PubMed Health⌕ Search

Biomedical subjects

V F Zarytova

Publications and source records attributed to V F Zarytova.

At least 19 recordsLinked to original sources
PubMed2001

Nuclease resistance and RNase H sensitivity of oligonucleotides bridged by oligomethylenediol and oligoethylene glycol linkers.

The properties of new chimeric oligodeoxynucleotides made of short sequences (tetramers, pentamers, octamers, and decamers) bridged by hexamethylenediol and hexaethylene glycol linkers have been investigated. These chimeric oligonucleotides showed an improved resistance toward snake venom 3'-phosphodiesterase, with an increased stability when a terminal 3'-3'-internucleotide phosphodiester bond is present. It also has been demonstrated that the hybrid complexes formed by bridged oligonucleotides and a complementary 20-mer RNA are able to elicit the activity of ribonuclease H (RNase H) from Escherichia coli. The substrate properties of chimeric oligonucleotides depend on the length of the oligonucleotide fragments bridged by linkers. Introduction of a nonnucleotide spacer into the native oligonucleotide only slightly hampers the extent of the RNA hydrolysis in the hybrid complexes, whereas a modification of the site of reaction is observed as a possible consequence of the steric disturbance due to the aliphatic linkers. Hence, these new chimeric oligonucleotides, namely, short oligonucleotide fragments bridged by nonnucleotide linkers, demonstrate a favorable combination of exonuclease resistance and high substrate activity toward RNase H. As a consequence, these chimeric oligonucleotides could be proposed as new, promising analogs to be used in the antisense strategy.

Ethylene Glycols↗
PubMed2000

PAcM-AN: poly (N-acryloylmorpholine)-conjugated antisense oligonucleotides.

A new amphiphilic, high-molecular weight poly (N-acryloylmorpholine) (PAcM) polymer has been used to be linked to oligonucleotide chains through a liquid-phase stepwise synthesis. This new conjugate has been investigated for its melting property, nuclease stability and capacity to elicit RNase H activity. Its antisense activity against an HIV-1 target has been also evaluated.

Gene Expression Regulation↗
PubMed2000

[Reactive derivatives of oligonucleotide phosphorothioate analogues. IV.Site-directed modification of nucleic acids in intramolecular alkylation of phosphorothioate groups].

Alkylation of the 22-mer DNA target pTGCCTGGAGCTGCTTGATGCCC (I) by oligodeoxynucleotide phosphorothioate derivatives (PTAO) GpsCpsApsTpsCpsApsApsGpsCpsApsGpsCpN(CH3)CH2(RCl) (II-PS) and (RCl)CH2N(CH3)pGpsCpsApsTpsCpsApsApsGpsCpsApsGpsC (III-PS) bearing a residue of an aromatic analogue of nitrogen lost (RCl = C6H4N(CH3)(CH2CH2Cl) at the 3'- or 5'-end was studied. It was shown that the internucleotide phosphorothioate bonds do not affect the regiospecificity of the target modification. The maximum degree of the target modification (at t-->infinity) at 20 degrees C was about 25% for both (II-PS) and (III-PS). The use of GCATCAAGCAGCpN(CH3)CH2(RCl) (II-PO), containing internucleotide phosphodiester bonds, under the same conditions gave about 65% of the modified DNA. Kinetics of the PTAO-induced complementarily addressed nucleic acid (NA) modification was analyzed. The rate constants of the reaction of the intermediate reactive ethylenimmonium ion with phosphorothioate groups of the reagents were evaluated both in solution and in duplex. The intramolecular alkylation of phosphorothioate groups considerably affected the DNA target modification by decreasing the effectiveness of the modification in a wide range of temperatures and changing the temperature dependence of the modification from a bell-like to an S-like profile. It was concluded that, in the course of the modification, the PTAO phosphorothioate groups are intramolecularly alkylated both in solution and in the complementary NA target-oligonucleotide duplex.

Alkylating Agents↗
PubMed2000

[Cleavage of RNA in hybrid duplexes by ribonuclease H from E. coli. I. Substrate properties of complexes formed by RNA and tandem of short oligodeoxyribonucleotides].

