PubMed Health⌕ Search

Biomedical subjects

T Mizuno

Publications and source records attributed to T Mizuno.

At least 289 records · Page 16Linked to original sources
PubMed1995

The osmo-inducible gpd1+ gene is a target of the signaling pathway involving Wis1 MAP-kinase kinase in fission yeast.

The gpd1+ gene of Schizosaccharomyces pombe encodes an isozyme of NADH-dependent glycerol-3-phosphate dehydrogenases that is involved in glycerol synthesis, whose expression is induced upon an upshift of the medium osmolarity. We provide evidence that this osmotic induction of gpd1+ in S. pombe is under the control of a MAP-signaling pathway involving the wis1+ gene-product, which is a homologue of MAP-kinase kinases. The results suggested that the gpd1+ gene is a downstream target of the osmosensing signaling that is transmitted through Wis1, thereby defects of either of these genes result in the similar phenotype, namely, osmosensitive for growth, because of the failure in accumulation of the intracellular osmoprotectant, glycerol.

Gene Expression Regulation, Fungal↗
PubMed1995

An Escherichia coli curved DNA-binding protein whose expression is affected by the stationary phase-specific sigma factor sigma S.

From Escherichia coli, a DNA-binding protein that preferentially recognizes a curved DNA sequence was isolated and shown to correspond to one that has recently been reported as a binding protein for the replication origin of the E. coli chromosome, named Rob. Here, a rob promoter-lacZ transcriptional fusion was constructed on the chromosome, and used to demonstrate that the expression of rob is notably enhanced at the onset of stationary phase in Luria-broth and also under certain growth conditions in a minimal medium, such as glucose- and phosphate-starvation medium. It was further shown that this growth condition-dependent expression of rob is notably reduced in a null mutant for the stationary phase-specific sigma subunit of RNA polymerase, sigma s, although sigma s-independent expression of rob was significant during the logarithmic growth phase. Furthermore the rob null mutant was found to exhibit, as compared with the wild-type, an altered profile of protein synthesis, particularly at the very late stationary phase.

Amino Acid Sequence↗
PubMed1995

Gene activation by the Escherichia coli positive regulator OmpR: a mutational study of the DNA-binding domain of OmpR.

The Escherichia coli DNA-binding protein, OmpR, is one of the best characterized of the bacterial positive regulators that enhance the transcriptional ability of RNA polymerase. OmpR, consisting of 239 amino acids, binds to specific sequences located upstream of the cognate ompC and ompF promoters. The C-terminal half of OmpR, consisting of about 120 amino acids, exhibits an inherent DNA-binding ability. To address the issue of DNA binding by OmpR, we selected a set of OmpR mutants, each of which has a single amino acid substitution in the C-terminal half of OmpR. In particular, we characterized a number of OmpR mutants which are defective in DNA binding and thereby result in an OmpF- OmpC phenotype. Among them, a putative positive control OmpR mutant was also obtained, which appears to be defective in phosphorylation-dependent transcriptional activation, but not in DNA binding. These results are discussed with general emphasis on DNA recognition by the E. coli family of OmpR-like regulatory proteins.

Amino Acid Sequence↗
PubMed1995

A Synechococcus gene encoding a putative pore-forming intrinsic membrane protein.

A cyanobacterium, Synechococcus species PCC7942, has a gene encoding a copper-transporting P-type ATPase, which is located in the thylakoid membrane. At the 5'-upstream of this ATPase gene, we identified another gene, which was supposed to be implicated in a copper-transport process. This novel gene was found to encode a putative pore-forming membrane protein that belongs to a growing family of homologous intrinsic membrane proteins (the MIP family of proteins), which include the major intrinsic protein (MIP) from animal lens fibre junction membranes, the tonoplast intrinsic protein (TIP) from vacuolar membranes of higher plants, and the Escherichia coli glycerol facilitator (GlpF) in the cytoplasmic membrane. The deduced product, named SmpX (Synechococcus membrane protein), is highly homologous throughout its entire sequence to these intrinsic membrane proteins which were postulated to be pore-forming proteins involved in a variety of transport processes. The primary amino acid sequence of SmpX shares all properties characteristic for members of the MIP family. SmpX is more similar to the eukaryotic members (e.g., nodulin-26 from soybean) than to the prokaryotic ones.

