by the osteocalcin promoter were generated. Femoral bone mineral content was increased in transgenic mice relative to wild-type controls as estimated by ash assay, depending on the transgene copy number per cell. In ovariectomized mice, bone mass loss due to estrogen deficiency was observed in both transgenic and control mice but bone mass was still higher in transgenic mice than in controls. Bone mass in ovariectomized transgenic mice was comparable to that in wild-type mice without ovariectomy. These observations indicate that OSF-1 may direct in vivo appositional bone formation by increasing osteoblast activity rather than decreasing osteoclast activity, suggesting a new way to treat osteoporosis with OSF-1.

Animals↗
PubMed1997

Cloning of human and mouse cDNAs encoding novel zinc finger proteins expressed in cerebellum and hippocampus.

We identified a novel gene, kf-1, highly expressed in the normal cerebellum but not in the cerebral cortex, the expression of which could have been augmented in the cerebral cortex of a sporadic Alzheimer's disease patient. We cloned human and mouse entire kf-1 cDNAs encoding conserved 79 kDa proteins containing a zinc-binding RING-H2 finger motif at the carboxy-terminus as found in acetylcholine receptor-associated protein (RAPsyn). The 3'-untranslated regions are highly conserved between human and mouse as to constitute a common mRNA secondary structure. In situ hybridization analysis of mouse brain sections revealed strong kf-1 expression in the cerebellum and hippocampus. We propose that KF-1 is involved in membranous protein-sorting apparatus similarly to RAPsyn. We mapped the human kf-1 gene to 2p11.2.

Alzheimer Disease↗
PubMed1997

Cloning of Xenopus presenilin-alpha and -beta cDNAs and their differential expression in oogenesis and embryogenesis.

Human presenilin (ps)-1 and -2 genes have recently been shown to be involved in genesis of early-onset familial Alzheimer's disease. By probing with human (H-) ps-1 cDNA, we isolated two types of cDNA clones, named X-ps-alpha and -beta, from a Xenopus brain cDNA library. The encoded proteins, X-PS-alpha and -beta, may correspond to H-PS-1 and -2 with 89.4 and 85.9% similarity, respectively. The strongest expression of these genes was observed in ovaries and in the early stages of oogenesis, although weak or moderate expression was detected ubiquitously for both X-ps-alpha and -beta genes in multiple tissues. Upon oocyte maturation, the X-ps-beta mRNA level was constant even after fertilization until the midblastula transition. Zygotic expression of these genes became evident only at the tailbud stage. We propose that presenilins may function in preventing cells from undergoing apoptotic degeneration particularly prior to embryonic development and in developmentally matured tissues.

Amino Acid Sequence↗
PubMed1995

Plasmids with a kanamycin-resistance gene for site-directed mutagenesis using the oligodeoxyribonucleotide-directed dual amber method.

Plasmid vectors carrying lacZ' and kanamycin-resistance (KmR) genes were constructed for site-directed mutagenesis (SDM) using the oligodeoxyribonucleotide (oligo)-directed dual amber (ODA) method [Hashimoto-Gotoh et al., Gene 152 (1995) 271-276]. The plasmids, designated pKF16k, pKF17k, pKF18k and pKF19k, correspond to the previously reported chloramphenicol resistant (CmR) ODA plasmids, pKF16c, pKF17c, pKF18c and pKF19c, respectively, but contain dual amber (am) codons in KmR instead of the CmR gene. The SDM procedure using the KmR ODA plasmids is essentially the same as that with CmR ODA plasmids, which utilizes two oligo primers for in vitro DNA synthesis, one (selection primer) for dual am reversions and the other (mutagenic primer) for the target site. The KmR ODA plasmids yield 5-10-times more DNA per culture volume as compared to the CmR ODA plasmids, and one can prepare selection agar medium simply by spreading Km solution on dried agar plate at a final concentration of 50-100 micrograms/ml; due to the broad range of selecting antibiotic resistance.

Base Sequence↗
PubMed1995

Detection of exonuclease activities in restriction endonuclease preparations using an enforcement plasmid for kanamycin-resistance selection.

A new enforcement (kyosei-) cloning plasmid vector, designated pKF4, was constructed which confers kanamycin resistance (KmR) and enforces streptomycin sensitivity (SmS). Since it is important to employ restriction endonuclease (ENase) preparations free of exonuclease (Exo) activities for effective use of the kyosei-cloning procedure [Hashimoto-Gotoh et al., Gene 137 (1993) 211-216], ENases such as HpaI and SmaI purchased from four different suppliers were examined for possible contamination by exonucleases using pKF4. The plasmid DNA was digested with either ENase, ligated and transformed into Escherichia coli mutants, rpsL, supE, trpR. With pKF4 intact DNA (approx. 8 ng), 2.3 x 10(5) KmR transformant and four KmRSmR transformant colonies were obtained; the efficiency of transformation plating (ETP) of the intact DNA was approx. 2 x 10(-5). On the other hand, the ETP values were significantly higher by one to three orders of magnitude when cut and re-joined DNAs were used under the same conditions in six out of eight ENase samples examined. The results indicate that even commercially supplied ENases, that should have passed their quality control test, could have been contaminated with Exo sufficient to interfere with effective use of the kyosei-cloning method. Therefore, it is advisable to examine ENase samples for possible contamination with Exo activities, in order to choose the right preparations for this method at the beginning of the experiments.

