PubMed Health⌕ Search

Biomedical subjects

Tsuyoshi Monden

Publications and source records attributed to Tsuyoshi Monden.

At least 19 recordsLinked to original sources
PubMed2006

Tetrahydrobiopterin prevents endothelial dysfunction and restores adiponectin levels in rats.

Oxidative stress induces endothelial dysfunction and hypoadiponectinemia. We previously reported that supplementation with tetrahydrobiopterin (BH4), one of the most potent naturally occurring reducing agents and an essential cofactor of enzymatic NO synthase (NOS), ameliorates endothelial dysfunction and reverses hypoadiponectinemia as a result of oxidative stress in rats. To further confirm this hypothesis, we investigated the effects of treatment with BH4 on endothelium-dependent relaxation and adiponectin levels during oxidative stress in fructose-fed rats, which provide an animal model for the metabolic syndrome. Ingestion of a fructose diet for 8 weeks significantly impaired endothelium-dependent arterial relaxation in aortic strips and decreased plasma adiponectin levels, as well as adiponectin mRNA levels within adipose tissue. However, oral supplementation with BH4 (10 mg/kg day) over the final 4 weeks leads to a significant partial reversal of impaired endothelium-dependent arterial relaxation, as well as normalization of plasma adiponectin and fat adiponectin mRNA levels. Moreover, BH4 treatment of the fructose-fed rats significantly reduced the lipid peroxidation content of aorta, heart, liver, and kidney tissues, which were increased in fructose-fed rats. This effect of BH4 treatment may be due to its function as a cofactor for eNOS, as well as its anti-oxidative effects. Thus, BH4 might show promise for the treatment of oxidative stress-induced disorders, including the metabolic syndrome.

Adiponectin↗
PubMed2006

Identification of nesfatin-1 as a satiety molecule in the hypothalamus.

The brain hypothalamus contains certain secreted molecules that are important in regulating feeding behaviour. Here we show that nesfatin, corresponding to NEFA/nucleobindin2 (NUCB2), a secreted protein of unknown function, is expressed in the appetite-control hypothalamic nuclei in rats. Intracerebroventricular (i.c.v.) injection of NUCB2 reduces feeding. Rat cerebrospinal fluid contains nesfatin-1, an amino-terminal fragment derived from NUCB2, and its expression is decreased in the hypothalamic paraventricular nucleus under starved conditions. I.c.v. injection of nesfatin-1 decreases food intake in a dose-dependent manner, whereas injection of an antibody neutralizing nesfatin-1 stimulates appetite. In contrast, i.c.v. injection of other possible fragments processed from NUCB2 does not promote satiety, and conversion of NUCB2 to nesfatin-1 is necessary to induce feeding suppression. Chronic i.c.v. injection of nesfatin-1 reduces body weight, whereas rats gain body weight after chronic i.c.v. injection of antisense morpholino oligonucleotide against the gene encoding NUCB2. Nesfatin-1-induced anorexia occurs in Zucker rats with a leptin receptor mutation, and an anti-nesfatin-1 antibody does not block leptin-induced anorexia. In contrast, central injection of alpha-melanocyte-stimulating hormone elevates NUCB2 gene expression in the paraventricular nucleus, and satiety by nesfatin-1 is abolished by an antagonist of the melanocortin-3/4 receptor. We identify nesfatin-1 as a satiety molecule that is associated with melanocortin signalling in the hypothalamus.

Animals↗
PubMed2006

Correlation between serum osteoprotegerin and biomarkers of bone metabolism during anti-thyroid treatment in patients with Graves' disease.

Bone turnover is increased in favor of resorption in hyperthyroid patients. We aimed to examine whether osteoprotegerin (OPG), which has an inhibitory effect on osteoclasts, is correlated with any biomarkers for bone turnover in Graves' disease. Twenty-one patients with Graves' disease were examined in this study, before and after treatment. Briefly, OPG, calcium, phosphorus, PTH, free T3, free T4, TSH, TSH receptor antibody and TSH-stimulating antibody were measured. Elevated serum OPG levels were decreased in accordance with anti-thyroid treatment. This change of OPG level was associated with thyroid hormone free T4 (r = 0.175, p = 0.038) but not with free T3 (r = 0.164, p = 0.052) and TSH (r = 0.046, p = 0.59). Additionally, there was a negative correlation between OPG and PTH (r = -0.37, p = 0.0001). In stepwise regression analysis, the change in serum OPG levels during anti-thyroid treatment was significantly and independently associated with PTH (F ratio = 24.4, p < 0.0001). Our findings suggest that OPG may prevent excessive bone loss in the hyperthyroid state in accordance with the change of biomarkers for bone turnover.