We studied the E. coli RNase H cleavage of a 5'-labeled RNA fragment within two hybrid duplexes with identical sequences, one of which is formed by RNA and a 20-mer oligodeoxyribonucleotide (RNA/p20), whereas the second, by RNA and a tandem of short oligodeoxyribonucleotides (octanucleotide: (RNA/tandem). It was shown that RNA in the RNA/p20 complex is hydrolyzed from the 3'-end to yield consecutively the 17-, 14-, 11-, 8-, and 5-mer 5'-labeled fragments. On hydrolysis of RNA in complex RNA/tandem, the same products were registered, but their accumulation rates in this case differed. Thus, the initial rates of accumulation of the 17- and 8-mer were close. Moreover, the accumulation of the final 5-mer differed considerably: in the RNA/tandem complex it appeared within first minutes of the reaction, but only after a considerable lag period in complex RNA/p20. These data testify that the tandem is involved not only in the consecutive accumulation of the shortened products (which is characteristic of complexes including extended oligonucleotides) but also in the parallel accumulation. This results from hydrolysis of each duplex segment formed by RNA and the short oligonucleotide of the tandem. Although the order of recognition and cleavage of RNA target by ribonuclease H depends on the type of the hybrid duplex, the destruction of RNA target within complex RNA/tandem and in complex with the full-size oligonucleotide occurs with a close effectiveness.

Electrophoresis, Polyacrylamide Gel↗
PubMed2000

[Cleavage of RNA in hybrid duplexes by E. coli ribonuclease H. II. Substrate properties of nucleotides containing non-nucleotide linkers].

The 20-mer bridged oligodeoxynucleotides containing short oligomers joined by the hexamethylenediol and hexaethylene glycol linkers were shown to form complementary DNA/DNA and RNA/DNA complexes whose thermostability depends on the length and number of the nonnucleotide linkers. Hybrid complexes of the bridged oligonucleotides proved to be substrates for the E. coli ribonuclease H. The presence of one-three nonnucleotide linkers in a 20-mer decreased the hydrolysis efficacy only 1.2-1.4-fold. It is the composition of the RNA cleavage products that was influenced the most significantly by the nonnucleotide linkers. RNase H simultaneously hydrolyzed the RNA 3'-ends of each hybrid duplex involving a bridged oligonucleotide. The presence of an inverted 3'-3'-phosphodiester bond at the 3'-end of the oligodeoxyribonucleotide only slightly affected the RNase H activity.

DNA↗
PubMed1999

[Synthesis of oligodeoxyribonucleotide derivatives, containing perfluoroarylazide group at C8-atom of deoxyadenosine and their use in photomodification of DNA fragments].

Heptadeoxynucleotides were obtained that contained an aliphatic amino group in position 8 of the deoxyadenosine residue: ALNH2 CTTTCT, CTCALNH2 CTT, and ACACTCALNH2 where L = NH(CH2)n, n = 3, 5, or 7. A 4-azidotetrafluorobenzoyl residue was attached to the amino group in the oligonucleotides, and photomodification of a DNA target by the resulting reagents was carried out. It was shown that the length of the spacer influences the photomodification extent of the target; a spacer with n = 5 is optimum. The maximum modification extent (65%) was reached when a reagent containing a photoreactive group at the 5'-terminal deoxyadenosine residue was used.

DNA↗
PubMed1998

[Interactions of derivatives of short oligonucleotides with nucleic acids. VII. Effect of conformation changes in the duplex structure on on the specificity and efficacy of modification of target DNA by alkylating oligonucleotide derivatives].

The modification of a target DNA by alkylating oligonucleotide derivatives possessing various capacities for complex formation was studied. The binding properties of oligonucleotides were changed either by increasing their length (tetra-, octa-, and dodecamers) or by introducing a point substitution and/or an N-(2-hydroxyethylphenazinium) residue. It was found that conformational changes occurring in the structure of the target.reagent complex upon elevating the reaction temperature affect the efficiency and site-specificity of the alkylation. In the case of complete saturation of the target with the reagent, an increase in the hybridization ability of the reagent reduced the efficiency of the target modification. It was found that the modification by the tetranucleotide reagent (in the presence of an effector adjacent to the 3' end) occurs exclusively at an intracomplex target base. In the case of the dodecamer, which forms a stable, highly cooperative complex with the target, several bases of the target undergo alkylation, and an increase in temperature changes the site-specificity of alkylation. In this process, the redistribution of the target modification sites toward stronger nucleophilic centers enhances alkylation at temperatures near the melting temperature of the target.dodecanucleotide complex despite a decrease in the extent of target association.

Alkylation↗
PubMed1998

[Interaction of short oligonucleotide derivatives with nucleic acids. V. Ligation of short oligonucleotides in tandem on a complimentary DNA template].

A tetranucleotide was highly specifically and quantitatively ligated with a pair of flanking octanucleotides carrying both radioactive and nonradioactive reporter groups. The sequence of the ligation of oligonucleotide components in a tandem on a complementary template was studied. The first stage was found to be the enzyme-catalyzed activation of the phosphate group of octanucleotide, a tandem component that possesses a higher hybridization capacity than the tetramer. It is shown that the introduction of terminal reporter groups into octanucleotides does not decrease the efficiency of their tandem ligation.

