Biomedical subjects

V Gallo

Publications and source records attributed to V Gallo.

At least 37 records · Page 2Linked to original sources

PubMed1999

Neurotransmitter receptor activation triggers p27(Kip1 )and p21(CIP1) accumulation and G1 cell cycle arrest in oligodendrocyte progenitors.

We examined the pathways that link neurotransmitter receptor activation and cell cycle arrest in oligodendrocyte progenitors. We had previously demonstrated that glutamate receptor activation inhibits oligodendrocyte progenitor proliferation and lineage progression. Here, using purified oligodendrocyte progenitors and cerebellar slice cultures, we show that norepinephrine and the beta-adrenergic receptor agonist isoproterenol also inhibited the proliferation, but in contrast to glutamate, isoproterenol stimulated progenitor lineage progression, as determined by O4 and O1 antibody staining. This antiproliferative effect was specifically attributable to a beta-adrenoceptor-mediated increase in cyclic adenosine monophosphate, since analogs of this cyclic nucleotide mimicked the effects of isoproterenol on oligodendrocyte progenitor proliferation, while alpha-adrenoceptor agonists were ineffective. Despite the opposite effects on lineage progression, both isoproterenol and the glutamate receptor agonist kainate caused accumulation of the cyclin-dependent kinase inhibitors p27(Kip1)and p21(CIP1), and G1 arrest. Studies with oligodendrocyte progenitor cells from INK4a-/- mice indicated that the G1 cyclin kinase inhibitor p16(INK4a) as well as p19(ARF)were not required for agonist-stimulated proliferation arrest. Our results demonstrate that beta-adrenergic and glutamatergic receptor activation inhibit oligodendrocyte progenitor proliferation through a mechanism that may involve p27(Kip1) and p21(CIP1); but while neurotransmitter-induced accumulation of p27(Kip1) is associated with cell cycle arrest, it does not by itself promote oligodendrocyte progenitor differentiation.

Animals↗

PubMed1998

Modeling mutations in the G1 arrest pathway in human gliomas: overexpression of CDK4 but not loss of INK4a-ARF induces hyperploidy in cultured mouse astrocytes.

Nearly all human gliomas exhibit alterations in one of three genetic loci governing G1 arrest: INK4a-ARF, CDK4, or RB. To discern the roles of CDK4 amplification and INK4a-ARF loss in gliomagenesis, we compared the behavior of astrocytes lacking a functional INK4a-ARF locus with astrocytes overexpressing CDK4. Either a deficiency of p16(INK4a) and p19(ARF) or an increase in Cdk4 allows cultured astrocytes to grow without senescence. Astrocytes overexpressing CDK4 grow more slowly than INK4a-ARF-deficient astrocytes and convert to a tetraploid state at high efficiency; in contrast, INK4a-ARF-deficient cells remain pseudodiploid, consistent with properties observed in human gliomas with corresponding lesions in these genes.

Animals↗

PubMed1998

Expression and regulation of kainate and AMPA receptors in the rat neural tube.

We analyzed the expression and regulation of glutamate receptor subunits in the rat neural tube (10 day embryos) and in cell cultures derived from this tissue. In the cultures, all cells were stained with antibodies against the neural progenitor marker nestin. More than 50% of the cells were also stained by the monoclonal antibodies LB1 or A2B5, which bind to neuronal and glial progenitors. Approximately 6% of the cells were stained with antibodies for the low affinity NGF receptor, a neural crest cell marker. A small percentage of cells differentiated to neurons or astrocytes, as determined by staining with anti-neurofilament and anti-GFAP antibodies, respectively. RT-PCR analysis of neural tube tissue and culture mRNAs demonstrated that the AMPA receptor subunits GluR3 and 4 and the kainate receptor subunits GluR6, 7, KA1 and KA2 were detectable at E10. The kainate receptor subunits GluR6 and KA2 were upregulated by culture conditions which stimulated cell differentiation, as determined by concomitant downregulation of nestin mRNA. Both in neural tube tissue and in cultured cells, GluR6 was 100% unedited. Finally, both GluR6 and KA2 proteins could be detected in subpopulations of neural progenitors and differentiated neurons. Our data indicate that kainate receptor genes are expressed in undifferentiated progenitor cells of the neural tube at E10, and are upregulated during neural cell differentiation.

Animals↗

PubMed1998

Regulation of ion channel expression in neural cells by hormones and growth factors.