Adult↗
PubMed2006

Mouse sterol response element binding protein-1c gene expression is negatively regulated by thyroid hormone.

Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1-6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (-574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-alpha/thyroid hormone receptor-beta heterodimer bound to Site2, but retinoid X receptor-alpha/liver X receptor- heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-beta recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3 in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.

Animals↗
PubMed2006

Prolactin secretion in mice with thyrotropin-releasing hormone deficiency.

The physiological roles of TRH in pituitary lactotrophs, particularly during lactation, remain unclear. We studied the prolactin (PRL) status, including serum PRL and PRL mRNA levels in the pituitary, in nonlactating and lactating TRH-deficient (TRH(-/-)) mice with a rescue study with thyroid hormone and TRH. We found that, as reported previously for male TRH(-/-) mice, neither the morphology of the lactotrophs, PRL content in the pituitary, nor the serum PRL concentration was changed in nonlactating female TRH(-/-) mice. However, concurrent hypothyroidism induced a mild decrease in the PRL mRNA level. In contrast, during lactation, the serum PRL level in TRH(-/-) mice was significantly reduced to about 60% of the level in wild-type mice, and this was reversed by prolonged TRH administration, but not by thyroid hormone replacement. The PRL content and PRL mRNA level in the mutant pituitary during lactation were significantly lower than those in wild-type mice, and these reductions were reversed completely by TRH administration, but only partially by thyroid hormone replacement. Despite the low PRL levels, TRH(-/-) dams were fertile, and the nourished pups exhibited normal growth. Furthermore, the morphology of the pituitary was normal, and high performance gel filtration chromatography analysis of the PRL molecule revealed no apparent changes. We concluded that 1) TRH is not essential for pregnancy and lactation, but is required for full function of the lactotrophs, particularly during lactation; and 2) the PRL mRNA level in the pituitary is regulated by TRH, both directly and indirectly via thyroid hormone.

Animals↗
PubMed2006

Ventricular fibrillation due to severe hypokalemia induced by steroid treatment in a patient with thyrotoxic periodic paralysis.

We report a 25-year-old Japanese man with ventricular fibrillation associated with severe hypokalemia. He developed arm and leg paralysis. He had received 2 g of methylprednisolone because thoracic epidural hematoma had been suspected in another hospital. His serum potassium was 0.8 mEq/l on arrival at our hospital. Half an hour after arrival ventricular fibrillation occurred. Treatment with electric defibrillation 8 times was successful. Afterward Graves' disease was diagnosed, therefore, his clinical symptom was diagnosed as thyrotoxic periodic paralysis. We considered that the unusual condition of hyperthyroid-related hypokalemia worsened by steroid therapy induced the ventricular fibrillation.

Adult↗
PubMed2006

Expression of thyroid hormone receptor isoforms down-regulated by thyroid hormone in human medulloblastoma cells.

The role of thyroid hormone (T3) in the regulation of growth and development of the central nervous system including the cerebellum has been well established. However, the effects of thyroid hormone on malignant tumors derived from the cerebellum remain poorly understood. Our analysis mainly focused on expression levels of TR isoforms and the effects of thyroid hormone in human medulloblastoma HTB-185 cells. Northern blot analysis revealed TRalpha2 mRNA but not TRalpha1, beta1 or beta2 mRNA in the cell. The TRalpha1 and TRbeta1 mRNAs were detected only by RT-PCR method and TRbeta2 was not expressed. Incubation of T3 for 24 h decreased TRalpha1, TRalpha2 and TRbeta1 mRNA. Addition of actinomycin D caused an acute increase in the basal TR mRNA levels and the rate of decrease of all kinds of TR isoform mRNA was accelerated in the T3-treated groups compared to controls, indicating that the stability of TR mRNA was affected by T3. Incubation with cycloheximide also blocked a decrease in TR mRNA levels in the T3-treated HTB-185 cells suggesting that down-regulation of TR mRNA required the synthesis of new protein. Our data provide novel evidence for the expression of TRs down-regulated by T3 in HTB-185 cells, suggesting that TR expression is post-transcriptionally regulated by T3 at the level of RNA stability.

Brain Neoplasms↗
PubMed2005

Cross-talk between thyroid hormone receptor and liver X receptor regulatory pathways is revealed in a thyroid hormone resistance mouse model.

