Biomedical subjects

W C Chang

Publications and source records attributed to W C Chang.

At least 19 recordsLinked to original sources

PubMed1992

Plasmin and the regulation of tissue-type plasminogen activator biosynthesis in human endothelial cells.

Plasmin inhibited the biosynthesis of tissue-type plasminogen activator (tPA) antigen by human umbilical vein endothelial cells (HUVEC) in a dose-dependent manner. The amount of tPA antigen found in the 24-h conditioned medium of cells treated with 100 nM plasmin for 1 h was 20-30% of that in the control group. However, in contrast to tPA, such treatment led to a 3-fold increase in plasminogen activator inhibitor (PAI) activity, whereas the amount of PAI type 1 antigen was unchanged. The effects of plasmin on HUVEC were binding- and catalytic activity-dependent and were specifically blocked by epsilon-aminocaproic acid. Microplasmin, which has no kringle domains, was less effective in reducing tPA antigen biosynthesis or enhancing PAI activity in HUVEC. Kringle domains of plasmin affected neither tPA antigen nor PAI activity of the cells. Other proteases including chymotrypsin, trypsin, and collagenase at comparable concentrations did not have a significant effect on the biosynthesis of tPA antigen or PAI activity of HUVEC. Thrombin stimulated the biosynthesis of tPA and PAI-1 antigens by HUVEC. Thrombin also stimulated an increase in the protein kinase activity in HUVEC, whereas plasmin inhibited the protein kinase activity of the cells. It is possible that plasmin regulates the biosynthesis of tPA in HUVEC through the signal transduction pathway involving protein kinase.

Aminocaproic Acid↗

PubMed1992

Insulin-like growth factor I stimulates transcription of the c-jun proto-oncogene in Balb/C 3T3 cells.

Treatment of quiescent Balb/c 3T3 cells with insulin-like growth factor I (IGF I) resulted in the stimulation of proto-oncogene c-jun transcription. Cells exposed to cycloheximide and IGF I together showed super-induction of c-jun transcripts. Nuclear run-off assay revealed that IGF I up-regulated c-jun only while cycloheximide was present. The stability of c-jun mRNA was markedly increased in the cells treated with IGF I. These results suggest that IGF I controls the expression of c-jun by increasing the transcriptional activity and stabilizing the existing transcripts.

3T3 Cells↗

PubMed1992

Epidermal growth factor enhances a microsomal 12-lipoxygenase activity in A431 cells.

12-Hydroxyeicosatetraenoic acid (12-HETE) is formed from arachidonic acid either by 12-lipoxygenase or by a cytochrome P450 monooxygenase. 12-Lipoxygenase is generally localized in the soluble cytosolic fraction, and the cytochrome P450 monooxygenase is a microsomal enzyme. In this study, 12-HETE biosynthesis and the regulation of 12-HETE biosynthesis by epidermal growth factor (EGF) in A431 cells were investigated. 12-HETE was biosynthesized from arachidonic acid by the microsomal fraction of A431 cells, but not by the cytosolic fraction. The formation of 12-HETE was inhibited by 5,8,11,14-eicosatetraynoic acid, nordihydroguaiaretic acid, and caffeic acid. Nordihydroguaiaretic acid at 10(-4) M and 5,8,11,14-eicosatetraynoic acid at 10(-5) M almost completely inhibited its formation. However, the formation of 12-HETE was not affected by the presence of an NADPH-generating system, carbon monoxide, or SKF 525A. The biosynthetic 12-HETE was analyzed by chiral stationary phase high performance liquid chromatography and was highly enriched in (12S)-HETE. We therefore concluded that the enzyme responsible for the formation of (12S)-HETE in the microsomes of A431 cells is a 12-lipoxygenase. The microsomal 12-lipoxygenase of A431 cells belongs to the "leukocyte-type" enzyme as determined by substrate specificity and enzyme kinetics studies. The microsomal 12-lipoxygenase oxygenated linoleic acid much faster than the cytosolic platelet 12-lipoxygenase and is a "self-catalyzed inactivation" enzyme. Treatment of cells with 50 ng/ml EGF significantly induced microsomal 12-lipoxygenase activity. The lag period for the expression of the stimulatory effect of EGF on 12-lipoxygenase activity was approximately 10 h. The stimulatory effect of EGF on 12-lipoxygenase activity was completely blocked by treatment with 35 microM cycloheximide, indicating a requirement for de novo protein biosynthesis. Furthermore, the presence of the endogenous inhibitor of 12-lipoxygenase (which masked (12S)-HETE biosynthesis in intact cells) was identified in the cytosolic fraction of A431 cells. The putative inhibitor was enzyme-selective. It inhibited the leukocyte-type 12-lipoxygenase, but not the "platelet-type" enzyme.