Voltage-and ligand-gated ion channels are key players in synaptic transmission and neuron-glia communication in the nervous system. Expression of these proteins can be regulated at several levels (transcriptional, translational, or posttranslational) and by multiple extracellular factors in the developing and mature nervous system. A wide variety of hormones and growth factors have been identified as important in neural cell differentiation, which is a complex process involving the acquisition of cell-type-specific ion channel phenotypes. Much literature has already accumulated describing the structural and functional characteristics of ion channels, but relatively little is known about the factors that influence their synthesis and cell surface expression, although this area has generated considerable interest in the context of neural cell development. This article reviews several examples of regulated expression of these channels by cellular factors, namely peptide growth factors and steroid hormones, and discusses, where applicable, current understanding of molecular mechanisms underlying such regulation of voltage-and neurotransmitter-gated ion channels.

Animals↗

PubMed1998

Noninvasive assessment of spontaneous baroreflex sensitivity in patients with liver cirrhosis.

AIMS/BACKGROUND: An impairment of baroreceptor sensitivity has been found in liver cirrhosis. Noninvasive and spontaneous estimates of baroreflex sensitivity are obtained from beat-to-beat blood pressure and heart rate recordings by means of cross-spectrum analysis and calculation of alpha-index (as a measure of baroreflex gain). The aim of the present study was to investigate the function of the spontaneous baroreflex sensitivity related to clinical Child score in liver cirrhosis. METHODS: The alpha-index was evaluated in 40 cirrhotic patients (18 with and 22 without ascites) and 17 healthy subjects by analysing finger arterial pressure recorded noninvasively with the Portapres device. RESULTS: Baroreflex sensitivity was significantly lower in cirrhotic patients with and without ascites compared with healthy subjects (p<0.01). Furthermore, in patients with ascites the baroreflex gain was significantly related to plasma sodium (p<0.01). A significant inverse relationship was present between baroreflex gain and grade of Child score and the severity of ascites (p<0.01). There were no significant relationships between hormonal parameters (catecholamines, renin, aldosterone, arginine-vasopressin, atrial natriuretic peptide and nitric oxide) and baroreflex gain. No significant differences were found between healthy subjects and cirrhotic patients with respect to systolic and diastolic blood pressure total variability in a supine position, whilst it was lower in cirrhotic patients with ascites in a tilted position (p<0.05). CONCLUSION: Our findings showed that baroreflex sensitivity was significantly impaired in cirrhotic patients when compared with healthy subjects. In addition, there was a significant trend toward lower baroreflex sensitivity values with the grade score of Child class (p<0.01). Spectral analysis of the alpha-index provides viable alternatives to the pharmacological approach for estimation of baroreflex sensitivity and may represent a prognostic tool to identify cirrhotic patients at increased risk of adverse events.

Aldosterone↗

PubMed1998

A role for glutamate and its receptors in the regulation of oligodendrocyte development in cerebellar tissue slices.

We tested the hypothesis that the neurotransmitter glutamate would influence glial proliferation and differentiation in a cytoarchitecturally intact system. Postnatal day 6 cerebellar slices were maintained in organotypic culture and treated with glutamate receptor agonists or antagonists. After dissociation, cells were stained with antibodies for different oligodendrocyte developmentally regulated antigens. Treatment of the slices with the glutamate receptor agonists kainate or alpha -amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid significantly decreased the percentage of LB1(+), NG2(+) and O4(+) cells, and their bromodeoxyuridine labeling index. The non-N-methyl-D-aspartate glutamate receptor antagonist 6,7-dinitroquinoxaline-2,3-dione increased the percentage and bromodeoxyuridine labeling of LB1(+), NG2(+) and O4(+) cells. In intact slices, RNA levels of the oligodendrocyte gene for 2',3'-cyclic nucleotide 3'-phosphodiesterase were decreased by kainate and alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid, and increased by 6,7-dinitroquinoxaline-2,3-dione. The percentage of astrocytes was not modified by kainate, alpha -amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid or 6, 7-dinitroquinoxaline-2,3-dione. Treatment with the N-methyl-D-aspartate receptor antagonist 2-amino-5-phosphonopentanoic acid did not alter the percentage of O4(+) cells, nor their proliferation. Incubation with the gamma-aminobutyric acid receptor antagonist bicuculline did not modify the percentage of LB1(+), A2B5(+) and O4(+) cells. In purified cerebellar oligodendrocyte progenitor cells, glutamate receptor agonists blocked K+ currents, and inhibited cell proliferation and lineage progression. The K+ channel blocker tetraethylammonium also inhibited oligodendrocyte progenitor cell proliferation. These findings indicate that in rat cerebellar tissue slices: (i) glutamate specifically modulates oligodendrocyte but not astrocyte development through selective activation of alpha -amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors, and (ii) cell depolarization and blockage of voltage-dependent K+ channels is likely to be the triggering mechanism.

