PubMed Health⌕ Search

Biomedical subjects

V Holoubek

Publications and source records attributed to V Holoubek.

At least 19 recordsLinked to original sources
PubMed1989

Two LINE 1 repeats in rat.

One LINE 1 repeat has been located 661 bp downstream from the last albumin exon and another approx. 10 kbp downstream from the last alpha-fetoprotein exon in the rat genomic DNA. The LINE 1 repeat following the albumin gene is truncated at its 5' end and is 1204 nucleotides long. The 5' end of the longer repeat downstream from the alpha-fetoprotein gene has not been determined. The two repeats have 95% homology with each other, with the exception of a short diverse 3' end sequence just preceding the putative polyadenylation signal.

Albumins↗
PubMed1988

Nucleotide sequence of small chromatin-associated RNA (fr3 RNA).

A small RNA found in the fraction on non-histone chromosomal proteins or rat liver and chicken reticulocytes [Holoubek, V., Deacon, N.J., Buckle, D.W. and Naora, H. (1983) Eur. J. Biochem. 137, 249-256] has been isolated from rat liver and then sequenced. The RNA is 30 nucleotides long and has the following composition: 5'AGUGGGGGACUGCGUUCGCGCUCUCCCCUG3'. This sequence is identical with the sequence of the last 30 nucleotides at the 3' end of small nuclear U1 RNA.

Animals↗
PubMed1987

Effects of 3'-methyl-4-dimethylaminoazobenzene on RNA processing in rat liver nuclei.

Treatment of rats with the hepatocarcinogen 3'-methyl-4-dimethylaminoazobenzene (3'MeDAB) leads to the accumulation of polyadenylated RNA in rat liver nuclei. This polyadenylated nuclear RNA contains more double-stranded stretches than polyadenylated nuclear RNA isolated from liver of control animals. Treatment with 3'MeDAB also results in an increase of sequences homologous to small chromatin-associated RNA (fr 3-RNA) in the polyadenylated nuclear RNA and in the appearance of these sequences in polyadenylated nuclear RNA which contains some double-stranded stretches. The last mentioned fraction of nuclear RNA from liver of control animals did not hybridize with a DNA probe for fr 3-RNA. It is proposed that, perhaps as a result of inhibition of RNA processing by 3'MeDAB, the transient stages of RNA processing can be observed in animals treated with this compound.

Animals↗
PubMed1984

Location of DNA sequences complementary to small nuclear repeat RNA (fr 3-RNA) in relation to DNA sequences coding for albumin and alpha-fetoprotein in rat liver cells.

Rat liver nuclei contain a 29-nucleotides-long RNA (fr 3-RNA) which is transcribed from middle repetitive DNA sequences. By Southern analysis of restriction fragments of rat albumin and alpha-fetoprotein genomic clones, DNA sequences complementary to this RNA were detected on a 4.6 kbp Eco RI fragment located 600 bp downstream from the termination exon of the albumin gene and on a 2 kbp Eco RI-HindIII fragment located 10 kbp downstream from the restriction fragment containing the alpha-fetoprotein site. No sequence complementary to this RNA was found either in the introns of exons of both genes or in the regions extending 7 kbp upstream from the first albumin exon and 10 kbp upstream of the first alpha-fetoprotein exon. We concluded that sequences complementary to fr 3-RNA are present at the 3'-end flanking regions of the rat albumin and alpha-fetoprotein gene complexes.

Animals↗
PubMed1984

Decrease in the phosphorylation of the proteins associated with heterogeneous nuclear RNA after the application of 3'-methyl-4-dimethylaminoazobenzene.