12-Hydroxy-5,8,10,14-eicosatetraenoic Acid↗

PubMed1992

Human stomach aldehyde dehydrogenase cDNA and genomic cloning, primary structure, and expression in Escherichia coli.

An aldehyde dehydrogenase isozyme, ALDH3, which is strongly expressed in the stomach, may play a role in the oxidation of toxic aldehydes. Using reverse genetic approach, we cloned and characterized the cDNA and the gene for the ALDH3. The full length cDNA is 1624 base pairs (bp) in length and contains an open reading frame encoding 453 amino acid residues. The deduced amino acid sequence shows a high degree of resemblance to that of rat hepatocarcinoma ALDH. The human ALDH3 gene spans about 8 kb in length and consists of 10 exons. The putative TATA and CCAAT boxes are located in the consensus upstream distance from the transcription initiation site. Southern blot analysis of total genomic DNA argues against the proposed two-gene model for the ALDH3 isozymes (Yin, S.-J., Cheng, T.-C., Chang, C.-P., Chen, Y.-J., Chao, Y.-C., Tang, H.-S., Chang, T.-M., and Wu, C.-W. (1988) Biochem. Genet. 26, 343-360). Northern blot hybridization and analysis of PCR amplification products of cellular RNA demonstrated the existence of a high level of ALDH3 mRNA in human stomach and hepatoma cells, but a very low level in the normal liver. Expression of ALDH3 cDNA in Escherichia coli yielded a protein of 55 kDa, which exhibited kinetic properties similar to that found in ALDH3 isozyme purified from human stomach and liver, and was hybridizable with rabbit anti-human-hepatoma ALDH serum.

Aldehyde Dehydrogenase↗

PubMed1992

Effects of retinoids on endothelial cell proliferation, prostacyclin production and platelet aggregation.

In addition to their anti-inflammatory and anti-cancer activities, retinoids have been shown to affect angiogenesis, endothelial proliferation and the process of wound healing. While peripheral vascular occlusion has not been observed as an adverse effect clinically, the effects of retinoids on prostacyclin production in endothelial cells and platelet aggregation are not known. We examined the effects of tretinoin, isotretinoin and etretinate (3.3 x 10(-8) to 3.3 x 10(-5) M) on cytotoxicity by 51Cr-release assay, growth and prostacyclin in bovine carotid endothelial cell cultures, and the aggregation of human platelets induced by ADP. All retinoids showed either no or only small effects on cytotoxicity and human platelet aggregation. Prostacyclin production was not significantly affected except for tretinoin and isotretinoin at 3.3 x 10(-5) M. Endothelial proliferation was affected by all three retinoids in a dose-dependent fashion; for tretinoin and isotretinoin an inhibitory trend was noted as the concentration increased but the reverse was true for etretinate. Retinoids at 3.3 x 10(-5) M induced alterations of typical endothelial morphology; the cells became fibroblastoid. The results of prostacyclin production and platelet aggregation in the present study are consistent with the absence of peripheral vascular occlusion as a side effect clinically.

Animals↗

PubMed1992

Cytoprotective effect of reduced glutathione in hydrogen peroxide-induced endothelial cell injury.

