PubMed Health⌕ Search

Biomedical subjects

T Pieler

Publications and source records attributed to T Pieler.

71 records · Page 4Linked to original sources
PubMed1987

A split binding site for TFIIIC on the Xenopus 5S gene.

We have previously shown that of the two functional domains which constitute the Xenopus 5S gene promoter the common, conserved box A element is directly involved in the binding of the common transcription factor IIIC. Here, we describe the investigation of the role of the 5S gene specific promoter element, box C, in transcription factor binding. Analysis of 22 different single site basepair changes reveals that mutations created within the 5'-region of this segment interfere with transcription due to a reduced affinity for TFIIIA, whereas sequence alterations introduced into the 3'-region of the same element similarly inhibit transcription, but do not result in a measurable defect in TFIIIA binding. Instead, they clearly reduce the affinity for TFIIIC. DNase I protection experiments with TFIIIA on 5S mutants which have an increased spacing of box A and box C demonstrate that TFIIIA recognizes a specific box A sequence element and that the factor has to be properly aligned on the DNA template in order to allow stable complex formation with TFIIIC to proceed. The structural and functional organization of protein binding signals on the 5S gene internal control region will be discussed in regard to these results.

Animals↗
PubMed1987

Evolution of organisms and organelles as studied by comparative computer and biochemical analyses of ribosomal 5S RNA structure.

The results documented in this publication demonstrate that for evolutionary studies the ribosomal 5S rRNA is a suitable object for such an investigation and that as many methods as possible should be consulted. In this study the results of biochemical and chemical experiments were combined with those of computer sequence analyses, and they revealed that these methods complement each other nicely. We are currently at a state at which we are able to well define the secondary structures of the 5S rRNAs for eubacteria, organelles, archaebacteria, and eukaryotes and we are even able to propose a secondary structure for a Ur-5S rRNA. It is also clear that in the future the present studies should be continued and extended in such a way that the tertiary structures of these molecules will become known.

Animals↗
PubMed1986

Analysis of the RNA structural elements involved in the binding of the transcription factor III A from Xenopus laevis.

Xenopus laevis 5S rRNA isolated from 7S particles or transcribed in vitro is found to adopt two alternative conformations. These two conformers contain different structural elements within the major TF III A binding domain, which, when isolated as RNA fragments, still interact with the transcription factor. Chemical modification of easily accessible adenines in their N-1 position does not have any measurable effect on the binding of 5S rRNA to TF III A. These observations are in support of the idea that only a small amount of conserved sequence information is required for the binding of the transcription factor, whereas specific secondary structure features seem to be essential.

Animals↗
PubMed1986

Improved procedure for the isolation of a double-strand-specific ribonuclease and its application to structural analysis of various 5S rRNAs and tRNAs.

An improved method for the isolation of a double-strand-specific RNase from snake venom is presented. This RNase, called CSV, was used to cleave yeast tRNAPhe and tRNA2Glu and tRNAfMet from Escherichia coli. In addition these RNAs and E. coli tRNAPhe were examined with the single-strand-specific nuclease S1. The results are discussed in terms of the specificity of CSV RNase and the structure of tRNAs. S1 nuclease digestions at increasing temperatures allowed the melting of tertiary and secondary structure to be monitored. 5S rRNA from E. coli, Thermoplasma acidophilum and the chloroplasts of Spinacia oleracea were digested with CSV and S1. The information these results give on the secondary-structural differences between different classes of 5S rRNA are discussed. Supporting evidence is found for tertiary interactions between hairpin loop c and internal loop d of eubacterial 5S rRNA.

Animals↗
PubMed1985

Functional domains of the Xenopus laevis 5S gene promoter.

To study the fine structure of the Xenopus laevis somatic 5S gene internal control region, we have created 15 different transversions using mutagenic oligonucleotide primers. The effects of these mutations on 5S DNA transcription in vitro as well as on stable complex formation with transcription factor TF III A and TF III C in crude nuclear extracts were analyzed. Mutations in the common class III 5' promoter element (nucleotides 50-61 in the 5S gene) interfere with transcription activity and stable complex formation whenever they contradict the tDNA box A consensus sequence. The second promoter element is defined by a major sequence block (nucleotides 80-89, box C) and two additional internal residues (70 and 71) at a distance of roughly one helical turn from both the major 3' and 5' control sequences; these two 3' elements contain the primary TF III A binding domain. The remaining nucleotides (62-69 and 71-79) when mutated do not interfere with transcription activity or factor binding and thus they constitute two spacer elements within a symmetrically structured 5S gene promoter. An increase in the relative spacing of box A and box C by insertion of 3 bp between nucleotides 66 and 67 leads to a drastic reduction in transcription activity and the ability to form a stable complex with TF III A and/or TF III C. Thus, accurate spacing is essential for the proper orientation of TF III A on 5S DNA and/or TF III C binding.