Autoradiography↗
PubMed1998

[Interaction of short oligonucleotides derivatives with nucleic acids. VI. Discrimination of mismatch-containing complexes upon ligation of a short oligonucleotide tandem on DNA template].

The high ligation specificity of a tetranucleotide with a pair of flanking octanucleotides on DNA template by the action of T4 phage DNA ligase is shown. In a tetranucleotide-DNA template complex containing a mismatch, almost no ligation products are formed. The ligation of a tandem octanucleotide-tetranucleotide-octanucleotide makes it possible to identify accurately any single nucleotide substitution in a tetranucleotide binding site.

Autoradiography↗
PubMed1998

[Interaction of derivatives of short oligonucleotides with nucleic acids. VIII. Characteristics of target DNA modification by alkylating oligonucleotide derivatives in tandem complexes].

The influence of effectors [octanucleotides and their 3',5'-di-N-(2-hydroxyethyl)phenazinium derivatives] on the modification of a target DNA by alkylating oligonucleotide derivatives forming duplexes of different stability with the target ws studied. It is shown that, being in tandem complexes immediately adjacent to the reactive group of an oligonucleotide reagent possessing a high hybridization capacity, the effector, on the one hand, enhances the stability of the reagent target duplex, and on the other hand, changes the site-specificity of alkylation and decreases the efficiency of the target modification at temperatures that provide a high extent of the target association with the reagent. Conversely, in the case of oligonucleotide reagents forming weak complexes with the target, effectors enhance both the stability of the target.reagent duplex and the extent of the target throughout the temperature range tested. The data indicate that the varying influence of effectors on the target modification by reagents with different hybridization capacities is due to conformational features of the target reagent duplexed regions. Increasing the rigidity of the target.reagent duplex reduces the efficiency of the target modification in tandem complexes.

Alkylating Agents↗
PubMed1997

The NMR structure of estrone (Es)-tethered tandem DNA duplex: [d(5'pCAGCp3')-Es] + [Es-d(5'pTCCA3')]: d(5'pTGGAGCTG3').

The solution structure of an estrone (Es)-tethered tandem DNA duplex consisting of two Es-tethered tetranucleotides and a target octameric DNA sequence is reported. The structure of this Es-tethered tandem duplex has been compared with a corresponding natural tandem duplex without estrones. The Tm of the 3'-Es-tethered tetranucleotide part of the tandem duplex increases by 5 degrees C, whereas the Tm of the 5'-Es-tethered tetranucleotide part increases by 7 degrees C, compared with the corresponding natural counterpart. The NMR structures of both the Es-tethered tandem duplex and the natural counterpart have been based on 24 experimental NMR constraints per residue. Despite the fact that there is considerable distortion at the junction of two Es-tethered tetranucleotides in the major groove of the Es-tethered DNA duplex compared to the natural counterpart, both duplexes do take up B-type DNA structures. It is likely that the spatial proximity of two Es residues, and the resulting hydrophobic interaction between them might be responsible for the increase of the thermal stability of the Es-tethered tandem duplex in comparison with the natural counterpart.

DNA↗
PubMed1997

[Artificial ribonucleases I. Targeted RNA cleavage by 5'-peptidyloligodeoxyribonucleotides containing arginine and leucine residues].

The interaction of DNA and RNA with oligodeoxyribonucleotides and their 3'-terminal N-(2-hydroxyethyl)phenazinium derivatives carrying peptide residues with alternating basic and hydrophobic amino acids at the 5'-terminal phosphate was studied. It was found that the introduction of peptide residues (LeuArg)n-Gly-NH2 (n = 2-4) into an oligodeoxyribonucleotide enhances the latter's hybridization ability: each additional LeuArg pair increases the Tm value of the (5')pd(CACACACAAAAAAC).(3')d(TGTGTGTG)p(-LeuArg)n-Gly- NH2 complex by 1.3 degrees C. The reagents did not destort the DNA structure and were capable of site-specific hydrolysis of the phosphodiester bonds of RNA. It was shown that the location of the cleavage sites and the efficacy of the RNA hydrolysis at n = 2 and 4 and at n = 3 strongly differ. The maximum hydrolysis (80%) of tetradecaribonucleotide (5')p(GAUUGAAAAUCCCC) was achieved using peptidyloligodeoxyribonucleotide (3')d(CTAACT)p(LeuArg)4GlyNH2. The possibility of directed cleavage of phosphodiester bonds in tRNAPhe by peptidyloligodeoxyribonucleotides (3')d(CTAACT)p(LeuArg)nGlyNH2 (n = 3 and 4) was shown.

Arginine↗
PubMed1997

[Nucleic acids interactions with short oligonucleotide derivatives. II. Tandem of short oligonucleotides as highly sensitive system for identification of single base substitutions in target DNA].

