Biomedical subjects

T Sreenath

Publications and source records attributed to T Sreenath.

12 recordsLinked to original sources

PubMed2006

Amelogenin-mediated regulation of osteoclastogenesis, and periodontal cell proliferation and migration.

We previously reported that amelogenin isoforms M180 and leucine-rich amelogenin peptide (LRAP) are expressed in the periodontal region, and that their absence is associated with increased cementum defects in amelogenin-knockout (KO) mice. The aim of the present study was to characterize the functions of these isoforms in osteoclastogenesis and in the proliferation and migration of cementoblast/periodontal ligament cells. The co-cultures of wild-type (WT) osteoclast progenitor and KO cementoblast/periodontal ligament cells displayed more tartrate-resistant acid phosphatase (TRAP)-positive cells than the co-cultures of WT cells. The addition of LRAP to both co-cultures significantly reduced RANKL expression and the TRAP-positive cells. Proliferation and migration rates of the KO cementoblast/periodontal ligament cells were lower than those of WT cells and increased with the addition of either LRAP or P172 (a porcine homolog of mouse M180). Thus, we demonstrate the regulation of osteoclastogenesis by LRAP, and the proliferation and migration of cementoblast/periodontal ligament cells by LRAP and P172.

Amelogenin↗

PubMed2004

Transgenic mouse model of early-onset DYT1 dystonia.

Early-onset dystonia is an autosomal dominant movement disorder associated with deletion of a glutamic acid residue in torsinA. We generated four independent lines of transgenic mice by overexpressing human DeltaE-torsinA using a neuron specific enolase promoter. The transgenic mice developed abnormal involuntary movements with dystonic-appearing, self-clasping of limbs, as early as 3 weeks after birth. Animals also showed hyperkinesia and rapid bi-directional circling. Approximately 40% of transgenic mice from each line demonstrated these severe behavioral abnormalities. Neurochemical analyses revealed decreases in striatal dopamine in affected transgenic mice, although levels were increased in those that had no behavioral changes. Immunohistochemistry demonstrated perinuclear inclusions and aggregates that stained positively for ubiquitin, torsinA and lamin, a marker of the nuclear envelope. Inclusions were detected in neurons of the pedunculopontine nucleus and in other brain stem regions in a pattern similar to what has been described in DYT1 patients. This transgenic mouse model demonstrates behavioral and pathologic features similar to patients with early-onset dystonia and may help to better understand the pathophysiology of this disorder and to develop more effective therapies.

Amino Acid Sequence↗

PubMed2004

Is the lingual forming part of the incisor a structural entity? Evidences from the fragilitas ossium (fro/fro) mouse mutation and the TGFbeta1 overexpressing transgenic strain.

Our objective was to study the teeth of a mutant mice fro/fro that display severe forms of osteogenesis imperfecta. One day and 8 week-old fro/fro and +/fro heterozygote mice (wild type, WT) were processed for light and scanning electron microscopy. The genetic defect, shown to be located on chromosome 8, induced alveolar bone and teeth hypomineralisation. Due to defective cell proliferation in the fro/fro, the distal growth of the mandibular incisors was impaired. Immunolabelling revealed an increase of chondroitin/dermatan sulphate, whereas no difference was detected in dental tissues for decorin and biglycan. Amelogenin expression was decreased in the incisor and enhanced in the molar. Dentin sialoprotein was below the level of detection in the fro/fro, whereas osteonectin and osteopontin were unchanged. The main target of the mutation was seen in the lingual part of the incisor near the apex where dentine formation was delayed. In the molars, bulbous roots with obliteration of the pulp chamber were seen. In the TGFbeta1 overexpressing mice, the lingual root-analogue part of the incisor was missing. In the molar, short roots, circumpulpal dentine of the osteodentine type and pulp obliteration were seen. It may be noted that, although the mutant and transgenic strains mutations are two different genetic alterations not related to the same defective gene, in both cases the expression of the dentin sialoprotein is altered. Altogether, the present data suggest that the lingual forming part of the incisor seems to be an anatomical entity bearing its own biological specificities.

Amelogenin↗

PubMed2001

Amelogenin-deficient mice display an amelogenesis imperfecta phenotype.