2',3'-Cyclic-Nucleotide Phosphodiesterases↗

PubMed1997

K+ channel expression and cell proliferation are regulated by intracellular sodium and membrane depolarization in oligodendrocyte progenitor cells.

The effects of a variety of antiproliferative agents on voltage-dependent K+ channel function in cortical oligodendrocyte progenitor (O-2A) cells were studied. Previously, we had shown that glutamate receptor activation reversibly inhibited O-2A cell proliferation stimulated by mitogenic factors and prevented lineage progression by attenuating outward K+ currents in O-2A cells. We now show that the antiproliferative actions of glutamate receptor activation are Ca2+-independent and arise from an increase in intracellular Na+ and subsequent block of outward K+ currents. In support of this mechanism, agents that acted to depolarize O-2A cells or increase intracellular sodium similarly had an antiproliferative effect, attributable at least in part to a reduction in voltage-gated K+ currents. Also, these effects were reversible and Ca2+-independent. Chronic treatment with glutamate agonists was without any long-term effect on K+ current function. Cells cultured in elevated K+, however, demonstrated an upregulation of inward rectifier K+ currents, concomitant with an hyperpolarization of the resting membrane potential. This culture condition therefore promoted a current phenotype typical of pro-oligodendroblasts. Finally, cells chronically treated with the mitotic inhibitor retinoic acid displayed a selective downregulation of outward K+ currents. In conclusion, signals that affect O-2A cell proliferation do so by regulating K+ channel function. These data indicate that the regulation of K+ currents in cells of the oligodendrocyte lineage plays an important role in determining their proliferative potential and demonstrate that O-2A cell K+ current phenotype can be modified by long-term depolarization of the cell membrane.

Animals↗

PubMed1997

Gene structure of the rat kainate receptor subunit KA2 and characterization of an intronic negative regulatory region.

We have isolated and analyzed the structure of the gene grik5 (glutamate receptor ionotropic kainate 5), encoding the rat kainate receptor subunit KA2. Six overlapping DNA fragments containing the entire grik5 gene were identified in a rat genomic library. grik5 is a unique gene composed of 20 exons that together span over 54 kilobases (kb). Reporter gene analysis demonstrated that 2 kb of grik5 5'-flanking sequence confers tissue-specific expression on a chloramphenicol acetyltransferase gene in vitro. We show that (i) the first intron of grik5 (3.4 kb) inhibited transcription of the chloramphenicol acetyltransferase gene driven by the 2-kb grik5 5'-flanking region; (ii) the negative regulatory element was located within 500 bp of the 3'-end of intron 1, and this 500-bp fragment selectively bound nuclear proteins isolated from neural and nonneural cells; (iii) the effect of the negative regulatory element on grik5 transcription was orientation- and distance-independent; and (iv) a 24-nucleotide sequence (CTTTCTGTGGCCTCTGACCTTTCC) was identified as the binding site for nuclear proteins within the 500-bp fragment, as determined by footprinting and gel shift assays. We conclude that an intronic element that displays features of a silencer modulates grik5 transcription.

Animals↗

PubMed1997

Neurotransmitter- and growth factor-induced cAMP response element binding protein phosphorylation in glial cell progenitors: role of calcium ions, protein kinase C, and mitogen-activated protein kinase/ribosomal S6 kinase pathway.

