[Multiple endocrine neoplasia type IIb].
Explore the source record for details and available documents.
Adrenal Gland Neoplasms↗
Biomedical subjects
Teturou Satoh
Publications and source records attributed to Teturou Satoh.
Mouse sterol response element binding protein-1c gene expression is negatively regulated by thyroid hormone.
Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1-6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (-574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-alpha/thyroid hormone receptor-beta heterodimer bound to Site2, but retinoid X receptor-alpha/liver X receptor- heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-beta recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3 in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.
Animals↗
Expression of thyroid hormone receptor isoforms down-regulated by thyroid hormone in human medulloblastoma cells.
The role of thyroid hormone (T3) in the regulation of growth and development of the central nervous system including the cerebellum has been well established. However, the effects of thyroid hormone on malignant tumors derived from the cerebellum remain poorly understood. Our analysis mainly focused on expression levels of TR isoforms and the effects of thyroid hormone in human medulloblastoma HTB-185 cells. Northern blot analysis revealed TRalpha2 mRNA but not TRalpha1, beta1 or beta2 mRNA in the cell. The TRalpha1 and TRbeta1 mRNAs were detected only by RT-PCR method and TRbeta2 was not expressed. Incubation of T3 for 24 h decreased TRalpha1, TRalpha2 and TRbeta1 mRNA. Addition of actinomycin D caused an acute increase in the basal TR mRNA levels and the rate of decrease of all kinds of TR isoform mRNA was accelerated in the T3-treated groups compared to controls, indicating that the stability of TR mRNA was affected by T3. Incubation with cycloheximide also blocked a decrease in TR mRNA levels in the T3-treated HTB-185 cells suggesting that down-regulation of TR mRNA required the synthesis of new protein. Our data provide novel evidence for the expression of TRs down-regulated by T3 in HTB-185 cells, suggesting that TR expression is post-transcriptionally regulated by T3 at the level of RNA stability.
Brain Neoplasms↗
Cross-talk between thyroid hormone receptor and liver X receptor regulatory pathways is revealed in a thyroid hormone resistance mouse model.
Hypercholesterolemia is found in patients with hypothyroidism and resistance to thyroid hormone. In this study, we examined cholesterol metabolism in a thyroid hormone receptor beta (TR-beta) mutant mouse model of resistance to thyroid hormone. Whereas studies of cholesterol metabolism have been reported in TR-beta knock-out mice, generalized expression of a non-ligand binding TR-beta protein in this knock-in model more fully recapitulates the hypothyroid state, because the hypothyroid effect of TRs is mediated by the unliganded receptor. In the hypothyroid state, a high cholesterol diet increased serum cholesterol levels in wild-type animals (WT) but either did not change or reduced levels in mutant (MUT) mice relative to hypothyroidism alone. 7alpha-Hydroxylase (CYP7A1) is the rate-limiting enzyme in cholesterol metabolism and mRNA levels were undetectable in the hypothyroid state in all animals. triiodothyronine replacement restored CYP7A1 mRNA levels in WT mice but had minimal effect in MUT mice. In contrast, a high cholesterol diet markedly induced CYP7A1 levels in MUT but not WT mice in the hypothyroid state. Elevation of CYP7A1 mRNA levels and reduced hepatic cholesterol content in MUT animals are likely because of cross-talk between TR-beta and liver X receptor alpha (LXR-alpha), which both bind to a direct repeat + 4 (DR+4) element in the CYP7A1 promoter. In transfection studies, WT but not MUT TR-beta antagonized induction of this promoter by LXR-alpha. Electromobility shift analysis revealed that LXR/RXR heterodimers bound to the DR+4 element in the presence of MUT but not WT TR-beta. A mechanism for cross-talk, and potential antagonism, between TR-beta and LXR-alpha is proposed.
Animals↗
Isolation and characterization of a transcriptional cofactor and its novel isoform that bind the deoxyribonucleic acid-binding domain of peroxisome proliferator-activated receptor-gamma.