Animals↗
PubMed1985

Point mutational analysis of the Xenopus laevis 5S gene promoter.

We have introduced C to T transitions into GC and CG base pairs of the Xenopus laevis somatic 5S gene coding region and its 5' flank in order to analyse their effects on transcription activity and regulation. These studies allow us to differentiate between the two promoter elements and their spacer, within the internal control region. Mutations within the 5' element which dissent from the corresponding tRNA consensus sequence reduce transcription activity substantially without significantly affecting transcription factor (TF) III A binding. Mutations in the spacer region have no pronounced effect on transcription. The 3' promoter element is found to extend to position 97, since mutations in this region interfere with transcription activity. This may be, at least partially, attributable to a reduced competition strength for TF III A.

Animals↗
PubMed1985

RNA structural dynamics: pre-melting and melting transitions in E. coli 5S rRNA.

The temperature dependent transition from duplex to a single strand in E. coli 5S ribosomal RNA is a multistep process, and it involves intermediate states. We have analyzed these structural dynamics by chemical modification of cytidines and by single strand specific nuclease digestions. This combined approach led to the characterization of premelting and melting transitions within individual structural segments of the native macromolecule, which we feel may find general application to the structure of biological polyribonucleotides: 1) G-C base pairs at the termini of helices are relatively unstable and they readily undergo premelting transition. 2) Internal G-U/A-U rich stretches of helices exhibit dynamic premelting properties. 3) Hairpin loops have a relatively stronger destabilizing effect than internal loops. 4) Bulge loops destabilize the neighbouring base pairs. 5) Melting of helical segments occurs starting from the destabilizing structures listed above, preferentially from the helix termini. E. coli 5S rRNA has been shown to adopt different conformations. The presence of urea leads to induction of enhancement in the sensitivity for nuclease S1 at several nucleotide positions. The possibility of structural rearrangements will be discussed.

Base Sequence↗
PubMed1984

Structural requirements for the interaction of 5S rRNA with the eukaryotic transcription factor IIIA.

In order to study the binding of the eukaryotic transcription factor IIIA to heterologous 5S rRNAs with a low degree of overall sequence conservation (less than 20%) we have utilized a transcription competition assay involving eubacterial, archaebacterial and eukaryotic 5S rRNAs. All the molecules inhibit Xenopus 5S rRNA transcription specifically, which suggests that only a small amount of specific conserved RNA sequences, if indeed any, are essential for the interaction of the transcription factor with the 5S rRNA molecule, whereas universal 5S rRNA secondary structure elements seem to be required. A fragment of Xenopus laevis oocyte 5S rRNA (nucleotides 41-120), which partially maintains the original 5S rRNA structure, also competes for TF III A. In vitro transcription of a naturally occurring mutant of the Xenopus laevis oocyte 5S rRNA gene, the pseudogene, which carries several point mutations within the TF III A binding domain is equally inhibited by exogenous Xenopus 5S rRNA.

Animals↗
PubMed1984

Comparative structural analysis of eubacterial 5S rRNA by oxidation of adenines in the N-1 position.

Adenines in free 5S rRNA from Escherichia coli, Bacillus stearothermophilus and Thermus thermophilus have been oxidized at their N-1 position using monoperphthalic acid. The determination of the number of adenine 1-N-oxides was on the basis of UV spectroscopic data of the intact molecule. Identification of the most readily accessible nucleotides by sequencing gel analysis reveals that they are located in conserved positions within loops, exposed hairpin loops and single-base bulge loops. Implications for the structure and function of 5S rRNA will be discussed on the basis of this comparative analysis.

Adenine↗
PubMed1984

Reconstitution of 50 S ribosomal subunits from Bacillus stearothermophilus with 5 S RNA from spinach chloroplasts and low-Mr RNA from mitochondria of Locusta migratoria and bovine liver.

Reconstitution experiments with 50 S ribosomal subunits from Bacillus stearothermophilus demonstrate that spinach chloroplast 5 S rRNA can be incorporated into the bacterial ribosome and yield biologically active particles, thereby establishing the eubacterial nature of chloroplast 5 S rRNA. In contrast, mitochondria from Locusta migratoria or bovine liver do not appear to contain discrete, low-Mr RNAs, which can replace 5 S rRNA in the functional reconstitution of B. stearothermophilus ribosomes.

Animals↗
PubMed1983

Isolation and characterization of a 7 S RNP particle from mature Xenopus laevis oocytes.

Mature oocytes of Xenopus laevis contain a 7 S RNP particle consisting of two components, ribosomal 5 S RNA and a protein of Mr approximately 45000. The structure of the free 5 S rRNA and the 7 S RNP complex has been studied by diethylpyrocarbonate modification of adenines. A74, A77, A90, A100, A101 and A103 of the 5 S rRNA are protected upon association of the protein.