To understand how extracellular signals may produce long-term effects in neural cells, we have analyzed the mechanism by which neurotransmitters and growth factors induce phosphorylation of the transcription factor cAMP response element binding protein (CREB) in cortical oligodendrocyte progenitor (OP) cells. Activation of glutamate receptor channels by kainate, as well as stimulation of G-protein-coupled cholinergic receptors by carbachol and tyrosine kinase receptors by basic fibroblast growth factor (bFGF), rapidly leads to mitogen-activated protein kinase (MAPK) phosphorylation and ribosomal S6 kinase (RSK) activation. Kainate and carbachol activation of the MAPK pathway requires extracellular calcium influx and is accompanied by protein kinase C (PKC) induction, with no significant increase in GTP binding to Ras. Conversely, growth factor-stimulated MAPK phosphorylation is independent of extracellular calcium and is accompanied by Ras activation. Both basal and stimulated MAPK activity in OP cells are influenced by cytoplasmic calcium levels, as shown by their sensitivity to the calcium chelator bis(2-aminophenoxy)ethane-N,N,N',N'-tetra-acetic acid. The kinetics of CREB phosphorylation in response to the various agonists corresponds to that of MAPK activation. Moreover, CREB phosphorylation and MAPK activation are similarly affected by calcium ions. The MEK inhibitor PD 098059, which selectively prevents activation of the MAPK pathway, strongly reduces induction of CREB phosphorylation by kainate, carbachol, bFGF, and the phorbol ester TPA. We propose that in OPs the MAPK/RSK pathway mediates CREB phosphorylation in response to calcium influx, PKC activation, and growth factor stimulation.

Animals↗

PubMed1997

Growth factor-induced transcription of GluR1 increases functional AMPA receptor density in glial progenitor cells.

We analyzed the effects of two growth factors that regulate oligodendrocyte progenitor (O-2A) development on the expression of glutamate receptor (GluR) subunits in cortical O-2A cells. In the absence of growth factors, GluR1 was the AMPA subunit mRNA expressed at the lowest relative level. Basic fibroblast growth factor (bFGF) caused an increase in GluR1 and GluR3 steady-state mRNA levels. Platelet-derived growth factor (PDGF) did not modify the mRNA levels for any of the AMPA subunits but selectively potentiated the effects of bFGF on GluR1 mRNA (4.5-fold increase). The kainate-preferring subunits GluR7, KA1, and KA2 mRNAs were increased by bFGF, but these effects were not modified by cotreatment with PDGF. Nuclear run-on assays demonstrated that PDGF+bFGF selectively increased the rate of GluR1 gene transcription (2.5-fold over control). Western blot analysis showed that GluR1 protein levels were increased selectively (sixfold over control) by PDGF+bFGF. Functional expression was assessed by rapid application of AMPA to cultured cells. AMPA receptor current densities (pA/pF) were increased nearly fivefold in cells treated with PDGF+bFGF, as compared with untreated cells. Further, AMPA receptor channels in cells treated with PDGF+bFGF were more sensitive to voltage-dependent block by intracellular polyamines, as expected from the robust and selective enhancement of GluR1 expression. Our combined molecular and electrophysiological findings indicate that AMPA receptor function can be regulated by growth factor-induced changes in the rate of gene transcription.

Animals↗

PubMed1997

Prolonged treatment (2 years) with different doses (3 versus 6 MU) of interferon alpha-2b for chronic hepatitis type C. Results of a multicenter randomized trial.

BACKGROUND/AIMS: To examine the effect of prolonged treatment with different doses of interferon alpha-2b on the relapse rate in patients with chronic hepatitis C. METHODS: One hundred and seventy-one patients with non-cirrhotic chronic hepatitis C were enrolled in an Italian multicenter trial. All patients were treated for 3 months with 3,000,000 Units (3 MU) of interferon alpha-2b given subcutaneously three times a week (t.i.w.). Patients with abnormal alanine aminotransferase (ALT) values were given 6 MU of interferon for an additional 3 months. If ALT remained persistently abnormal, therapy was then suspended. If ALT levels were normal, therapy was continued (6 MU t.i.w.) for an additional 18 months (total=2 years). Patients with normal ALT were randomly assigned to two groups, one receiving 3 MU and the other receiving 6 MU t.i.w. for an additional 21 months (total=2 years). Follow-up continued for 2 years after therapy withdrawal. RESULTS: Seven patients stopped treatment during the first 3 months. Of the remaining 164 patients, 76 (46%) showed abnormal ALT levels after 3 months of therapy: 11 of these (14%) normalized ALT values when given 6 MU and a sustained response was maintained in eight during the follow-up. Overall, 54 and 34 patients were allocated respectively to the groups receiving the 3 MU and 6 MU long-term treatment. At the end of therapy, 35/54 patients of the group 3 MU and 21/34 patients of the group 6 MU showed normal ALT levels (65% vs 62%, p=N.S.). After 2 years of follow-up, 24/35 (69%) patients of the group 3 MU and 16/21 (76%) of the group 6 MU were still in remission (p=N.S.). In an intention-to-treat analysis, 48/171 (28%) patients showed a long-term response (normal ALT values, HCV-RNA negative). About 65% of the sustained responders showed low baseline viremia compared with 33% of non-responders (p=0.005) while genotype 1b was more frequently found among non-responders than in long-term responders (84% vs 25%, p=0.0001). CONCLUSIONS: About 14% of patients who do not respond to a 3-month course of 3 MU of interferon normalize ALT levels when given 6 MU. In prolonged treatment, there is no significant difference between 3 and 6 MU in inducing a sustained response. Patients with low baseline viremia and genotype 2a respond significantly better to prolonged interferon therapy than highly viremic patients with genotype 1b.