A new approach for modification of target DNAs with tandems of derivatives of short oligonucleotides was suggested that allows highly selective modification of perfect duplexes only. At physiological temperatures, the efficiency of DNA modification by a dodecanucleotide alkylating agent was demonstrated to be the same for both perfect and mismatch-containing duplexes, whereas the tetranucleotide reagent in the presence of two flanking effectors alkylated with high selectivity the target DNA in the perfect duplex only.

Alkylating Agents↗
PubMed1997

[Reactive derivatives of phosphorothioate oligonucleotide analogues. II. Properties of phosphorothioate oligodeoxyribonucleotide derivatives containing an aromatic residue of nitrogen mustard gas].

The alkylating properties of the derivatives of phosphorothioate oligonucleotide analogues containing the alkylating 3'-[N-methyl-4-(N'-methyl-N'-2-chloroethylamino)benzyl]phosphamide group were studied using the alkylating 3'-phosphamide derivative of trithymidine phosphorothioate TpsTpsTpN(CH3)CH2RCl. It was shown by ion-exchange chromatography and 31P NMR spectroscopy that reagents of this type are able to alkylate, depending on the conditions, both their own internucleotide phosphorothioate residues and nucleophiles in the medium. In the absence of external nucleophiles in aqueous media, TpsTpsTpN(CH3)CH2RCl forms predominantly the products of intramolecular alkylation of ps-groups rather than the products of hydrolysis of the RCl-group. In the presence of a nucleophile (1 M aqueous ethylenediamine), the reagent alkylates mainly the aliphatic amino groups of the nucleophile. If the ethylenediamine concentration is reduced to 0.1 M, both processes take place, whereby the rate of reaction with EDA is twice as high as that of intramolecular alkylation. The rate constant of the limiting stage of alkylation (ionization of the C-Cl bond), k0, does not depend on the presence of the competitive nucleophile (ethylenediamine) and is 3.95 x 10(-4) s-1 at 37 degrees C.

Alkylating Agents↗
PubMed1997

[Interaction of short nucleotide derivatives with nucleic acids. III. photomodification of DNA targets using tandems of short nucleotide derivatives].

High efficiency was demonstrated for the photomodification of a DNA target by a 5'-p-azidotet-rafluorobenzoyl reagent based on a tetranucleotide and its 3'-phosphoestrone ester in the presence of a pair of flanking effectors. These effectors are oligonucleotide derivatives with N-(2-hydroxyethyl)phenazinium groups or those connected to cholesterol residues at the terminal phosphates.

Amino Acids↗
PubMed1997

[Interaction of short nucleotide derivatives with nucleic acids. IV. Modification of DNA by an alkylating tetranucleotide reagents in the presence of effectors in perfect and imperfect complexes].

It was demonstrated that any mismatches in a complex formed by an ssDNA target and a tetranucleotide at 25 or 37 degrees C can be discriminated by alkylating the DNA with a tetranucleotide carrying a 4-[N-methyl-N-(2-chloroethyl)]aminobenzylethylamine residue at the 5'-terminal phosphate in the presence of a pair of flanking effectors, octanucleotide di-N-(2-hydroxyethyl)-phenazinium derivatives. The discrimination factor (ratio of the extent of the target modification in the perfect and mismatch-containing complexes) for a single mismatch in the tetranucleotide binding site at 25 degrees C varied between 4 and 500 depending on the type of mismatch and its location in the complex and exceeded 400 at 37 degrees C for all the investigated mismatches. The DNA target modification by the alkylating derivative of the 3'-estrone ester of tetranucleotide pCAGX (mean = C, T, A or G) was selective in the presence of a pair of hydrophobic effectors, octanucleotide 5'-cholesteryl-3'-phenazinium derivatives. The discrimination factors for 3'-terminal mismatches T.G, A.G, and G.G were 1,8,400, and 400, respectively.

Alkylating Agents↗
PubMed1996

[Structure of an oligonucleotide of bleomycin A5 from 13C-NMR data].

The localization of the covalent bond in the conjugates of bleomycin A5 and oligonucleotides was established by 13C NMR using the bleomycin derivative of uridine-5'-phosphate synthesized as a model compound. The phosphate group of the nucleotide was shown to form a phosphamide bond with the primary amino group of the spermidine moiety of bleomycin A5. The formation of the P-N bond causes the downfield shift of the signals of the neighboring carbon atoms of the spermidine fragment by 1.8 and 4.2 ppm and the splitting of the signal of the C-2 atom of the spermidine fragment with J 6.8 Hz due to vicinal spin-spin coupling with the phosphorous atom.

Bleomycin↗