Animals↗
PubMed1983

Comparative structural analysis of cytoplasmic and chloroplastic 5S rRNA from spinach.

5S rRNAs from Spinacea oleracea cytoplasmic and chloroplastic ribosomes have been subjected to digestion with the single strand specific nuclease S1 and to chemical modification of cytidines by sodium bisulphite in order to probe the RNA structure. According to these data, cytoplasmic 5S rRNA can be folded as proposed in the general eukaryotic 5S rRNA structure (1) and 5S rRNA from chloroplastides is shown to be more related to the general eubacterial structure (2).

Base Sequence↗
PubMed1983

Dynamics of ribosomal RNA structure.

The structural dynamics of ribosomal 5S RNAs have been investigated by probing single strandedness through enzymatic cleavage and chemical modification. This comparative study includes 5S rRNAs from E. coli, B. stearothermophilus, T. thermophilus, H. cutirubrum, spinach chloroplast, spinach cytomplasm, and Artemia salina. The structural studies support a unique tertiary interaction in eubacterial 5S rRNAs, involving nucleotides around positions 43 and 75. In addition long range structural effects are demonstrated in E. coli 5S rRNA due to the conversion of C to U at position 92.

Base Sequence↗
PubMed1982

Nucleotide sequence and secondary structure analysis of spinach chloroplast 4.5 S RNA.

The nucleotide sequence of the 4.5 S ribosomal RNA from Spinacia oleracea chloroplast has been determined to be HOAGAGAAGGUCACGGCGAGACGAGCCGUUUAUCAUUAC GAUAGGUGUCAAGUGGAAGUGCAGUGAUGUAUGCAGCUGAGGCAUCCUAACAGACCCACAGACUUGAACOH using rapid gel sequencing techniques. This RNA contains 106 nucleotides including an AGA sequence at the 5'-end not found in other chloroplast 4.5 S RNAs and a seven-nucleotide segment absent in the sequences of wheat and maize 4.5 S RNAs. Except for these differences, the sequence of spinach 4.5 S RNA is highly homologous with those of other species. It shows 95% sequence homology to that of tobacco and 78% homology to those of wheat and maize. The secondary structure was probed using limited ribonuclease T1 and nuclease S1 digestions. The results support the 5'-half of the secondary structure model previously proposed for 4.5 S RNA (Machatt, M. A., Ebel, J.-P., and Branlant, C. (1981) Nucleic Acids Res. 9, 1533-1549) but are inconsistent with the rest of that model. An alternative model for spinach 4.5 S RNA is discussed.

Base Sequence↗
PubMed1982

Three-dimensional structural model of eubacterial 5S RNA that has functional implications.

Escherichia coli 5S RNA and its specific protein complexes were hydrolyzed with the single-strand-specific nuclease S1. Based on the results, a tertiary structural model for E. coli 5S RNA is proposed in which ribosomal proteins E-L5, E-L18, and E-L25 influence the conformation of the RNA. This may be of significance for ribosomal function. Comparison of the proposed E. coli 5S RNA structure with those of 18 other prokaryotic 5S RNAs led to a generalized eubacterial 5S RNA tertiary structure in which the majority of the conserved nucleotides are in non-base-paired regions and several conserved "looped-out" adenines (in E. coli, adenines -52, -53, -57, -58, and -66) are implied to be important for protein recognition or interaction or both.

Endonucleases↗
PubMed1982

The effect of a cytidine-to-uridine transition on the stability of Escherichia coli A19 5-S RNA.

We have been able to isolate several species of 5-S ribosomal RNA from Escherichia coli A19. These molecules were separated on the basis of their differing stabilities during electrophoresis on 12% polyacrylamide gels in 7 M urea. This differing stability is shown, in one case, to be due to a different primary sequence. We have determined the sequence of the least stable of these molecules and have found only one difference to the published sequence of E. coli A19 5-S RNA, namely a uridine in place of a cytidine at position 92. The consequent G x U base pair, formed in a normally highly stable G x C-rich region, is responsible for a drastic reduction in the stability of the molecule. This instability leads to a less constrained, more compact molecule which thus migrates faster in electrophoresis under denaturing conditions. This species of 5-S RNA is shown to make up 30% of the total 5-S RNA in the 50-S ribosomal subunits in this organism. Further structural studies were carried out using S1 nuclease digestion, sodium bisulphite modification and thermal melting analysis. All these methods indicate a 5-S RNA drastically destabilized in parts of its secondary and tertiary structure. Finally, the ability of the variant 5-S RNA to recognize and form a complex with its 50-S subunit binding proteins was examined and found to be impaired.

Cytidine↗