Using the DNA-binding domain (DBD) and hinge region of human peroxisome proliferator-activated receptor (PPAR)-gamma as bait in yeast two-hybrid screen, we isolated partial cDNA identical with that of the C terminal of KIAA1769. KIAA1769 encodes a 2080-amino acid protein (molecular mass, 231 kDa) that was recently identified to interact with PPARalpha and termed PPARalpha-interacting cofactor 285 (here referred to as PPARgamma-DBD-interacting protein 1 (PDIP1)-alpha). PDIP1 mRNA was expressed in 3T3-L1 adipocytes and THP-1 macrophages. We also identified the expression of the N terminal extended form of PDIP1alpha (referred to as PDIP1beta) consisting of 2649 amino acids (295 kDa) in human cultured cell lines by RT-PCR, and 5' rapid amplification of cDNA ends. Ribonuclease protection assay revealed that PDIP1beta mRNA was expressed more abundantly than PDIP1alpha mRNA. The C-terminal region of PDIP1 directly binds DBD of PPARgamma, and multiple LXXLL motifs in PDIP1 were not required for the interaction. PDIP1alpha and -beta similarly enhanced PPARgamma-mediated transactivation in transfection assays and short interfering RNA targeting PDIP1 mRNA significantly reduced transactivation by PPARgamma. No potent intrinsic activation domain was identified in either PDIP1 isoforms in mammalian one-hybrid assays, and mutation of all LXXLL motifs did not affect enhancement of PPARgamma-mediated transactivation. PDIP1alpha and -beta similarly augmented transactivation by PPARalpha, PPARdelta, thyroid hormone receptor (TR)-alpha1, TRbeta1, and retinoid X receptor-alpha. PDIP1alpha also enhanced estrogen receptoralpha- and androgen receptor-mediated transactivation, whereas PDIP1beta did not. PDIP1alpha showed receptor-specific synergism with activation function-2-interacting coactivators in PPARgamma- and TRbeta1-mediated transactivation. Together, PDIP1 might function as a transcriptional cofactor for a broad range of nuclear receptors, possibly in collaboration with specific activation function-2 interacting coactivators.
3T3 Cells↗
Thyrotropin-releasing hormone (TRH) specific interaction between amino terminus of P-Lim and CREB binding protein (CBP).
P-Lim (Lhx3a) is a LIM homeodomain transcription factor essential for pituitary development and motor neuron specification in mice. The Lhx3 gene encodes two isoforms, which differ in their amino (N) termini, Lhx3a and 3b. The P-Lim DNA binding site on the glycoprotein hormone alpha subunit (alpha-GSU) gene promoter is conserved in mammals. P-Lim plays a pivotal role in mediating thyrotropin-releasing hormone (TRH) signaling by binding CREB binding protein (CBP), as we have reported previously. Here, we demonstrate that P-Lim (Lhx3a) but not Lhx3b can mediate TRH signaling and bind to CBP. Moreover, TRH specifically induces P-Lim-CBP binding through the N-termini of P-Lim. We also found that the protein kinase C (PKC) phosphorylation site within the N-terminus of P-Lim is responsible for the P-Lim-CBP binding suggesting that the TRH signaling pathway phosphorylates P-Lim. These studies have elucidated the molecular mechanism by which TRH stimulates alpha-GSU gene expression.
Animals↗
Unliganded RXR acts as an inhibitory factor on troglitazone-induced activation.