Amino Acid Sequence↗
PubMed1995

Effects of fluvastatin on human biliary lipids.

The 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors have rapidly become widespread in the treatment of hypercholesterolemia and are known to be variable in efficacy. To investigate the effect on biliary lipids, a 3-month study using fluvastatin was devised. A total of 19 patients were enrolled in this study: all had hypercholesterolemia (7 men, 12 women; 13 with type IIa, 6 with type IIb). After an observation period of 4-6 weeks with placebo, fluvastatin at a daily dose of 30 mg was administered for 3 months. Fasting blood samples were taken early in the morning, before, and once a month during 3 months of fluvastatin treatment, for measurement of serum lipids. Cerulein-stimulated bile in the gallbladder was sampled using a duodenal tube, and the changes in biliary lipids were assessed. There was a marked decrease in serum total cholesterol after 12 weeks of treatment (21%; p < 0.001). However, there was no significant difference in the bile cholesterol saturation index (CSI): values before and after 3 months of drug administration were 0.93 and 0.99, respectively (Admirand-Small method). There were no significant changes in either the fatty acid composition of biliary lecithin or in the bile acid composition of bile. In conclusion, on the basis of these results, short-term (3 months) administration of fluvastatin does not appear to affect CSI.

Adult↗
PubMed1995

Mutations causing high basal level transcription that is independent of transcriptional activators but dependent on chromosomal position in Saccharomyces cerevisiae.

Two single (bel2 and bel4) and two double (bel3 bel7 and bel5 be16) mutations causing enhanced transcription of a gene fusion, consisting of the open reading frame of PHO5 connected to the HIS5 promoter (HIS5p) integrated at the ura3 or leu2 locus, were isolated from a gcn4-disrupted mutant of Saccharomyces cerevisiae. The PHO5 gene, encoding repressible acid phosphatase, in the HIS5p-PHO5 construct was derepressed under amino acid starved conditions by the action of the transcriptional activator Gcn4p. The bel mutants showed temperature-sensitive cell growth and/or cell aggregation. All the mutants except bel4 also showed high levels of transcription of an intact PHO5 DNA integrated at the URA3 locus in the absence of the cognate transcriptional activator, Pho4p, and in the absence of upstream activating sequences of PHO5. The HIS5 and PHO5 genes at their original chromosomal positions were, however, not affected by the bel2 mutation. The BEL2 gene was found to be identical with SIN4/TSF3, mutations in which cause high levels of transcription of the HO and GAL genes in the absence of their respective transcriptional activators, Swi5p and Gal4p. The effect of the bel2/sin4/tsf3 mutation on PHO5 transcription was additive with the Pho4p function. Thus the effect of the bel2/sin4/tsf3 mutation is dependent on the position of PHO5 in the chromosome and independent of Pho4p and Gen4p activation.

Alleles↗
PubMed1995

Solution structure of the DNA binding domain of a nucleoid-associated protein, H-NS, from Escherichia coli.

The three-dimensional structure of the C-terminal domain (47 residues) obtained from the hydrolysis of H-NS protein with bovine trypsin was determined by NMR measurements and distance geometry calculations. It is composed of an antiparallel beta-sheet, an alpha-helix and a 3(10)-helix which form a hydrophobic core, stabilizing the whole structure. This domain has been found to bind to DNA. Possible DNA binding sites are discussed on the basis of the solution structure of the C-terminal domain of H-NS.

Amino Acid Sequence↗
PubMed1995

Quantitative control of the stationary phase-specific sigma factor, sigma S, in Escherichia coli: involvement of the nucleoid protein H-NS.