The effect of 3'-methyl-4-dimethylaminoazobenzene (3'-MeDAB) on the phosphorylation of the proteins of the nuclear ribonucleoprotein (RNP) particles was studied in liver of rats. Forty eight hours after the application of 4 mg of the hepatocarcinogen per 100 g of body wt. by stomach intubation the particle proteins contained only 7% as much phosphate per mg of protein as the proteins of the same particles isolated from liver of control animals. Determination of the protein kinase and protein phosphatase activities in the total fraction of the non-histone nuclear proteins 48 h after the application of the carcinogen have shown an increase (200% and 159%, respectively) in both enzymatic activities. These results suggest that the hepatocarcinogen could induce the observed high turnover of the phosphates on the proteins of the liver nuclear ribonucleoprotein particles and the resulting dephosphorylation of these particles by stimulation of nuclear protein kinases and phosphatases. Qualitatively the same, but quantitatively much smaller changes were also observed 48 h after the application of the non-carcinogenic p-aminoazobenzene (AB) by stomach intubation and in regenerating liver. After the application of AB phosphorylation of the proteins of rat liver nuclear ribonucleoprotein particles decreased to 70% and in regenerating liver to 61% of the phosphorylation of particle proteins in control liver. Since it is assumed that nuclear RNP particles are involved in the processing and transport of newly synthesized premessenger RNA it is possible that the drastic dephosphorylation of the particle proteins induced by the carcinogen could be connected with the distortion of RNA processing which is observed in liver of animals treated with hepatocarcinogens.

Animals↗
PubMed1983

A small chromatin-associated RNA homologous to repetitive DNA sequences.

The chromatins of rat liver and chicken reticulocytes contain a small RNA of identical length (29 nucleotides). This RNA species differs from the degradation products of nuclear RNA present in the chromatin in possessing a free 3'-hydroxyl terminus. It stays associated with chromatin and is not released from the nuclei during the extraction of nuclear ribonucleoprotein particles. This RNA species was purified from the third fraction of non-histone chromosomal proteins eluted from Sephadex G-200 (fraction 3 RNA). When fraction 3 RNA, isolated from rat liver, was used to screen a rat genomic library approximately 3% of the phage plaques hybridized with the RNA. DNA isolated from four randomly selected hybridizing phage clones hybridized with purified 29-nucleotide RNA demonstrating that the sequences present in the four clones represent those of the 29-nucleotide RNA species and not those of minor contaminants. Each of the four clones contained a different amount of sequences complementary to the RNA species 29-nucleotides-long and in each clone the DNA sequences homologous to this RNA were surrounded by different restriction sites. Hybridization of 3'-32P-labeled fraction 3 RNA with blots of total genomic DNA established that some sequences homologous to this RNA are dispersed in the DNA and others are present on one EcoRI restriction fragment, which is approximately 6000 base pairs long. Fraction 3 RNA is not a degradation product of ribosomal or transfer RNA, it is transcribed from middle repetitive DNA and probably originates by specific release during the formation and/or processing of high-molecular-weight transcripts. In normal liver cells its sequences are not released into the cytoplasm.

Animals↗
PubMed1982

The effect of inhibition of RNA synthesis by actinomycin D on the population of basic polypeptides of the 30S unclear ribonucleoprotein particles.

In rats injected intraperitoneally with actinomycin D (2 mg/kg body weight) 12 h earlier, the yield of the 30S ribonucleoprotein particles isolated from liver nuclei by extraction with 0.1 M NaCl at pH 8.0 decreased by 60 per cent. The protein-to-RNA ratio of these particles increased to 32:1 from the ratio 4.4:1 found in the same particles isolated from the nuclei of liver of control rats. The particles isolated from the liver nuclei of rats injected with actinomycin D were depleted of all charge isomers of the two most prominent polypeptides (33,000 and 39,000 daltons) present in the particles of liver of control animals. The most abundant protein in these particles was a 43,000 dalton polypeptide. This polypeptide is the least prominent of the 3 major polypeptides present in the control particles. The same charge isomers of the 43,000 dalton polypeptide were present in the nuclear ribonucleoprotein particles isolated from the liver of control animals and from the liver of animals treated with actinomycin D 12 h earlier. In control animals the nuclear ribonucleoprotein monoparticles isolated from kidney contained 3 major polypeptides of the same molecular weight with the same distribution of their charge isomers as were present in the particles isolated from liver nuclei. The injection of actinomycin D 12 h earlier was without any effect on the protein composition of the 30S nuclear ribonucleoprotein particles of rat kidney.