The kinetic effects of hydrogen peroxide (H2O2) on cultured endothelial cells isolated from bovine carotid artery were studied. The cytoprotective effects of glutathione (GSH) on H2O2-induced cell injury were also investigated. H2O2-induced a dose- and time-dependent cell injury in cultured endothelial cells. H2O2-induced cell injury was blocked by simultaneous treatment by catalase, but not by superoxide dismutase. H2O2 also induced endogenous PGI2 biosynthesis, and the maximum PGI2 production was reached after 1 h treatment. Stimulation of PGI2 production was parallel with arachidonate release from H2O2-treated cells. However the prostaglandin biosynthesis enzyme activity in cells was inhibited by H2O2 treatment. When the cells were treated with GSH, the intracellular GSH reached a plateau after 3 h treatment. Both H2O2-induced cell injury and PGI2 production were significantly inhibited by the 3 h pretreatment with GSH. The cytoprotective effect of GSH was completely inhibited by buthionine sulfoximine which is a specific inhibitor of gamma-glutamylcysteine synthetase. The results indicate that the cytoprotective effect of GSH on H2O2-induced cell injury in cultured bovine carotid artery endothelial cells depends on the increase in intracellular GSH content.

Animals↗

PubMed1992

Inhibition of platelet activation and endothelial cell injury by polyphenolic compounds isolated from Lonicera japonica Thunb.

Effects of the polyphenolic compounds isolated from Lonicera japonica Thunb on platelet aggregation, platelet thromboxane biosynthesis and hydrogen peroxide-induced endothelial cell injury were studied. With regard to the inhibitory effect on human platelet aggregation, methyl caffeate, 3,4-di-O-caffeoylquinic acid and methyl 3,4-di-O-caffeoylquinate had a strong effect. They significantly inhibited the second wave of platelet aggregation induced by ADP. Concerning thromboxane biosynthesis triggered by calcium ionophore A23187 in platelets, methyl caffeate and methyl 3,4-di-O-caffeoylquinate had the most potent inhibitory effect. Methyl 3,4-di-O-caffeoylquinate directly inhibited the conversion of arachidonic acid to thromboxane by platelet microsomes, while methyl caffeate did not have any significant effect on thromboxane biosynthesis in platelet microsomes. In the prevention of hydrogen peroxide-induced endothelial cell injury in culture, protocatechuic acid, methyl caffeate, methyl chlorogenic acid and luteolin were significantly effective. The inhibitory effect on platelet activation and the cytoprotective effect on hydrogen peroxide-induced cell injury may explain the possible role of polyphenolic compounds isolated from Lonicera japonica Thunb in maintaining vascular homeostasis.

Animals↗

PubMed1992

The change of urinary 11-dehydro-thromboxane B2 and 2,3-dinor-6-keto-prostaglandin F1 alpha in arteriogenic impotence.