In Escherichia coli, recent intensive studies revealed that expression of a certain subset of genes is under the control of the stationary phase-specific sigma factor, sigma S, which is encoded by the rpoS gene. Since sigma S functions predominantly under certain growth conditions, its activity and/or cellular content has accordingly to be tightly controlled, however, the underlying molecular mechanism is at present unclear. We previously demonstrated that expression of the cbpA gene, encoding an analogue of the DnaJ molecular chaperone, is largely dependent on sigma S function. Here we have found that a mutational lesion of the hns gene, which encodes one of the well-characterized nucleoid proteins, H-NS, affects the cellular content of sigma S remarkably and consequently affects the expression of cbpA. Enhanced accumulation of sigma S in hns deletion cells was particularly observed in the logarithmic growth phase and was demonstrated to result from an elevated translational efficiency of rpoS mRNA and also from an increased stability of newly synthesized sigma S. Although H-NS is known to influence the transcription of a number of apparently unlinked genes on the chromosome, in this study we provide a novel instance in which H-NS is deeply implicated in post-transcriptional regulation(s) of the expression of rpoS. As to physiological relevance, it was also demonstrated that hns deletion cells exhibit an extreme thermotolerance even in the logarithmic growth phase, presumably because of the enhanced accumulation of sigma S.

Adaptation, Biological↗
PubMed1995

An oligodeoxyribonucleotide-directed dual amber method for site-directed mutagenesis.

A simple procedure for in vitro site-directed mutagenesis (SDM) was developed using two oligodeoxyribonucleotide (oligo) primers, one serving as selection primer and the other for mutagenesis in the target DNA (mutagenic primer). The mutant clones can be selected by reversion mutations of dual amber (am) to dual Gln codons in the cat gene, resulting in a chloramphenicol-resistant phenotype in sup(O) host cells. Unlike previously reported procedures, the new method requires neither special chemical reagents, nor single-stranded DNA purification, nor any additional biochemical treatments such as multiple PCRs, restriction digestion and so on, but utilises one of the oligo-directed dual am (ODA) plasmids, i.e., pKF16c, pKF17c, pKF18c or pKF19c. The two amber (am) mutations located two codons apart from each other in cat (catam2) can be simultaneously reverted with a 20-nucleotide primer (CQ, pAACCAGACCGTTCAGCTGGA) during primer extension. In a model experiment using the lacZ' gene, an am mutation or a single-bp deletion (sbd) mutation was frequently co-introduced in lacZ' using a mixture of am- or sbd-encoding mutagenic primer for lacZ', and the CQ primer for catam2. Applying this procedure to the human AT cDNA (encoding antithrombin), a missense mutation (Arg406-->Met) in one of the human AT variants, AT-Kyoto, involved in congenital thrombosis disease, was introduced efficiently into the wild-type cDNA (> 85%).

Base Sequence↗
PubMed1995

The usefulness of severe combined immunodeficiency (SCID) mice to study human carcinogenesis.

In the present study, we engrafted normal colonic epithelial and histologically diagnosed colonic adenomas from a familial adenomatous polyposis (FAP) patient into severe combined immunodeficient (SCID) mice and subsequently examined them histologically and molecular biologically. Successful engraftment and metastasis was observed. The facts that human normal colonic epithelium and adenomatous polyps can take in SCID mice indicates the possibility that this human SCID mouse system will be useful for investigating the dynamics of human carcinogenesis in various tissues.

Adenomatous Polyposis Coli↗
PubMed1995

Pathogenesis of thymolipoma: report of three cases.

Three case reports of thymolipoma are herein presented. One patient presented with myasthenia gravis, while the other patients were asymptomatic. The tumors in our cases all had histopathologically different features: case 1, lipoma of the thymus; case 2, involuted thymic hyperplasia; and case 3, typical thymolipoma. The histopathological findings of thymolipoma are discussed in the context of the pathogenesis of thymolipoma.