Troglitazone (TZ), a thiazolidinedione derivative, is a specific ligand for the peroxisome proliferator-activated receptor (PPAR) gamma and improves insulin sensitivity. PPARgamma regulates the expression of genes by binding to PPAR response element in promoter regions of regulator genes as heterodimers with a retinoid X receptor (RXR). We report here that PPARgamma activation by TZ depends on the expression levels of RXR. A transient transfection study in CV-1 cells revealed that the activation by TZ was suppressed by increasing amounts of expression of RXR, but not PPARgamma. Northern blot analysis revealed that PPARgamma and RXR were not expressed in CV-1 cells, and TZ did not induce PPARgamma or RXR mRNA in CV-1 cells indicating that RXR suppression is not related to these endogenous receptor expressions. Electrophoretic mobility shift assay revealed that the increasing amount of RXR did not compete with the DNA binding of the PPARgamma/RXR heterodimer in the presence or absence of TZ. Transfected co-activators enhanced the TZ-dependent gene transcription, and this activation was inhibited by excessive amounts of RXR, indicating that unliganded RXR may recruit the specific coactivators from the PPARgamma/RXR heterodimer.
Animals↗
A patient with classic severe primary hyperparathyroidism in whom both Tc-99m MIBI scintigraphy and FDG-PET failed to detect the parathyroid tumor.
A 24-year-old woman was admitted to our department for further examination of hypercalcemia, a high level of intact parathyroid hormone (PTH) and a right parathyroid tumor. She complained of bone pain throughout her body and was unable to walk due to systemic cystic osteofibrosis, including a brown tumor of the left lower extremities. Neck ultrasonography (US) and magnetic resonance imaging (MRI) revealed a tumor 2 cm in diameter in the upper side of the right thyroid lobe. 99mTc sestamibi (99mTc-MIBI) imaging and F-18 fluorodeoxyglucose positron emission tomography (FDG-PET) were performed to diagnose primary hyperparathyroidism and examination of other parathyroid glands. However, neither imaging modality detected the parathyroid tumor. To confirm the diagnosis, we performed selective venous sampling around the parathyroid and the patient was diagnosed with primary hyperparathyroidism due to a right parathyroid tumor. Resection of the right parathyroid tumor was performed and the pathological diagnosis was parathyroid adenoma. To date, both 99mTc-MIBI and FDG-PET are useful to localize parathyroid tumors. In this case, however, neither modality detected the tumor. Although recent studies state that expression of P-glycoprotein (P-gp) in parathyroid tumors plays an important role in the false-negative results of both 99mTc-MIBI scans and FDG-PET, immunohistological study detected no P-gp expression in the parathyroid tumor in the current case.
Adenoma↗
[Hypothalamic hypogonadism associated with GRH and CRH deficiencies].
Explore the source record for details and available documents.
Adult↗
Activation of peroxisome proliferator-activated receptor-gamma stimulates the growth arrest and DNA-damage inducible 153 gene in non-small cell lung carcinoma cells.
Activation of peroxisome proliferator-activated receptor (PPAR)-gamma by the thiazolidinedione (TZD) class of antidiabetic drugs elicits growth inhibition in a variety of malignant tumors. We clarified the effects of TZDs on growth of human non-small cell lung carcinoma (NSCLC) cells that express endogenous PPAR-gamma. Troglitazone and pioglitazone caused inhibition of cellular growth and induced apoptosis of NSCLC cells in a time- and dose-dependent manner. Subtraction cloning analysis identified that troglitazone stimulated expression of the growth arrest and DNA-damage inducible (GADD)153 gene, and the increased expression of GADD153 mRNA was also confirmed by an array analysis of the 160 apoptosis-related genes. Western blot analysis revealed that troglitazone also increased GADD153 protein levels in a time-dependent manner. Troglitazone did not stimulate GADD153 mRNA levels in undifferentiated 3T3-L1 cells lacking PPAR-gamma expression, whereas its induction was clearly observed in differentiated adipocytes expressing PPAR-gamma. Activity of the GADD153 promoter occurred in a NSCLC cell line in transient transcription assays and was significantly stimulated by troglitazone, although binding of PPAR/retinoid X receptor heterodimer was not detected in the promoter region in gel retardation assays. Inhibition of GADD153 gene expression by an antisense phosphorothionate oligonucleotide attenuated the troglitazone-induced growth inhibition. These findings collectively indicated that activation of PPAR-gamma by TZDs could cause growth inhibition and apoptosis of NSCLC cells and that GADD153 might be a candidate factor implicated in these processes.