Hypercholesterolemia is found in patients with hypothyroidism and resistance to thyroid hormone. In this study, we examined cholesterol metabolism in a thyroid hormone receptor beta (TR-beta) mutant mouse model of resistance to thyroid hormone. Whereas studies of cholesterol metabolism have been reported in TR-beta knock-out mice, generalized expression of a non-ligand binding TR-beta protein in this knock-in model more fully recapitulates the hypothyroid state, because the hypothyroid effect of TRs is mediated by the unliganded receptor. In the hypothyroid state, a high cholesterol diet increased serum cholesterol levels in wild-type animals (WT) but either did not change or reduced levels in mutant (MUT) mice relative to hypothyroidism alone. 7alpha-Hydroxylase (CYP7A1) is the rate-limiting enzyme in cholesterol metabolism and mRNA levels were undetectable in the hypothyroid state in all animals. triiodothyronine replacement restored CYP7A1 mRNA levels in WT mice but had minimal effect in MUT mice. In contrast, a high cholesterol diet markedly induced CYP7A1 levels in MUT but not WT mice in the hypothyroid state. Elevation of CYP7A1 mRNA levels and reduced hepatic cholesterol content in MUT animals are likely because of cross-talk between TR-beta and liver X receptor alpha (LXR-alpha), which both bind to a direct repeat + 4 (DR+4) element in the CYP7A1 promoter. In transfection studies, WT but not MUT TR-beta antagonized induction of this promoter by LXR-alpha. Electromobility shift analysis revealed that LXR/RXR heterodimers bound to the DR+4 element in the presence of MUT but not WT TR-beta. A mechanism for cross-talk, and potential antagonism, between TR-beta and LXR-alpha is proposed.

Animals↗
PubMed2005

Isolation and characterization of a transcriptional cofactor and its novel isoform that bind the deoxyribonucleic acid-binding domain of peroxisome proliferator-activated receptor-gamma.

Using the DNA-binding domain (DBD) and hinge region of human peroxisome proliferator-activated receptor (PPAR)-gamma as bait in yeast two-hybrid screen, we isolated partial cDNA identical with that of the C terminal of KIAA1769. KIAA1769 encodes a 2080-amino acid protein (molecular mass, 231 kDa) that was recently identified to interact with PPARalpha and termed PPARalpha-interacting cofactor 285 (here referred to as PPARgamma-DBD-interacting protein 1 (PDIP1)-alpha). PDIP1 mRNA was expressed in 3T3-L1 adipocytes and THP-1 macrophages. We also identified the expression of the N terminal extended form of PDIP1alpha (referred to as PDIP1beta) consisting of 2649 amino acids (295 kDa) in human cultured cell lines by RT-PCR, and 5' rapid amplification of cDNA ends. Ribonuclease protection assay revealed that PDIP1beta mRNA was expressed more abundantly than PDIP1alpha mRNA. The C-terminal region of PDIP1 directly binds DBD of PPARgamma, and multiple LXXLL motifs in PDIP1 were not required for the interaction. PDIP1alpha and -beta similarly enhanced PPARgamma-mediated transactivation in transfection assays and short interfering RNA targeting PDIP1 mRNA significantly reduced transactivation by PPARgamma. No potent intrinsic activation domain was identified in either PDIP1 isoforms in mammalian one-hybrid assays, and mutation of all LXXLL motifs did not affect enhancement of PPARgamma-mediated transactivation. PDIP1alpha and -beta similarly augmented transactivation by PPARalpha, PPARdelta, thyroid hormone receptor (TR)-alpha1, TRbeta1, and retinoid X receptor-alpha. PDIP1alpha also enhanced estrogen receptoralpha- and androgen receptor-mediated transactivation, whereas PDIP1beta did not. PDIP1alpha showed receptor-specific synergism with activation function-2-interacting coactivators in PPARgamma- and TRbeta1-mediated transactivation. Together, PDIP1 might function as a transcriptional cofactor for a broad range of nuclear receptors, possibly in collaboration with specific activation function-2 interacting coactivators.

3T3 Cells↗
PubMed2005

Thyrotropin-releasing hormone (TRH) specific interaction between amino terminus of P-Lim and CREB binding protein (CBP).