Child, Preschool↗
PubMed1995

Effects of long-term treatment with low-dose pravastatin on biliary lipid and bile acid composition in patients with nonfamilial hyperlipoproteinemia.

We tested the possibility that pravastatin, a competitive inhibitor of hepatic hydroxymethyl glutaryl coenzyme A (HMG CoA) reductase, would alter cholesterol saturation of gallbladder bile by decreasing its cholesterol saturation index and/or degree of fatty acyl chain unsaturation in lecithin. Eighteen patients with type IIa hyperlipoproteinemia were treated with pravastatin 10 mg/d for 12 months. Gallbladder bile samples were aspirated with a duodenal tube by stimulating gallbladder contraction with intramuscular administration of cerulein before and after treatment. Serum cholesterol level was significantly reduced by 20% after 3 months, and this level was maintained after 12 months. In contrast, the cholesterol saturation index of gallbladder bile was not altered after 3 months (1.52 +/- 0.20 v 1.70 +/- 0.24), but it decreased significantly after 12 months (0.95 +/- 0.11, P < .01). The degree of fatty acyl chain unsaturation tended to decrease, although this was not statistically significant except for the decrease in molar percent of linoleate after 3 months. These findings suggest that long-term treatment with an inhibitor of HMG CoA reductase improves bile lithogenicity even at a comparatively low dose, and can decrease the incidence and complications of cholesterol gallstones.

Adult↗
PubMed1995

p53 protein expression and p53 gene mutation in thymic epithelial tumors. An immunohistochemical and DNA sequencing study.

p53 protein expression in 34 thymic epithelial tumors was examined immunohistochemically, and p53 gene mutation was detected in selected cases by DNA sequencing, using formalin-fixed and paraffin-embedded tissues. The tumors comprised 12 noninvasive thymomas, 9 invasive/metastatic thymomas, and 13 thymic carcinomas. All the tumors were immunoreactive for p53 protein. The p53-positive tumor cells in noninvasive thymoma were less than 10% (low expressor) in 7 cases and 10% to 50% (moderate expressor) in 5 cases. In invasive/metastatic thymoma, two were low expressors and seven were moderate expressors. In thymic carcinomas, there were nine moderate expressors and four high expressors (with > 50% positive cells). There was significant difference in p53 protein immunopositivity between thymic carcinoma and each of the noninvasive or invasive/metastatic thymomas. The DNA sequencing study confirmed the presence of p53 gene point mutation in all 10 cases examined, including three low expressors. These results suggest that p53 gene mutation is an early event in thymic tumorigenesis, and the p53 protein-positive cells increase with the progression of the tumor. Immunostaining reactivity of p53 may be a useful adjunct to differentiate thymic carcinoma from thymoma.

Adult↗
PubMed1995

Phosphotransfer circuitry of the putative multi-signal transducer, ArcB, of Escherichia coli: in vitro studies with mutants.

Recently we demonstrated the occurrence of a novel device of signal transducers in Escherichia coli. This class of bacterial sensory kinases, typified by ArcB and BarA, possesses two phospho-donor (His) sites, together with a phospho-accepting (Asp) site. These multi-phosphorylation sites were suggested to make a phosphotransfer circuit. To clarify this complex circuitry, we carried out a series of in vitro assays involving a set of ArcB mutant proteins which have an amino acid substitution at each putative phosphorylation site (His-292, Asp-576 and His-717). By these in vitro phosphorylation and/or phosphotransfer assays, the followings were assessed: (i) ArcB autophosphorylation; (ii) ArcB-mediated phosphorylation of the cognate response regulator, ArcA; (iii) ArcB-mediated phosphorylation of its truncated form (ArcBc) encompassing only the C-terminal phosphorylation site (His-717); (iv) phosphotransfer from ArcBc to ArcA; and (v) phosphotransfer from ArcBc to ArcB. On the basis of these in vitro results, a complex circuitry was revealed for the signal transducer ArcB. This evidence obtained in vitro supports the view that ArcB can serve as a powerful device for not only propagating multi-signals, but also making up signalling networks, in ways more sophisticated than previously thought.