Dental enamel is the hardest tissue in the body and cannot be replaced or repaired, because the enamel secreting cells are lost at tooth eruption. X-linked amelogenesis imperfecta (MIM 301200), a phenotypically diverse hereditary disorder affecting enamel development, is caused by deletions or point mutations in the human X-chromosomal amelogenin gene. Although the precise functions of the amelogenin proteins in enamel formation are not well defined, these proteins constitute 90% of the enamel organic matrix. We have disrupted the amelogenin locus to generate amelogenin null mice, which display distinctly abnormal teeth as early as 2 weeks of age with chalky-white discoloration. Microradiography revealed broken tips of incisors and molars and scanning electron microscopy analysis indicated disorganized hypoplastic enamel. The amelogenin null phenotype reveals that the amelogenins are apparently not required for initiation of mineral crystal formation but rather for the organization of crystal pattern and regulation of enamel thickness. These null mice will be useful for understanding the functions of amelogenin proteins during enamel formation and for developing therapeutic approaches for treating this developmental defect that affects the enamel.

Amelogenesis Imperfecta↗

PubMed2001

Neuronal cyclin-dependent kinase 5 activity is critical for survival.

Cyclin-dependent kinase 5 (Cdk5) null mice exhibit a unique phenotype characterized by perinatal mortality, disrupted cerebral cortical layering attributable to abnormal neuronal migration, lack of cerebellar foliation, and chromatolytic changes of neurons in the brainstem and the spinal cord. Because Cdk5 is expressed in both neurons and astrocytes, it has been unclear whether this phenotype is primarily attributable to defects in neurons or in astrocytes. Herein we report reconstitution of Cdk5 expression in neurons in Cdk5 null mice and its effect on the null phenotype. Unlike the Cdk5 null mice, the reconstituted Cdk5 null mice that express the Cdk5 transgene under the p35 promoter (TgKO mice) were viable and fertile. Because Cdk5 expression is mainly limited to neurons in these mice and rescues the defects in the nervous system of the Cdk5 null phenotype, it clearly demonstrates that Cdk5 activity is necessary for normal development and survival of p35-expressing neurons.

Animals↗

PubMed2001

Neuron-specific expression of Cre recombinase during the late phase of brain development.

Gene targeting to disrupt gene expression in a temporal and spatial manner in a specific tissue using Cre recombinase-mediated gene inactivation has been proven to be useful to study in vivo gene function. To delete genes specifically in neurons during the late phase of brain development, we have generated transgenic mouse lines that express Cre recombinase under the control of the murine neurofilament-H (mNF-H) gene promoter. In this study, we report that one of these mouse lines expresses Cre recombinase specifically in the neurons of the brain and spinal cord during the late stage of their development. The transgenic line displays specific excision of the loxP-flanked gene in the neurons just after embryonic day 18.5 (E.18.5), which coincides with the later phase of brain maturation including spinal cord and olfactory bulb area. This mNF-H-cre transgenic mouse line will be valuable for studying in vivo functions of neuron-specific genes, particularly, defining their precise roles in the mature nervous system using conditional gene targeting strategies.

Age Factors↗

PubMed2000

Reduced expression of dentin sialophosphoprotein is associated with dysplastic dentin in mice overexpressing transforming growth factor-beta 1 in teeth.

Transforming growth factor (TGF)-beta1 is expressed in developing tooth from the initiation stage through adulthood. Odontoblast-specific expression of TGF-beta1 in the tooth continues throughout life; however, the precise biological functions of this growth factor in the odontoblasts are not clearly understood. Herein, we describe the generation of transgenic mice that overexpress active TGF-beta1 predominantly in the odontoblasts. Teeth of these mice show a significant reduction in the tooth mineralization, defective dentin formation, and a relatively high branching of dentinal tubules. Dentin extracellular matrix components such as type I and III collagens are increased and deposited abnormally in the dental pulp, similar to the hereditary human tooth disorders such as dentin dysplasia and dentinogenesis imperfecta. Calcium, one of the crucial inorganic components of mineralization, is also apparently increased in the transgenic mouse teeth. Most importantly, the expression of dentin sialophosphoprotein (dspp), a candidate gene implicated in dentinogenesis imperfecta II (MIM 125420), is significantly down-regulated in the transgenic teeth. Our results provide in vivo evidence suggesting that TGF-beta1 mediated expression of dspp is crucial for dentin mineralization. These findings also provide for the first time a direct experimental evidence indicating that decreased dspp gene expression along with the other cellular changes in odontoblasts may result in human hereditary dental disorders like dentinogenesis imperfecta II (MIM 125420) and dentin dysplasia (MIM 125400 and 125420).

Animals↗

PubMed1999

Androgen-independent expression of hoxb-13 in the mouse prostate.