Antiviral Agents↗

PubMed1996

Oligodendrocyte progenitor cell proliferation and lineage progression are regulated by glutamate receptor-mediated K+ channel block.

We have analyzed the role of glutamate and its receptors (GluRs) in regulating the development of oligodendrocytes. Activation of AMPA-preferring GluRs with selective agonists inhibited proliferation of purified cortical oligodendrocyte progenitor (O-2A) cells cultured with different mitogens, as measured by [3H]thymidine incorporation or bromodeoxyuridine staining. In contrast, activation of GABA or muscarinic receptors did not affect O-2A proliferation. Cell viability and apoptosis assays demonstrated that the inhibition of O-2A proliferation was not attributable to a cytotoxic action of GluR agonists, and was reversible. Activation of GluRs prevented lineage progression from the O-2A (GD3+/nestin+) stage to the prooligodendroblast (O4+) stage, but did not affect O-2A migration. Additional experiments examined the membrane ionic channels mediating these GluR activation effects. We found that proliferating O-2A cells expressed functional delayed rectifier K+ channels, which were absent in pro-oligodendroblasts. GluR agonists and the K+ channel blocker tetraethylammonium (TEA) strongly inhibited delayed rectifier K+ currents in O-2A cells. TEA reproduced the effects of GluR activation on O-2A proliferation and lineage progression in the same concentration range that blocked delayed rectifier K+ currents. These results indicate that glutamate regulates oligodendrogenesis specifically at the O-2A stage by modulating K+ channel activity.

Animals↗

PubMed1996

Spontaneous release of interleukin 1 beta from human blood monocytes in thyrotoxic osteodystrophy.

Hyperthyroidism is a well documented cause of impaired bone turnover characterized by increased osteoblastic and osteoclastic activity, resulting in predominance of bone resorption and in decreased bone mass. Thyroid hormones can carry out a direct effect on osteoblasts which express specific receptors on their surface membrane; differently effect on osteoclast seems to be mediated by local factors, cytokynes released by activated osteoblasts or by bone monocytes cells. Interleukin 1 beta is the first purified cytokyne shown to have bone resorbing activity. In ten thyrotoxic female patients IL 1 beta in the cellular medium of the monocytes blood cells culture has been measured, compared to PYD/cr urinary excretion, and FT3, BGP serum levels, before and after thyrostatic treatment. Ten normal females were studied as control group. The results before treatment showed osteopenia in 20% (DEXA densitometry), increased values of FT3, BGP, IL 1 beta and PYD/cr in patients versus controls (p < 0.001). The thyrostatic therapy obtained normalization of IL 1 beta, PYD/cr, BGP, and FT3 levels. Our data demonstrate that increased thyroid hormone levels in vivo are associated to increased secretion of monocytes cytokynes in vitro and suggest that alterations in local production of bone acting cytokyne may underlie to thyrotoxic osteodistrophy.

Adult↗

PubMed1996

News on glutamate receptors in glial cells.

Glutamate (Glu) receptors convey most of the excitatory synaptic transmission in the mammalian CNS. Distinct Glu-receptor genes and different subtypes of glutamate-activated channels are expressed ubiquitously throughout the developing and mature brain in the two major macroglial cell types, astrocytes and oligodendrocytes. These glial receptors are found in acutely isolated cells and in brain slices, and are therefore functional in vivo. Glutamate receptors in glial cells are activated during neuronal activity, and their activation modulates gene expression in astrocytes and oligodendrocytes. The proliferation and differentiation of glial precursor cells are also regulated by activation of Glu receptors, suggesting that the excitatory transmitter might be one of the environmental signals that regulate glial-cell development.

Animals↗

PubMed1995

Excitatory amino acid receptors in glia: different subtypes for distinct functions?