P-Lim (Lhx3a) is a LIM homeodomain transcription factor essential for pituitary development and motor neuron specification in mice. The Lhx3 gene encodes two isoforms, which differ in their amino (N) termini, Lhx3a and 3b. The P-Lim DNA binding site on the glycoprotein hormone alpha subunit (alpha-GSU) gene promoter is conserved in mammals. P-Lim plays a pivotal role in mediating thyrotropin-releasing hormone (TRH) signaling by binding CREB binding protein (CBP), as we have reported previously. Here, we demonstrate that P-Lim (Lhx3a) but not Lhx3b can mediate TRH signaling and bind to CBP. Moreover, TRH specifically induces P-Lim-CBP binding through the N-termini of P-Lim. We also found that the protein kinase C (PKC) phosphorylation site within the N-terminus of P-Lim is responsible for the P-Lim-CBP binding suggesting that the TRH signaling pathway phosphorylates P-Lim. These studies have elucidated the molecular mechanism by which TRH stimulates alpha-GSU gene expression.

Animals↗
PubMed2005

A case of non-specific interstitial pneumonia effectively treated with a combination of prednisolone and colchicine, in which granulation tissue was extensive.

A 56-year-old woman was admitted for interstitial pneumonia, and subsequently diagnosed with idiopathic non-specific interstitial pneumonia with a bronchiolitis obliterans organizing pneumonia pattern, on the basis of clinical and surgical lung biopsy findings. Histological findings revealed diffuse thickness of alveolar walls accompanied by lymphocyte infiltration and fibrosis in the lobules. In addition to those findings, granulation tissue was extensive. Although initial symptom and CT improvement occurred following high-dose prednisolone therapy, the CT did not show further improvement and her serum KL-6 level began increasing again as prednisolone was reduced. With the addition of colchicine therapy, clinical and CT findings improved remarkably and a further reduction of the prednisolone dose was achieved. This case suggests that the combination of colchicine and corticosteroids may be an effective therapy for non-specific interstitial pneumonia.

Anti-Inflammatory Agents↗
PubMed2004

Unliganded RXR acts as an inhibitory factor on troglitazone-induced activation.

Troglitazone (TZ), a thiazolidinedione derivative, is a specific ligand for the peroxisome proliferator-activated receptor (PPAR) gamma and improves insulin sensitivity. PPARgamma regulates the expression of genes by binding to PPAR response element in promoter regions of regulator genes as heterodimers with a retinoid X receptor (RXR). We report here that PPARgamma activation by TZ depends on the expression levels of RXR. A transient transfection study in CV-1 cells revealed that the activation by TZ was suppressed by increasing amounts of expression of RXR, but not PPARgamma. Northern blot analysis revealed that PPARgamma and RXR were not expressed in CV-1 cells, and TZ did not induce PPARgamma or RXR mRNA in CV-1 cells indicating that RXR suppression is not related to these endogenous receptor expressions. Electrophoretic mobility shift assay revealed that the increasing amount of RXR did not compete with the DNA binding of the PPARgamma/RXR heterodimer in the presence or absence of TZ. Transfected co-activators enhanced the TZ-dependent gene transcription, and this activation was inhibited by excessive amounts of RXR, indicating that unliganded RXR may recruit the specific coactivators from the PPARgamma/RXR heterodimer.

Animals↗
PubMed2004

Usefulness of cholescintigraphy with lipid meal loading for diagnosis and determination of cholecystectomy in a patient with gallbladder dysfunction.

A 47-year-old woman was admitted to our hospital because of upper abdominal and back pain. Abdominal ultrasonogram, computed tomogram, endoscopic retrograde cholangiopancreatography and arteriography examination did not reveal any abnormalities. As cholescintigraphy after lipid meal loading detected dysfunction of the gallbladder, we diagnosed dyskinesia of the gallbladder. And the output ratio of the gallbladder from scintigraphy was less than 1%. Cholecystectomy completely relived her from symptoms. Histological examination disclosed chronic cholecystitis and arteritis causing dysfunction of the gallbladder. This case suggested the usefulness of cholescintigraphy with lipid meal loading for gallbladder dysfunction in determining whether or not to do cholecystectomy.

Abdominal Pain↗
PubMed2003

Leucine at codon 428 in the ninth heptad of thyroid hormone receptor beta1 is necessary for interactions with the transcriptional cofactors and functions regardless of dimer formations.

Structure/function studies of the thyroid hormone receptor (TR) beta(1) have demonstrated that single amino acid substitutions in either position 428 or 429 in the ligand-binding domain (LBD) can alter heterodimerizations and homodimerizations, respectively. A leucine at 428 is located in a highly conserved region corresponding to the putative ninth heptad repeat of a leucine-zipper-like motif in the LBD of TRbeta(1). To investigate how the side chain of amino acids at 428 affect receptor characteristics, gel-shift mobility shift assays and yeast two-hybrid assays were analyzed. The neutral status amino acids such as a leucine (wild-type) or a glutamine at 428 preferred heterodimerization with RXR. Furthermore, a positively charged side chain of amino acids at 428 such as an arginine or a lysine, preserved homodimer formation. Irrespective of charge, ninth heptad mutant receptors did not bind the ligand and were not able to interact with either corepressor or coactivating proteins. Limited trypsinization assays revealed no major conformational change in the ninth heptad mutant receptors. Together, these findings suggested that a leucine at 428 was a critical amino acid for both interaction with the thyroid hormone receptor associated proteins and ligand-independent and -dependent functions regardless of dimer formations.