Bacterial Outer Membrane Proteins↗
PubMed1995

Osmoregulation of fission yeast: cloning of two distinct genes encoding glycerol-3-phosphate dehydrogenase, one of which is responsible for osmotolerance for growth.

Many types of microorganisms, including both prokaryotes and eukaryotes, have developed mechanisms to adapt to severe osmotic stress. In this study, we isolated multicopy suppressor genes for a Schizosaccharomyces pombe mutant, which exhibited the clear phenotype of being osmosensitive for growth (Osms) on agar plates containing high concentrations of either non-ionic or ionic osmotic solutes. Two genes were thus identified, and each was suggested to encode an NADH-dependent glycerol-3-phosphate dehydrogenase (GPD), which is required for glycerol synthesis. The nucleotide sequences, determined for these genes (named gpd1+ and gpd2+, respectively), revealed that S. pombe has two distinct GPD isozymes. They are only 60% identical to each other in their amino acid sequences. One such isozyme, GPD1, was shown to be directly involved in osmoregulation, based on the following observations. (i) Expression of gpd1+ was regulated at the mRNA level in response to osmotic upshift. (ii) It was demonstrated that wild-type cells markedly accumulated internal glycerol under high-osmolarity growth conditions. (iii) delta gpd1 mutants, however, failed to do so even in a high-osmolarity medium, and thus exhibited an Osms phenotype. On the other hand, the gpd2+ gene was constitutively expressed at a particular low level, regardless of the osmolarity of the medium.

Adaptation, Physiological↗
PubMed1995

Prevalence study of oral mucosal lesions in a selected Cambodian population.

The aim of this study was to investigate the epidemiology of oral mucosal lesions in a selected Cambodian population to obtain pilot data useful in planning an oral health data base for the country. Due to unstable conditions in Cambodia, the validity of population data related to present census information is highly questionable. Therefore, prior to this investigation a census registration was carried out using local health workers as registrars in nine villages of a commune. In the period July 4-31, 1991, a total of 1319 individuals (953 women, 366 men, 15-99 yr) were examined by one oral surgeon in the nine villages of Kok Trop Commune, Kandal Stung District, southwest of the capital Phnom Penh. Clinical diagnoses were based on WHO criteria. Information on smoking habits, betel nut chewing habits, and alcohol use was collected by 4 Khmer dental personnel. In total, 71 lesions were recorded in 64 (4.9%) individuals. Leukoplakia was found in 1.1%, lichen lesions in 1.8%, candidosis in 1.4%, submucous fibrosis in 0.2%, cancer in 0.1% and other diagnoses in 0.8%. The prevalence of leukoplakia was 2.2% and 0.6% among men and women respectively, a statistically significant difference (P < 0.05). There were significantly more smokers (P < 0.01) among subjects with leukoplakia (64.3%) than among those without this lesion (28.6%). All subjects with lichen lesions were women. The age-adjusted relative risk for developing lichen among betel nut chewers as compared to non-chewers was 3.3.(ABSTRACT TRUNCATED AT 250 WORDS)

Adolescent↗
PubMed1995

A study of the double mutation of dnaJ and cbpA, whose gene products function as molecular chaperones in Escherichia coli.

The CbpA protein is an analog of the DnaJ molecular chaperone of Escherichia coli. To gain insight into the function of CbpA, we examined the nature of a cbpA null mutation with special reference to those of dnaK and dnaJ null mutations. In particular, the cbpA dnaJ double-null mutant was found to exhibit severe defects in cell growth, namely, a very narrow temperature range for growth, a defect in cell division, and susceptibility to killing by carbon starvation. These phenotypes are very similar to those reported for dnaK null mutants but not to those of dnaJ null mutants. Our results are best interpreted by assuming that CbpA is capable of compensating for DnaJ for cell growth and thus that the function(s) of CbpA is closely related to that of DnaJ.

Cell Division↗