Cloning, Molecular↗
PubMed1995

Quantitative determination of effective nibbling activities contaminating restriction endonuclease preparations.

A simple and sensitive procedure with which to detect residual exonucleolytic nibbling activities contaminating restriction endonuclease preparations is described. The procedure uses the kyosei-plasmid, pKF4, which confers kanamycin resistance and enforces streptomycin sensitivity encoded by the trp promoter/operator-driven rpsL+amber(PO(trp)-rpsL+4(am)) gene onto Escherichia coli streptomycin-resistant, amber-suppressive, trp repressor-negative strains such as TH5. When TH5 cells transformed by pKF4 were selected on agar medium containing kanamycin plus streptomycin, the efficiency of transformation plating was substantially lower than that on agar containing kanamycin alone. However, when pKF4 DNA was digested by restriction enzymes that cut once per molecule within PO(trp)-rpsL+4(am) and relegated, the plating efficiency increased depending on the degree of contamination of exonucleolytic nibbling activities in the enzyme preparations, due to deletion mutation at the ligand junction. Plating efficiency was converted to "effective nibbling activity" corresponding to Bal31 nuclease-equivalent units. Using this procedure, effective nibbling activities were detected in 17 of 34 commercial samples of restriction enzymes tested. The method is simple and more sensitive than the procedures used by the commercial suppliers and it is applicable to the quality control testing of more than 100 restriction enzymes.

Amino Acid Sequence↗
PubMed1995

Developmental and differential regulations in gene expression of Xenopus pleiotrophic factors-alpha and -beta.

Using conserved nucleotide sequences in mammalian osteoblast specific factor-1 (OSF-1) coding regions, we isolated two kinds of cDNA clones from the Xenopus brain library. The encoded proteins, named Xenopus pleiotrophic factors (X-PTFs)-alpha and -beta, were 65 and 87% homologous to human midkine and OSF-1, respectively. In the adult frog, X-ptf-alpha was expressed in the ovary, brain, eye, bone, heart and lung, whereas X-ptf-beta was expressed in the brain, eye and bone. By in situ hybridization of the tailbud embryo, X-ptf-alpha mRNA was detected rather broadly in the head/tail regions including the central nervous system (CNS), whereas X-ptf-beta mRNA was restricted to the CNS, particularly in the hind-brain. During embryogenesis, X-ptf-alpha mRNA was detected in the one-cell stage embryo, whereas only zygotic expression was observed in X-ptf-beta. X-ptf-beta mRNAs contained approximately 79 bp tandem repeats in the 3'-untranslated region, complementary to those found in retinoic acid cellular receptor mRNA and in the sense strand of short interspersed repeat transcripts in X. laevis.

Aging↗
PubMed1995

An oligodeoxyribonucleotide-directed dual amber method for site-directed mutagenesis.

A simple procedure for in vitro site-directed mutagenesis (SDM) was developed using two oligodeoxyribonucleotide (oligo) primers, one serving as selection primer and the other for mutagenesis in the target DNA (mutagenic primer). The mutant clones can be selected by reversion mutations of dual amber (am) to dual Gln codons in the cat gene, resulting in a chloramphenicol-resistant phenotype in sup(O) host cells. Unlike previously reported procedures, the new method requires neither special chemical reagents, nor single-stranded DNA purification, nor any additional biochemical treatments such as multiple PCRs, restriction digestion and so on, but utilises one of the oligo-directed dual am (ODA) plasmids, i.e., pKF16c, pKF17c, pKF18c or pKF19c. The two amber (am) mutations located two codons apart from each other in cat (catam2) can be simultaneously reverted with a 20-nucleotide primer (CQ, pAACCAGACCGTTCAGCTGGA) during primer extension. In a model experiment using the lacZ' gene, an am mutation or a single-bp deletion (sbd) mutation was frequently co-introduced in lacZ' using a mixture of am- or sbd-encoding mutagenic primer for lacZ', and the CQ primer for catam2. Applying this procedure to the human AT cDNA (encoding antithrombin), a missense mutation (Arg406-->Met) in one of the human AT variants, AT-Kyoto, involved in congenital thrombosis disease, was introduced efficiently into the wild-type cDNA (> 85%).