Amino Acid Substitution↗
PubMed2002

Activation of peroxisome proliferator-activated receptor-gamma stimulates the growth arrest and DNA-damage inducible 153 gene in non-small cell lung carcinoma cells.

Activation of peroxisome proliferator-activated receptor (PPAR)-gamma by the thiazolidinedione (TZD) class of antidiabetic drugs elicits growth inhibition in a variety of malignant tumors. We clarified the effects of TZDs on growth of human non-small cell lung carcinoma (NSCLC) cells that express endogenous PPAR-gamma. Troglitazone and pioglitazone caused inhibition of cellular growth and induced apoptosis of NSCLC cells in a time- and dose-dependent manner. Subtraction cloning analysis identified that troglitazone stimulated expression of the growth arrest and DNA-damage inducible (GADD)153 gene, and the increased expression of GADD153 mRNA was also confirmed by an array analysis of the 160 apoptosis-related genes. Western blot analysis revealed that troglitazone also increased GADD153 protein levels in a time-dependent manner. Troglitazone did not stimulate GADD153 mRNA levels in undifferentiated 3T3-L1 cells lacking PPAR-gamma expression, whereas its induction was clearly observed in differentiated adipocytes expressing PPAR-gamma. Activity of the GADD153 promoter occurred in a NSCLC cell line in transient transcription assays and was significantly stimulated by troglitazone, although binding of PPAR/retinoid X receptor heterodimer was not detected in the promoter region in gel retardation assays. Inhibition of GADD153 gene expression by an antisense phosphorothionate oligonucleotide attenuated the troglitazone-induced growth inhibition. These findings collectively indicated that activation of PPAR-gamma by TZDs could cause growth inhibition and apoptosis of NSCLC cells and that GADD153 might be a candidate factor implicated in these processes.

Apoptosis↗
PubMed2002

Transcriptional regulation of the human PRL-releasing peptide (PrRP) receptor gene by a dopamine 2 Receptor agonist: cloning and characterization of the human PrRP receptor gene and its promoter region.

PRL-releasing peptide receptor (PrRPR) mRNA was expressed in pituitary adenomas but was not detected in patients treated with bromocriptine, a specific agonist of dopamine 2 (D2) receptor. Although medical treatment with bromocriptine is effective for patients with pituitary adenomas, little is known about the molecular mechanisms of gene regulation mediated by D2 receptors. The cloned human PrRPR gene spanned approximately 2.0 kb and contained two exons and one intron. Two functional polyadenylation signals located at 510 and 714 bp downstream from the stop codon. A primer extension analysis demonstrated two major transcriptional start sites at 139 and 140 bp upstream from the translational start site and an additional minor site at -161. The promoter region contained several putative binding sites for transcriptional factors including pituitary-specific transcription factor (Pit 1), activator protein 1 (AP-1), and specificity protein (Sp1), but no typical TATA or CAAT box. This promoter showed the strong activity in the pituitary-derived GH4C1 cells, and the region between -697 and -596 bp was responsible for the stimulation both by forskolin and overexpression of cAMP response element binding protein (CREB). These stimulations were significantly suppressed by incubation with bromocriptine in a dose- and time-dependent manner, and the mutant CREB (S133A) completely abolished the inhibitory events of bromocriptine. However, EMSA studies demonstrated that CREB did not bind to this region, to which an approximately 60-kDa protein was strongly bound, and that antibodies against CREB, c-Fos, and Sp1 did not supershift this complex. Furthermore, the amount of this unknown protein was apparently reduced by treatment with bromocriptine. A series of mutation analyses demonstrated that the specific sequence, 5'-cccacatcat-3', was required for both the binding to the 60-kDa protein and the repression by bromocriptine. Therefore, the transcriptional repression of the PrRPR gene by bromocriptine required CREB but was independent of direct binding of CREB to the gene and that the sequence -663 -- -672, 5'-cccacatcat-3', bound to the 60-kDa protein appeared to be critical for this event.

Amino Acid Sequence↗