Thromboxane A2 is a potent vasoconstrictor and a stimulus of platelet aggregation, which may contribute to hypercoagulability. The prostacyclin, prostaglandin I2, has exactly the opposite effect. Measurement of the major urinary metabolites, 11-dehydro-thromboxane B2 and 2,3-dinor-6-keto-prostaglandin F1 alpha (prostaglandin F1 alpha) by radioimmunoassay can accurately reflect in vivo the biosynthesis of thromboxane A2 and prostaglandin I2, respectively. Group 1 consisted of 60 patients less than 50 years old. The mean urinary 11-dehydro-thromboxane B2 level of 3 patients with arteriogenic impotence was significantly greater than that of the 57 control volunteers: 2.66 +/- 0.65 versus 1.74 +/- 0.56 (plus or minus standard deviation) ng./mg. creatinine (p = 0.008). The prostaglandin F1 alpha levels for the patients and controls were 32.74 +/- 8.45 and 37.58 +/- 16.55 ng./mg. creatinine, respectively, which was not significantly different (p greater than 0.05). Group 2 consisted of 96 patients 50 years old or older. The 11-dehydro-thromboxane B2 concentration in the urine was 1.83 +/- 0.58, 2.54 +/- 1.12 and 1.91 +/- 0.73 ng./mg. creatinine in the 47 normal control volunteers, 20 patients with arteriogenic impotence and 29 with arteriogenic impotence plus intracavernous injection of 20 micrograms prostaglandin E1, respectively. The arteriogenic impotence group showed the significantly highest level among the 3 groups (p = 0.0025). Also, the urinary prostaglandin F1 alpha levels in these patients were 45.71 +/- 36.3, 57.71 +/- 35.53 and 59.30 +/- 45.08 ng./mg. creatinine, respectively, which was not significantly different (p greater than 0.05). For the 13 patients with arteriogenic impotence (group 3) we compared the urinary 11-dehydro-thromboxane B2 and prostaglandin F1 alpha levels before and after intracavernous injection of prostaglandin E1 by using a paired t test. The results showed that the change in 11-dehydro-thromboxane B2 levels was 2.78 +/- 1.09 versus 1.99 +/- 0.75 ng./mg. creatinine, which was significantly different (p = 0.005), whereas that for prostaglandin F1 alpha was 62.30 +/- 40.41 versus 58.86 +/- 44.26 ng./mg. creatinine, with no significant difference (p greater than 0.05). Our findings suggest that urinary 11-dehydro-thromboxane B2 may have an important role in the diagnosis and treatment of arteriogenic impotence.

6-Ketoprostaglandin F1 alpha↗

PubMed1992

Predicted secondary and tertiary structures of carp gamma-crystallins with high methionine content: role of methionine residues in the protein stability.

A systematic structural comparison of several carp gamma-crystallins with high methionine contents was made by the secondary-structure prediction together with computer model-building based on the established X-ray structure of calf gamma-II crystallin. The overall surface hydrophilicity profile and the distribution of helices, beta-sheets, and beta-turns along the polypeptide chains are very similar among these carp gamma-crystallins. In addition, their general polypeptide packing is close to the characteristic 2 domain/4 motif Greek key three-dimensional conformation depicted for the calf gamma-II crystallin. Interestingly, most hydrophobic methionine residues are located on the protein surface with only a few buried inside the protein surface or in the interface between two motifs of each domain. The exposed hydrophobic and polarizable methionine cluster on the protein surface may have a bearing on the crystallin stability and dense packing in the piscine species, and probably also provides a malleable nonpolar surface for the interaction with other crystallin components for the maintenance of a clear and transparent lens.

Amino Acid Sequence↗

PubMed1992

Effects of acute exercise on the biosynthesis of eicosanoids in rats.

We conducted this study to evaluate the effects of different intensities of acute exercise on the regulation of endogenous eicosanoid levels in male Wistar rats. The animals were divided into 4 groups; i.e.: control, mild exercise, moderate exercise and severe exercise. Immediately after exercise, animals were sacrificed. Plasma prostacyclin (PGI2) level and PGI2 release from two vessel segments (i.e., thoracic aorta and inferior vena cava) were determined by a specific 6-keto-PGF1 alpha (125I) radioimmunoassay. Urine thromboxane was determined by a specific 11-dehydro-TXB2 (125I) radioimmunoassay and normalized by urine creatinine. Although both plasma PGI2 and urine thromboxane tended to be elevated by severe exercise, only the increase in thromboxane was statistically significant (p < 0.05). In addition, PGI2 release from both vessels were not affected by different intensities of acute exercise. We also observed that aortic PGI2 release was greater than their corresponding veins in each group. We therefore conclude that only severe acute exercise, rather than mild or moderate exercise, may affect prostacyclin-thromboxane balance in rats.

Animals↗

PubMed1992

Pure rhabdomyosarcoma of the corpus uteri in a postpartum patient: report of a case and review of the literature.

Pure rhabdomyosarcomas originate in the female genital tract. They are uncommon and most often occur in infancy or childhood as sarcoma botryoides (embryonal rhabdomyosarcoma) which involve the vagina and cervix. Such tumors rarely occur in adults. A pure rhabdomyosarcoma of the uterus that arose in a postpartum patient is described. The pertinent literature is discussed.