BACKGROUND: Hox genes encode transcriptional regulatory proteins that are largely responsible for establishing the body plan of all metazoan organisms. A subset of Hox genes is expressed during the period of organogenesis and into adulthood. hoxb-13 is a recently-described member of the Hox gene family that is expressed in the spinal cord, hindgut, and urogenital sinus during embryogenesis. METHODS: Northern blot and in situ hybridization analyses of hoxb-13 expression in adult mouse tissues were performed. RESULTS: hoxb-13 mRNA is restricted to the prostate gland and distal colon in adult animals. In situ hybridization of mouse prostate tissue demonstrated that hoxb-13 is expressed in the epithelial cells of the ventral, dorsal, lateral, and anterior prostate lobes. Accumulation of hoxb-13 mRNA is not diminished following castration. CONCLUSIONS: These data demonstrate that hoxb-13 expression is androgen-independent in mouse prostate glands. The identification of hoxb-13 as an androgen-independent gene expressed in adult mouse prostate epithelial cells provides a new potential target for developing therapeutics to treat advanced prostate cancer.

Androgens↗

PubMed1999

Expression pattern of macrophage migration inhibitory factor during embryogenesis.

Although macrophage migration inhibitory factor (MIF) was originally identified as a lymphokine that inhibits the migration of macrophages, its ubiquitous expression suggests it may have a role beyond the immune system. Here we report a detailed characterization of MIF expression during mouse embryogenesis. The MIF expression pattern was found to parallel tissues specification and organogenesis.

Animals↗

PubMed1995

Gain of function mutations for paralogous Hox genes: implications for the evolution of Hox gene function.

To investigate the functions of paralogous Hox genes, we compared the phenotypic consequences of altering the embryonic patterns of expression of Hoxb-8 and Hoxc-8 in transgenic mice. A comparison of the phenotypic consequences of altered expression of the two paralogs in the axial skeletons of newborns revealed an array of common transformations as well as morphological changes unique to each gene. Divergence of function of the two paralogs was clearly evident in costal derivatives, where increased expression of the two genes affected opposite ends of the ribs. Many of the morphological consequences of expanding the mesodermal domain and magnitude of expression of either gene were atavistic, inducing the transformation of axial skeletal structures from a modern to an earlier evolutionary form. We propose that regional specialization of the vertebral column has been driven by regionalization of Hox gene function and that a major aspect of this evolutionary progression may have been restriction of Hox gene expression.

Animals↗

PubMed1992

Expression of matrix metalloproteinase genes in transformed rat cell lines of high and low metastatic potential.

The enzymes that comprise the family of matrix metalloproteinases (MMPs) share the capacity to degrade extracellular matrix components. A large body of evidence indicates that certain members of this metalloproteinase gene family play critical roles in determining the malignant phenotype of solid tumors. We previously have derived transformed cell lines with vastly different metastatic potentials by transfecting different combinations of oncogenes into primary rat embryo cells. Conditioned medium from those cell lines was assayed by Western blot analysis for the production of four separate matrix metalloproteinases to see whether a correlation could be found between protease expression and the metastatic phenotype. The transformed rat embryo cell lines with high metastatic potential were found to produce high levels of the stromelysin 1 (MMP-3) and stromelysin 2 (MMP-10) proteases, while the nonmetastatic lines produced low or undetectable levels of these two enzymes. No correlation was seen between the metastatic phenotype of the cell lines and the level of expression of two other matrix metalloproteinases, the M(r) 72,000 type IV collagenase (MMP-2) and the M(r) 92,000 gelatinase (MMP-9). These data suggest that the differential regulation of the stromelysin proteases may contribute to the difference seen in the metastatic potential of these cell lines.

Animals↗

PubMed1990

Transcriptional regulatory elements of the RAS2 gene of Saccharomyces cerevisiae.

We have analyzed a series of 5' deletions of the RAS2 gene to investigate its complex transcriptional regulation in the yeast Saccharomyces cerevisiae. Two positive transcriptional regulatory elements were identified. Element A regulates two of the three clusters of RAS2 transcripts. This element is capable of activating a heterologous promoter and contains two copies of the sequence CCTCGCCCC. Although one copy is sufficient for partial transcriptional activation, both copies are required for maximal RAS2 induction. Deletion of one copy resulted in a reduced level of RAS2 mRNA, selective loss of cluster II transcripts and reduced ability to activate the heterologous CYC1 promoter. Each of the 9 bp C rich repeats of element A is part of a sequence with extensive homology to a transcriptional regulatory element upstream of the human epidermal growth factor receptor (EGFR) gene. Element B contains a tandem duplication of a 21 nucleotide sequence TACATATATATATATCTTAG and activates cluster I RAS2 transcripts in the absence of Element A. The physiological role of these deletions was determined by assaying their ability to support growth on a nonfermentable carbon source. RAS2 promoter deletions containing either element A or B were able to overcome this growth defect characteristic of ras2 mutants cells. Deletion of both elements resulted in an insufficient amount of RAS2 protein for growth on a non-fermentable carbon source.

Base Sequence↗