Base Sequence↗
PubMed1993

Construction and characterization of new host-vector systems for the enforcement-cloning method.

The Escherichia coli host strains, TH1, TH2, TH3 alpha, TH4 and TH5, all trpR-, rpsL- and supE-, were constructed to constitutively express a trp promoter/operator (POtrp)-driven synthetic rpsLam+ gene encoding the streptomycin sensitivity (Sms) determinant (ribosomal protein S12). The applicability of these strains to the Sms-enforcement cloning procedure [Toba-Minowa and Hashimoto-Gotoh, Gene 121 (1992) 25-33] was examined on tryptophan-rich low-salt (LS) agar medium in combination with two reconstructed Sms-enforcement plasmid vectors, ampicillin-resistant (ApR) pKF2, and chloramphenicol-resistant (CmR) pKF3. The results indicated that (1) pKF2 enforced the Sms phenotype on TH1, TH2, TH4 and TH5, but not TH3 alpha, while pKF3 was effective on all the strains, (2) even without Sm, strains TH1, TH2, TH4 and TH5 harboring pKF2 rarely formed colonies on LS+Ap agar, and (3) TH2 harboring pKF3 hardly grew, forming tiny colonies only after two overnight incubations at 37 degrees C on LS+Cm agar. By using the AseI, BclI, StuI and EcoRI sites in POtrp-rpsL+4am of pKF2 and pKF3, it was revealed that enforcement cloning was applicable in the new host-vector systems on normal nutrient agar medium, except for a combination of TH3 alpha and pKF2, with the TH2 strain in combination with pKF2 or pKF3 seeming to be most suitable for enforcement cloning, even without Sm.

Amino Acid Sequence↗
PubMed1992

Characterization of the spontaneous elimination of streptomycin sensitivity (SmS) on high-copy-number plasmids: SmS-enforcement cloning vectors with a synthetic rpsL gene.

The strAS or rpsL+ gene, encoding a ribosomal protein, S12, expresses its streptomycin-sensitivity (SmS) phenotype dominantly over strAR or rpsL- gene. Therefore, strAR cells that harbor plasmids with strAS alleles are phenotypically SmS. It was found that the SmS phenotype is unstable, and such cells eventually switch to the Sm-resistance (SmR) phenotype, especially when the strAS gene was cloned on high-copy-number (HCN) plasmids. It seemed that the strA gene cloned on HCN plasmids was toxic to Escherichia coli host cells and, during prolonged cultivation, plasmids with an inactivated strAS gene, mostly carrying insertion sequence elements, such as IS1, IS5 and gamma delta, were selected. The instability of the strA gene was particularly enhanced when the Val51 residue in the middle of S12 protein was replaced by Leu, suggesting enhanced toxicity of the altered S12. Since the strAS gene was stably maintained throughout approx. 100 cell doublings when its expression was abolished, most probably it is the gene product rather than the nucleotide sequence itself that is responsible for the instability of strA gene on HCN plasmids. To improve the stability of the SmS phenotype, the previously reported ampicillin-resistance-conferring and SmS-enforcing plasmid vector, pHSG670, was reconstructed. The resulting vector, pHSG683, confers chloramphenicol resistance, enforces SmS on strAR and supE- host bacteria, and has multiple cloning sites within the coding region of synthetic rpsL gene. When pHSG683 DNA was prepared from strAR and sup+ cells grown in tryptophan-rich medium with Cm and Sm, less than 10(-6) plasmids failed to enforce SmS on strAR and supE- cells in tryptophan-less medium with Cm.(ABSTRACT TRUNCATED AT 250 WORDS)

Amino Acid Sequence↗
PubMed1992

Isolation and characterization of a mouse protein C cDNA.

Protein C (PC) is a vitamin K-dependent serine protease, a deficiency of which results in thrombus. There is no spontaneously occurring mouse model of the disease. Attempts to create such a model in mice by using anti-sense gene technology requires isolation of a normal mouse PC cDNA. When a mouse liver (BALB/c) cDNA library was screened using a human PC cDNA as a probe, nine overlapping cDNA clones were isolated and sequenced. The cloned mouse PC cDNA comprised 1,512 nucleotides and the open reading frame of the cDNA encoded a polypeptide of 461 amino acids residues including a leader peptide composed of 41 amino acids. Mouse PC exhibited high homology to both human and bovine PCs. Mouse PC also had several structural features common in other PCs; locations of 23 Cys residues, location of putative beta-hydroxy Asp71, possible carbohydrate attachment sites involving Asp residues at amino acid positions 249, 314, and 330, and location of active sites such as His212, Asp258, and Ser361. Northern blot hybridization analysis identified a single species of mouse PC mRNA (2.0 kb in length) in mouse liver.