Adult↗

PubMed1991

Gamma-crystallin genes in carp: cloning and characterization.

The carp gamma-crystallin gene family was found to be composed of at least three members: gamma m1, gamma m2 and gamma m3. The encoded products are very similar to other known gamma-crystallins but with their own peculiarities: (1) they all have a high methionine content: 12.4%, 14% and 8.4% in gamma m1, gamma m2 and gamma m3, respectively; and (2) the amino acid sequences are aberrant in the region before connecting peptides and its corresponding region in motif 4. Their protein structures might remain the same as those of other gamma-crystallins since they retain all the conserved amino acid residues essential for maintaining the loops in the protein structures.

Amino Acid Sequence↗

PubMed1991

Cloning and characterization of a new functional human aldehyde dehydrogenase gene.

We cloned a new functional ALDH gene (ALDHx) from a human genomic library in cosmid pWE-15 by screening with a 29-nucleotide probe partially matched to a conserved region of the ALDH1 and ALDH2 genes. The new ALDHx gene does not contain introns in the coding sequence for 517 amino acid residues. The degree of resemblance between the deduced amino acid sequences of the new ALDHx gene and the ALDH2 gene is 72.5% (alignment of 517 amino acid residues), while that between the ALDHx and the ALDH1 gene is 64.6% (alignment of 500 amino acid residues). The amino acid residues (Cys-162, Cys-302, Glu-268, Glu-487, Gly-223, Gly-225, Gly-229, Gly-245 and Gly-250), which exist in both ALDH1 and ALDH2 isozymes and have been implicated in functional and structural importance, are also preserved in the deduced sequence of the new ALDHx gene. Northern blot hybridization with ALDHx probe revealed the existence of a unique mRNA band (3.0 kilobases) in the human liver and testis tissues. Using the new ALDHx probe, we cloned the cDNA of the gene from a human testis cDNA library in lambda gt11 vector. The nucleotide sequence of the cDNA differs from that of the genomic sequence at three nucleotide positions resulting in the exchange of 2 deduced amino acid residues. These positions are polymorphic as further demonstrated by the PCR amplification of the targeted region followed by nucleotide sequence analysis of the genomic DNA from eight unrelated individuals. Alignment of the genomic and cDNA sequence indicates that although the ALDHx gene appears to have no intron in its coding sequence, an intron of 2.6 kilobases is found to interrupt the 5'-untranslated (5'-UT) sequence. Primary extension and S1 mapping analysis indicate the existence of at least two 5'-UT exons. The new ALDHx gene was assigned to chromosome 9 by Southern blot hybridization of DNA samples from a panel of rodent-human hybrid cell lines.

Aldehyde Dehydrogenase↗

PubMed1991

The effects of glucocorticoid hormone on the expression of c-jun.

The effects of glucocorticoid hormone on the expression of c-jun in the fibroblasts were studied. The expression of c-jun was repressed by dexamethasone in the NIH3T3 cells, but not in the transformed B104-1 or EJ-Ras cells. The repression was not relieved by the addition of cycloheximide.

Animals↗

PubMed1991

Cloning and characterization of the carp prolactin gene.

A carp genomic DNA clone containing the carp prolactin (Prl) gene was isolated with carp Prl cDNA as a probe. The organization of the carp Prl gene was determined by restriction nuclease mapping and nucleotide sequencing. The Prl gene comprises approx. 2.8 kilobasepairs (kb) of DNA including the 5'-flanking region, five exons, four introns and the 3'-flanking region. Analysis of the 5'-flanking region reveals (1) the sequence TATATAAT at positions -38 to -31 upstream from the cap site which was found to be a guanine residue, and (2) the palindrome, CTCATTGCATATACAAATGAG at positions -79 to -59. The carp Prl gene matches with the reported cDNA except for one difference in coding region and five in the 3'-flanking region, while the encoded amino acid sequences are identical. The arrangement of exons and introns is very similar to that seen in carp GH as well as mammalian Prl, which, however, have much longer introns.