Animals↗
PubMed1981

Azocarcinogen-induced release of chromatin-associated RNA into liver cytoplasm: the possible role of reiterated RNA sequences in the control of RNA processing.

In the liver of rats fed the azocarcinogen 3'-methyl-4-dimethylaminoazobenzene (3'MeDAB) reiterated RNA sequence transcribed from middle repetitive DNA are released into the cytoplasm. The same repetitive nucleotide sequences can be isolated from the chromatin of the liver of control animals in the form of metabolically highly active, 13 000 daltons RNA. This small, chromatin-associated RNA originates from nuclear RNA larger than 10 S. The discontinuation of the feeding of the azocarcinogen will not stop the release of the nuclear reiterated RNA sequences into the cytoplasm. The repetitive sequences of nuclear RNA which are released into the cytoplasm in animals fed the azocarcinogen can no longer be found in the chromatin in the form of small RNA molecules. The results can be explained by the assumption that the reiterated RNA sequences are involved in the upholding of RNA processing. A cell-specific processing of RNA will be maintained by the interaction of reiterated RNA fragments from already processed RNA with the reiterated complementary sequences on RNA yet to be processed. Existence of such a feed-back circuit would make it possible to explain how a temporary interference of the azocarcinogen with RNA processing will result in the disappearance of specific reiterated RNA sequences from the chromatin. It could also explain the continuation of the release of the same repeated RNA sequences into the cytoplasm as part of larger RNA molecules even after the removal of the carcinogen.

Animals↗
PubMed1980

Polysomal poly(A)+ RNA in liver of rats fed 3'-methyl-4-dimethylaminoazobenzene and in hepatoma induced by the same carcinogen.

Feeding of carcinogenic azo dyes to rats results in a release into the cytoplasm of RNA sequences which in liver cells of control animals are degraded in the cell nucleus. A cross-hybridization of polysomal poly(A)+ RNA from liver of rats fed the hepatocarcinogen 3'-methyl-4-dimethylaminoazobenzene and from liver of control animals with their complementary DNA has shown, that the disruption of the processing and/or release of nuclear RNA induced by the carcinogen is not reflected in a change in the polysomal poly(A)+ RNA. After 17 weeks of feeding the hepatocarcinogen, there is no difference in the sequence complexity of polysomal poly(A)+ RNA in the liver. It is therefore not probable that the RNA sequences released from the nucleus by the azo dye serve as a template for protein synthesis. An alteration in the polysomal poly(A)+ RNA population was observed only temporarily at an earlier stage of feeding of the azocarcinogen. It coincided with the regeneration of the liver in a response to the initial toxic effect of the azocarcinogen. Therefore, it is probable that this alteration is the result of a temporary change in the population of liver cells. A cross-hybridization of liver and hepatoma complementary DNA with the polysomal poly(A)+ RNA from both organs have shown an overlap of the polysomal poly(A)+ RNA sequences of the hepatoma with the sequences present in the liver, with many liver sequences missing, or present only in very low concentration in the hepatoma.

Animals↗
PubMed1978

Isolation and characterization of the predominant protein in nuclear ribonucleoprotein particles from rat liver.

The predominant protein of the nuclear ribonucleoprotein particles of rat liver was isolated by polyacrylamide gel electrophoresis. The polypeptide represented 35% to 40% of the total mass of the protein moiety. Its molecular weight was estimated to be 38 000 and its NH2-terminal residue was found to be threonine. The amino acid composition is unique in having a high content of glycyl residues (20%) and NG-dimethylarginine (14% of total arginyl residues).

Amino Acid Sequence↗
PubMed1977

Stimulation of synthesis of the proteins of 30-S nuclear ribonucleoprotein particles in human amnion U cells by viral infection.