Apoptosis↗
A novel TRH-PFTAIRE protein kinase 1 pathway in the cerebellum: subtractive hybridization analysis of TRH-deficient mice.
TRH has been reported to possess several neurophysiological actions in the brain. To gain insights into the molecular mechanisms underlying these effects, particularly in the cerebellum, we attempted to clone a cDNA that was regulated by TRH using TRH knockout mice and subtractive cDNA analysis. Over 100 clones obtained by subtractive hybridization analysis between the wild-type and TRH-1-cerebellum were analyzed. Four clones among them were identical and cdc2-related kinase (PFTAIRE protein kinase 1 (PFTK1)) cDNA, which was previously reported to be expressed only in the brain and testis. PFTK1 mRNA levels in the euthyroid TRH-1- cerebellum supplemented with thyroid hormone were significantly decreased compared with those in the wild-type. Induction of PFTK1 mRNA by TRH was also observed in a time- and dose-dependent manner in human medulloblastoma-derived HTB-185 cells that expressed TRH receptor subtype I mRNA. In addition, treatment of 8-Br-cGMP significantly increased PFTK1 mRNA levels, and a specific inhibitor of cGMP production, ODQ, completely blocked TRH-induced expression of PFTK1 mRNA. Furthermore, induction of PFrK1 mRNA by TRH was significantly inhibited by a NOS specific inhibitor, L-NAME, but not by a MEK inhibitor, PD98059 or a calcium channel inhibitor, nimodipine. These findings demonstrated, for the first time, a novel pathway between a neuropeptide and a cell cycle related peptide in the brain, and PFTK1 may be a key regulator for TRH action in t he cerebellum through t he NO-cGMP pathway.
Animals↗
Transcriptional regulation of the human PRL-releasing peptide (PrRP) receptor gene by a dopamine 2 Receptor agonist: cloning and characterization of the human PrRP receptor gene and its promoter region.
PRL-releasing peptide receptor (PrRPR) mRNA was expressed in pituitary adenomas but was not detected in patients treated with bromocriptine, a specific agonist of dopamine 2 (D2) receptor. Although medical treatment with bromocriptine is effective for patients with pituitary adenomas, little is known about the molecular mechanisms of gene regulation mediated by D2 receptors. The cloned human PrRPR gene spanned approximately 2.0 kb and contained two exons and one intron. Two functional polyadenylation signals located at 510 and 714 bp downstream from the stop codon. A primer extension analysis demonstrated two major transcriptional start sites at 139 and 140 bp upstream from the translational start site and an additional minor site at -161. The promoter region contained several putative binding sites for transcriptional factors including pituitary-specific transcription factor (Pit 1), activator protein 1 (AP-1), and specificity protein (Sp1), but no typical TATA or CAAT box. This promoter showed the strong activity in the pituitary-derived GH4C1 cells, and the region between -697 and -596 bp was responsible for the stimulation both by forskolin and overexpression of cAMP response element binding protein (CREB). These stimulations were significantly suppressed by incubation with bromocriptine in a dose- and time-dependent manner, and the mutant CREB (S133A) completely abolished the inhibitory events of bromocriptine. However, EMSA studies demonstrated that CREB did not bind to this region, to which an approximately 60-kDa protein was strongly bound, and that antibodies against CREB, c-Fos, and Sp1 did not supershift this complex. Furthermore, the amount of this unknown protein was apparently reduced by treatment with bromocriptine. A series of mutation analyses demonstrated that the specific sequence, 5'-cccacatcat-3', was required for both the binding to the 60-kDa protein and the repression by bromocriptine. Therefore, the transcriptional repression of the PrRPR gene by bromocriptine required CREB but was independent of direct binding of CREB to the gene and that the sequence -663 -- -672, 5'-cccacatcat-3', bound to the 60-kDa protein appeared to be critical for this event.
Amino Acid Sequence↗