Biomedical subjects

Takayuki Horiuchi

Publications and source records attributed to Takayuki Horiuchi.

7 recordsLinked to original sources

PubMed2006

Alternative trans-splicing: a novel mode of pre-mRNA processing.

Alternative splicing is an important process contributing to proteome diversity without involving an increase in the number of genes. In some cases, alternative splicing is carried out under 'trans-mode', called alternative trans-splicing, in which exons located on separate pre-mRNA molecules are selectively joined to produce mature mRNAs encoding proteins with distinct structures and functions. However, it is not known how widespread or how frequently trans-splicing occurs in vivo. Recently, trans-allelic trans-splicing has been unambiguously demonstrated in Drosophila using a SNP (single nucleotide polymorphism) as a marker. In this review, we provide an overview of alternative trans-splicing in Drosophila and mammals, and discuss its mechanisms.

Alternative Splicing↗

PubMed2003

Alternative trans-splicing of constant and variable exons of a Drosophila axon guidance gene, lola.

longitudinals lacking (lola) is a complex Drosophila gene encoding at least 20 protein isoforms,each bearing the same N-terminal constant region linked to a different C-terminal variable region. Different isoforms specify different aspects of axon growth and guidance. We show here that lola mRNAs are generated by alternative trans-splicing of exons sequentially encoded by the same DNA strand. Chromosomal pairing facilitates interallelic trans-splicing,allowing complementation between mutations in the constant and those in the variable exons. We demonstrate that at least one variable exon is transcribed from its own promoter,and trans-spliced to the constant exons transcribed separately.

Alternative Splicing↗

PubMed2003

Drosophila lola encodes a family of BTB-transcription regulators with highly variable C-terminal domains containing zinc finger motifs.

Alternative splicing is an important mechanism contributing to the increased proteome diversity in higher eukaryotes. We have explored the alternative splicing events in the Drosophila longitudinals lacking (lola) gene by means of 5' RACE, 3' RACE, genome sequence searches, and EST sequencing. We demonstrated that the lola locus is comprised of 32 exons spanning over 60 kb, and encodes a total of 80 alternatively spliced variants consisting of 5' and 3' variable sequences and constitutive common exons. All the variants shared a common sequence (exons 5-8) encoding the N-terminal region containing the BTB domain, but both the 5' and 3' ends were variable. There were four promoters responsible for the variation in the 5' end (exons 1-4). Alternative splicing was involved in the variation in the 3' end corresponding to the C-terminal variable region, which was encoded by one or two exons that were selected from 20 groups of exons in a mutually exclusive manner (exons 9-32). Seventeen of the 20 isoforms contained C(2)H(2)-like zinc finger motifs in the C-terminal variable region. Analyses of the 3' variant-specific cDNA pools revealed that all combinations of 5' and 3' variable sequences were expressed in both the embryonic and third instar larval stages. Since the BTB domain mediates dimerization, lola encodes a family of transcription regulators with a large variety of DNA- or protein-binding specificities, and could be involved in various developmental processes, including the embryonic neural pathfindings. We also showed that the structures of Lola isoforms were highly conserved in Drosophila pseudoobscura.

3' Untranslated Regions↗

PubMed2003

Regulation of FRUA expression during vegetative growth and development of Myxococcus xanthus.

Expression of the fruA gene, encoding a putative transcription factor essential for fruiting body formation of Myxococcus xanthus, is specifically activated during development. In the present study, we have analyzed the mechanism of the transcriptional regulation of fruA expression. From gel retardation and footprinting assays using various fruA regulatory regions as probes and competitors, a protein designated factor X was found to specifically bind to a sequence (xbs) located downstream of the transcription-initiation site (+78 to +94) of the fruA gene. Factor X activity was present during vegetative growth and decreased during early development. Analysis of promoter activities of various segments of the fruA regulatory region using the lacZ reporter gene in vivo indicated that a DNA segment extending 45-bp upstream from the transcription-initiation site was required for developmentally regulated fruA expression at a low level. In addition, cis-acting regulatory regions located upstream and downstream of the fruA promoter region and including C-box and xbs, were found to be involved in regulation of fruA expression during development. When inserted into the vegA gene, the xbs element inhibited vegA expression during vegetative growth. Together with previously reported results, our studies reveal that fruA expression is regulated by both positive and negative mechanisms during the M. xanthus life cycle.

Bacterial Proteins↗

PubMed2002

Glass microchip with three-dimensional microchannel network for 2 x 2 parallel synthesis.

An integrated multireactor system for 2 x 2 parallel organic synthesis has been developed on a single glass microchip. Three-dimensional channel circuits in the chip were fabricated by laminating three glass plate layers. The fabrication method is a straightforward extension of the conventional one, and topological equivalence for any three-dimensional circuits can be constructed easily with it. 2 x 2 phase-transfer amide formation reactions, which constitute a simple model for combinatorial synthesis, were successfully carried out on the microchip, and the integrity of the three-dimensional circuits was confirmed. Combinatorial chemistry with multi-microreactors, in conjunction with a high-throughput screening method based on micro-TAS technologies, is expected to provide an efficient tool for drug discovery.

Journal Article↗

PubMed2002

Role of fruA and csgA genes in gene expression during development of Myxococcus xanthus. Analysis by two-dimensional gel electrophoresis.

Two genes, fruA and csgA, encoding a putative transcription factor and C-factor, respectively, are essential for fruiting body formation of Myxococcus xanthus. To investigate the role of fruA and csgA genes in developmental gene expression, developing cells as well as vegetative cells of M. xanthus wild-type, fruA::Tc, and csgA731 strains were pulse-labeled with [(35)S]methionine, and the whole cell proteins were analyzed using two-dimensional immobilized pH gradient/SDS-PAGE. Differences in protein synthesis patterns among more than 700 protein spots were detected during development of the three strains. Fourteen proteins showing distinctly different expression patterns in mutant cells were analyzed in more detail. Five of the 14 proteins were identified as elongation factor Tu (EF-Tu), Dru, DofA, FruA, and protein S by immunoblot analysis and mass spectroscopy. A gene encoding DofA was cloned and sequenced. Although both fruA and csgA genes regulate early development of M. xanthus, they were found to differently regulate expression of several developmental genes. The production of six proteins, including DofA and protein S, was dependent on fruA, whereas the production of two proteins was dependent on csgA, and one protein was dependent on both fruA and csgA. To explain the present findings, a new model was presented in which different levels of FruA phosphorylation may distinctively regulate the expression of two groups of developmental genes.

Amino Acid Sequence↗

PubMed2002

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Amino Acid Sequence↗