Amino Acid Sequence↗
PubMed1991

Congenital antithrombin III deficiency (AT-III Kyoto): identification of a point mutation altering arginine-406 to methionine behind the reactive site.

A Japanese patient with congenital antithrombin III (AT-III) deficiency, named AT-III Kyoto, is associated with reduced levels (60% of normal) of AT-III antigen, progressive activity and heparin cofactor activity. The antithrombin III gene of this patient was investigated by polymerase chain reaction (PCR) method followed by direct DNA sequencing analysis, which revealed a G to T transitional mutation resulting in the conversion of arginine-406 to methionine in exon 6. Arginine-406 is located at the 12th amino acid residue from the reactive site on the C-terminal side of AT-III in a core region of the molecule which has been highly conserved during evolution of serine protease inhibitor (serpin) family. It is concluded that AT-III Kyoto is a newly described mutation which is similar to AT-III Utah and lends support to the idea that the conserved region near the reactive site is important in maintaining biological function of the AT-III molecule.

Adult↗
PubMed1990

Isolation of mouse and human cDNA clones encoding a protein expressed specifically in osteoblasts and brain tissues.

Using the differential hybridization screening method between osteoblastic and fibroblastic cells, a cDNA clone coding for an osteoblast specific protein, named OSF-1, consisting of 168 amino acid residues including a possible 32 amino acid long leader sequence, was isolated from murine osteoblastic cell line MC3T3-E1. The OSF-1 gene was shown by Northern blotting analysis to be expressed in mouse calvarial osteoblast-enriched cells and in mouse brain tissues, but not in thymus, spleen, kidney, liver, lung, testis or heart. The human counterpart was also found in cDNA libraries from human osteosarcoma cell line MG63 and normal brain tissues. DNA sequence analysis revealed four amino acid sequence differences between the mouse and human, of which only one is located in the mature protein. This extremely high sequence conservation suggests that OSF-1 plays a fundamental role in bone and brain functions.

Animals↗
PubMed1990

Hydrophobic residues 382-386 of antithrombin III, Ala-Ala-Ala-Ser-Thr, serve as the epitope for an antibody which facilitates hydrolysis of the inhibitor by thrombin.

In the presence of a monoclonal antibody raised against the human thrombin-antithrombin III complex, the reaction between thrombin and antithrombin III proceeded to form preferentially a two-chain form of the inhibitor rather than to follow the major pathway of stable acyl complex formation. We thus propose the term "switching antibody" for an antibody that switches the enzyme-inhibitor reaction (Asakura, S., Matsuda, M., Yoshida, N., Terukina, S., and Kihara, H. (1989) J. Biol. Chem. 264, 13736-13739). By analyzing a CNBr fragment of the thrombin-antithrombin III complex that reacts with the antibody we localized the epitope for the antibody to a strongly hydrophobic residue 382-386 peptide segment, Ala-Ala-Ala-Ser-Thr, of the inhibitor, which is also contiguous with a hydrophobic amino acid Ala at its carboxyl terminus. This particular region should be cryptic in nascent antithrombin III, but could have been exposed to provide the reactive site for the antibody at an early stage of the reaction. Thereby a conformational change may have been induced at or near the reactive site of the complex, facilitating hydrolysis of the inhibitor by the enzyme. Interestingly, this hydrophobic region is highly conserved among members of the serpin family.

Amino Acid Sequence↗
PubMed1988

Tandem gene amplification in vitro for rapid and efficient expression in animal cells.

Plasmid vectors pHSG293 and pHSG747, suitable for in vitro gene amplification for subsequent animal-cell expression, were developed. A cosmid vector pHSG293 confers Km resistance to Escherichia coli host cells and G418 resistance to animal cells and contains a single BstXI recognition/cleavage site, CCACGGGG/CTGG, near the cos site (the recognition site is underlined). The cassette vector plasmid pHSG747 contains a multiple cloning site (MCS) between the simian virus 40 early promoter and the poly(A) signal sequence flanked by the same BstXI sites and confers Cm resistance to E. coli host cells. After inserting a coding fragment for human protein C or its derivative in the appropriate orientation in the MCS of pHSG747, the BstXI expression unit fragment was purified, mixed with BstXI-digested pHSG293 DNA at a molecular ratio of 20 to 40:1 and ligated. This allowed for tandem gene amplification due to asymmetric cohesive ends. Ligation products were packaged in lambda phage particles, amplified in E. coli cells as large cosmid molecules, and then introduced into CHO cells. G418R transformants were found to produce and secrete recombinant protein molecules at a high level. The plasmid vectors developed in this work will provide a rapid screening system useful for protein engineering in animal cells.

Animals↗