It is now well established that expression of voltage- and ligand-gated ionic channels, as well as G protein-coupled receptors, is not a property unique to neurons, but is also shared by macroglial cells (astrocytes and oligodendrocytes). These glial cells can receive a variety of signals from neurons at different stages of their development. Activation of membrane receptors may affect glial cell activity, proliferation, maturation, and survival through a complex cascade of intracellular events leading to long-term changes in glial cell phenotype and functional organization. Here we review the experimental evidence for glutamate receptor expression in glial cells in culture and in situ, and the molecular and functional properties of these receptors. We also describe some experimental models that identify possible functions of glutamate receptors in glia. Now that the existence of glutamate receptors in glia has been unambiguously demonstrated, future research will have to 1) determine which receptor subtypes are expressed in macroglial cells in vivo; 2) analyze, in adequate experimental models, the short- and long-term changes produced by glutamate receptor activation in glia; and 3) establish whether these receptors play a role in neuron-glia communication in the brain.

Animals↗

PubMed1995

AMPA receptors shape Ca2+ responses in cortical oligodendrocyte progenitors and CG-4 cells.

Intracellular calcium signals triggered by glutamate receptor activation were studied in primary cortical oligodendrocyte lineage cells and in the oligodendrocyte cell line CG-4. Glutamate, kainate, and AMPA (30-300 microM) increased [Ca2+]i in both types of cells at the stage of oligodendrocyte progenitors (O-2A; GD3+) or pro-oligodendroblasts (O4+). The peak amplitude of Ca2+ responses to glutamate receptor agonists was significantly larger in cortical cells. In CG-4 and in cortical cells, the majority (more than 90%) of bipolar GD3+ or multipolar O4+ cells responded to kainate. In all the cells analyzed, kainate was more efficacious than AMPA and glutamate. The percentage of bipolar or multipolar cells responding to glutamate was significantly lower in the CG-4 cell line than in primary cultures. Cellular responses typical of metabotropic glutamate receptor activation were observed in 20% of the cortical O-2A progenitors, but in none of the CG-4 cells. The AMPA-selective antagonist GYKI 52466 blocked kainate-induced Ca2+ responses in cortical O-2A cells. The selective AMPA receptor modulator cyclothiazide (30 microM) greatly potentiated the effects of AMPA (30-100 microM) on [Ca2+]i in cortical and CG-4 cells. Our findings indicate that Ca2+ responses in cells of the oligodendrocyte lineage are primarily shaped by functional AMPA receptors.

Animals↗

PubMed1995

Expression and regulation of kainate and AMPA receptors in uncommitted and committed neural progenitors.

Here we review experimental evidence of non-NMDA glutamate receptor expression in the embryonic central nervous system. AMPA- and kainate-preferring glutamate receptor subunit mRNA transcripts are detected in embryonic neurons, glia and neural progenitors. Functional assays demonstrate that in some cell subpopulations ionotropic glutamate receptors are expressed by progenitors before synapse formation and terminal differentiation, and may be present before lineage determination is specified. The activation of these receptors triggers induction of immediate early gene transcription in progenitor cells. The cloning and transcriptional analysis of upstream regulatory regions of glutamate receptor genes governing their temporal and tissue-specific expression are also discussed.

Animals↗

PubMed1995

Developmental and growth factor-induced regulation of nestin in oligodendrocyte lineage cells.

The expression and regulation of nestin, an intermediate filament protein associated with neuroepithelium-derived progenitor cells, was studied in developing oligodendrocytes. We analyzed glial cells cultured from late embryonic rat cerebral cortex, tissue prints from neonatal rat brains, and the oligodendrocyte cell line CG-4. Using cortical- or CG-4-derived oligodendrocyte lineage cells, Northern blot analysis demonstrated that nestin mRNA was highly expressed in proliferating O-2A progenitors, but downregulated in differentiated oligodendrocytes. Immunocytochemistry of cultured cells and tissue prints demonstrated that pre-O-2A cells and O-2A progenitors expressed high levels of the nestin protein. In contrast, nestin expression decreased during the pro-oligodendroblast stage, and the majority of oligodendrocytes were not labeled with anti-nestin antibodies. Culture conditions (PDGF+bFGF or B104-conditioned medium) that maintained O-2A progenitor proliferation and prevented differentiation enhanced expression of nestin mRNA transcripts and protein. In comparison, analysis of cortical astrocyte cultures demonstrated that type 1 astrocytes, but not type 2, expressed nestin mRNA and protein. Our findings demonstrate that nestin is expressed in developing glial cells, which is suggestive that this intermediate filament protein may play an important role during gliogenesis.

Animals↗