Early increase in RNA synthesis induced in human amnion U cells by infection with poliovirus is accompanied by an increased incorporation of amino acids into non-histone nuclear proteins with an approximate molecular weight of 40 000. These proteins are the main polypeptides of the 30-S nuclear ribonucleoprotein particles. After fractionation of nuclear proteins by extraction with solutions of different ionic strength, these polypeptides are present in the fraction of nuclear sap proteins soluble in 0.1 M Tris - HCl buffer, pH 7.6, and in the fraction of non-histone chromosomal proteins which are soluble in 0.35 M NaCl. The increase in synthesis of non-histone nuclear proteins with an approximate molecular weight of 40 000, observed in the infected cells, represents an increase in the synthesis of proteins concerned with post-transcriptional events and, therefore, is the result and not the cause of gene activation.

Carbon Radioisotopes↗
PubMed1977

Dependence of the composition of the protein moiety of nuclear ribonucleoprotein particles on the extent of particle purification as studied by electrophoresis including a two-dimensional procedure.

Extraction with 0.1 M NaCl in 0.01 M Tris-HCl buffer, pH 8.0 releases from liver nuclei 30-40-S ribonucleoprotein particles containing newly synthesized RNA. Separation of the protein moiety of these particles by acid-urea gel electrophoresis depends on the concentration of beta-mercaptoethanol in the buffer used for the solubilization of the particles. At low concentration or with short time of solubilization, only a polypeptide chain with apparent molecular weight 38 000 penetrates into the gel and can be detected by electrophoresis. By introduction of two-dimensional polyacrylamine gel electrophoresis, we succeeded to separate the protein moiety of these particles into a core group of 4 major and 6 minor polypeptides with molecular weights ranging from 38 000 to 50 000 and a second group of 19 polypeptides ranging in molecular weight from 50 000 to 120 000. The composition of the protein moiety of these particles is dependent on the extent of purification. Polypeptides with molecular weight below 50 000 represent 55% of the total protein of particles purified only by centrifugation through a 15-30% sucrose gradient. If the particles were first purified by gel filtration through Bio-Gel A-50m followed by centrifugation in sucrose gradient, the low molecular weight proteins represent 80% of all the proteins of the particles. The purification removed selectively the minor high molecular weight polypeptides without resulting in any extensive release of the four major polypeptides with molecular weight below 50 000 which form a stable core particle. By repeated purification it is possible to strip the particles of the high molecular weight polypeptides even further. An increase in the NaCl concentration of the extraction buffer to 0.35 M will extract additional 30-40-S particles associated with a newly synthesized RNA from the cell nucleus. These particles contain the same polypeptides as particles extracted at lower salt concentration. Extraction with 0.1 M and 0.35 M NaCl at pH 8.0 removed from the nucleus approximately 55% of all RNA labeled in 30 min after intraperitoneal injection of [3H] orotic acid to the rats.

Animals↗
PubMed1977

Protein composition of nuclear ribonucleoprotein particles isolated from liver of rats in the early stages of feeding of 3'-methyl-4-dimethylaminoazobenzene and from hepatoma induced by the same carcinogen.

The feeding of carcinogenic 3'-methyl-4-dimethylaminoazobenzene (3'-MeDAB) in the early stages results in a change in the protein composition of the nuclear ribonucleoprotein particles of the rat liver. These particles are associated with newly synthesized RNA and it is assumed that they are involved in the processing and in the transport of this RNA. After 6 weeks of feeding of this azocarcinogen, the amount of one of the main polypeptides (apparent molecular weight 42 000) is decreased and after 10 weeks of feeding the particles are devoid of this polypeptide completely. Feeding of the non-carcinogenic p-aminoazobenzene (AB) is without any effect. The loss of this polypeptide is not characteristic for the malignant transformation. In the nuclear ribonucleoprotein particles isolated from hepatoma which has been induced by 3'-MeDAB this polypeptide is present in even higher proportion to other polypeptides than it is in particles isolated from liver cells of control animals. The 3'-MeDAB binds to the proteins of the liver nuclear ribonucleoprotein particles and interferes with the RNA processing. It is proposed that the changes in the composition of the protein moiety of the particles reflect changes in the population of liver cells leading finally to the selection of hepatoma cells which are resistant to the toxic effect of 3'-MeDAB on RNA processing.

Animals↗