Amino Acid Sequence↗

PubMed1991

Cytoprotective effect of reduced glutathione in arsenical-induced endothelial cell injury.

The effect of four arsenic compounds on cultured endothelial cell isolated from bovine carotid arteries was studied. Only trivalent arsenicals (arsenic trioxide and sodium m-arsenite), but not pentavalent arsenicals (arsenic acid and p-arsenilic acid), induced significant cell injury. Since the intracellular reduced glutathione (GSH) plays an important role in detoxication in mammalian cells, its effect on arsenical-induced cell injury was then studied. Pretreatment of cells with 500 microM GSH not only resulted in several-fold increase in the intracellular level of GSH but also effectively protected them against the injury caused by arsenic trioxide. After a pretreatment of cells with GSH for 3 h, the intracellular GSH reached a plateau. A longer pretreatment for 24 h still kept GSH at a very significant high level. The cell injury induced by arsenic trioxide was protected by GSH, and then cellular biosynthesis of PGI2 in culture was also increased. The cytoprotective effect and the stimulatory effect on PGI2 production, where both were dose-dependent on GSH, were in a strict reverse relationship. Aspirin treatment inhibited the PGI2 biosynthesis induced by GSH in the arsenic trioxide-induced cell injury, and significantly reduced the cytoprotective effect induced by GSH. These results suggest that the marked stimulation of endogenous PGI2 biosynthesis by GSH is the mechanism of the latter's cytoprotective effect on arsenic trioxide-induced endothelial cell injury.

Animals↗

PubMed1991

Inhibition of platelet activation and endothelial cell injury by flavan-3-ol and saikosaponin compounds.

The effects of flavan-3-ol and saikosaponin compounds on platelet aggregation, platelet thromboxane biosynthesis and H2O2-induced endothelial cell injury were studied. Seven flavan-3-ol compounds isolated from Camellia sinensis L. var sinensis O. Kuntze (Theaceae) and three saikosaponin compounds isolated from Bupleurum falcatum L. (Umbelliferae) were used. Among the 10 compounds tested, only epigallocatechin and saikosaponin a significantly inhibited human platelet aggregation induced by ADP, and the potency of inhibition was comparable with aspirin. Both of epigallocatechin and saikosaponin a dose-dependently inhibited the platelet thromboxane formation from exogenous and endogenous arachidonic acid. In the prevention of H2O2-induced endothelial cell injury in culture, only gallocatechin-3-0-gallate and epicatechin-3-0-gallate were effective. The inhibitory effect of epigallocatechin and saikosaponin a on platelet activation and the cytoprotective effect of gallocatechin-3-0-gallate and epicatechin-3-0-gallate on H2O2-induced endothelial cell injury could give evidence of explaining the possible role of flavan-3-ol and saikosaponin compounds in maintaining vascular homeostasis.

Animals↗

PubMed1991

15-Hydroxyprostaglandin dehydrogenase activity in the lower genitourinary tract. A preliminary report.

In the pathway of prostaglandin inactivation, 15-hydroxyprostaglandin dehydrogenase (15-OHPGDH) has been proven to be the catalyst of the primary catabolic step in the oxidation of the 15-hydroxyl group into a 15-keto moiety in most derivatives of prostaglandins. In this study, we analysed 15-OHPGDH activity in the lower genitourinary tract. The specimens were obtained with permission from patients who underwent surgery. These specimens were then sent for quantitative determination using a tritium release assay specific for 15-OHPGDH. The highest enzyme activity was found in the ureter with a mean +/- SE (pmol/min/mg) of 94.99 +/- 51.00; the lowest activity was in the vas deferens, with a value of 0.18 +/- 0.21. This preliminary study indicated that the activity of 15-OHPGDH in the lower genitourinary tract was significant and that prostaglandin levels in the genitourinary tract may be regulated by this enzyme.

Adult↗