Biomedical subjects

U Liebl

Publications and source records attributed to U Liebl.

23 records · Page 2Linked to original sources

PubMed1995

Membrane-bound c-type cytochromes in Heliobacillus mobilis. In vivo study of the hemes involved in electron donation to the photosynthetic reaction center.

The amount of heme per photosynthetic reaction center (RC) was examined in whole cells of Heliobacillus mobilis, and a stoichiometry of 5-6 hemes c and 1-3 hemes b per RC was found. Virtually the full complement of heme was seen to be functionally connected to the pool of electron donors to the photosynthetic RC. The kinetic parameters of electron transfer between reduced c-type hemes and the photooxidized primary donor P798+ were studied in whole cells and membrane fragments. The in vivo half-times of electron donation (50% with t 1/2 = 110 microseconds, 50% with t 1/2 = 600 microseconds) were seen to slow down to half-times in the range of several and several tens of milliseconds following disruption of cells. A severe conformational alteration or a change in the identity of the donating heme is discussed. Redox titrations of the flash-induced absorption changes performed on whole cells in the presence of mediators yielded the following redox midpoint potentials: P798, Em = +240 mV; heme c553, Em = +190, +170, and +90 mV for the heme components oxidized after the first, second, and third flash, respectively. The results demonstrate that the pool of c553 hemes donating electrons to the RC is heterogeneous and that it consists of either several distinguishable cytochromes or multiheme cytochromes or both. The number of hemes reduced and the kinetics of heme rereduction after flash-induced oxidation were found to depend strongly on the degree of anaerobicity in the interior compartment of the cell. A model rationalizing the obtained results in terms of a set of differing redox components is proposed.

Bacteria↗

PubMed1993

Single core polypeptide in the reaction center of the photosynthetic bacterium Heliobacillus mobilis: structural implications and relations to other photosystems.

The gene for a reaction center core polypeptide from the anoxygenic photosynthetic bacterium Heliobacillus mobilis was cloned and sequenced. The deduced amino acid sequence consists of 609 residues with a molecular mass of 68 kDa. An adjacent open reading frame is not transcribed under our experimental conditions. No evidence for a second related reaction center core gene was found. The primary sequence of the reaction center protein (P800 protein) shows a high percentage of sequence identity to photosystem I in a cysteine-containing loop, which is the putative binding site of the iron-sulfur center FX and in the preceding hydrophobic region. Our data imply a homodimeric organization of the reaction center. This is fundamentally different from photosystem I and most other photosynthetic reaction centers, where the reaction center core is composed of two similar but nonidentical subunits.

Amino Acid Sequence↗

PubMed1992

The Rieske FeS center from the gram-positive bacterium PS3 and its interaction with the menaquinone pool studied by EPR.

The Rieske 2Fe2S center from Bacillus PS3, a Gram-positive thermophilic eubacterium, has been studied by EPR spectroscopy. Its redox midpoint potential at pH 7.0 was determined to be +165 +/- 10 mV and was found to decrease with an apparent slope of -80 mV/pH unit above pH 7.9. The Qo-site inhibitor stigmatellin induced spectral changes analogous to those reported for Rieske centers from mitochondria and chloroplasts. The redox midpoint potential of the PS3 Rieske cluster was not affected by stigmatellin. The orientation of the g tensor was similar to other Rieske centers (gz and gy are oriented parallel, gx is oriented perpendicular to the membrane plane). The shape of the EPR spectrum of the Rieske cluster from PS3 changed as a function of the redox state of the menaquinone (MK) pool. This permitted the redox midpoint potential of the MK pool to be determined in the membrane. Values of -60 +/- 20 mV at pH 7.0 and of -130 +/- 20 mV at pH 8.0 were obtained. The results are compared with already published data from other Rieske centers. It is proposed that all Rieske centers that function in electron transport chains using MK as pool quinone show common features that distinguish them from Rieske centers operating in ubiquinone- or plastoquinone-based electron transfer chains.

Anti-Bacterial Agents↗

PubMed1990

Reaction center photochemistry of Heliobacterium chlorum.

Reaction center photochemistry in Heliobacterium chlorum has been investigated by using EPR and flash absorption spectroscopy at low temperatures. The following results were obtained. At 5 K, in the presence of ascorbate, continuous illumination resulted in the formation of P798+ and a reduced iron-sulfur center designated FB (gz = 2.07, gy = 1.93, gx = 1.89). This state was stable at low temperatures, but the yield for this reaction was low, and it was estimated that it occurred only in about 3% of the centers upon the first flash. After continuous illumination of a dilute sample for 10 min, still only half of the centers attained this state. In most centers, flash excitation at 5 K produced a state which recombined with time constants of 2.5 ms (congruent to 80%) and 850 microseconds (congruent to 20%). These two phases were differently influenced by the redox state of the reaction center, indicating that two different acceptors were involved in the recombination reactions. When continuous illumination was given at 200 K, a second center, designated FA, was additionally reduced (gz = 2.05, gy = 1.95, gx = 1.90). High concentrations of dithionite resulted in the chemical reduction of FB and of most of FA; illumination at 200 K resulted in the further reduction of FA. Two triplet states were identified by EPR and optical spectroscopy. The amplitude of the narrower triplet (magnitude of D = 226 x 10(-4) cm-1) varied with the redox state of the iron-sulfur centers and was influenced by a component thought to be a quinone undergoing double reduction. It correlated with a triplet state observed by flash absorption spectroscopy showing a bleaching at 798 nm and is attributed to a triplet state formed by charge recombination in the reaction center. Its narrowness is taken as an indication of its origin on a pair of bacteriochlorophylls, and its orientation indicates an orientation of the chlorophyll ring plane perpendicular to the membrane plane. The second triplet had a wider splitting (magnitude of D = 242 x 10(-4) cm-1), did not vary systematically with redox conditions, corresponds to an optical spectrum with a maximum at 812 nm, and is not ordered in the membrane. It was thus attributed to a triplet located on a BChl g monomer in the antenna. The reaction center photochemistry in H. chlorum is comparable in many respects to that of photosystem I and green sulfur bacteria. Earlier contrasting conclusions are discussed and rationalized in light of the present results.

Bacteria↗

PubMed1981

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only.

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms, respectively, in tomato exhibited defined differences in the RNase T1 and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the 'severe' strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.

Base Sequence↗