Biomedical subjects

W D Funk

Publications and source records attributed to W D Funk.

At least 19 recordsLinked to original sources

PubMed1998

The mouse telomerase RNA 5"-end lies just upstream of the telomerase template sequence.

Telomerase is a ribonucleoprotein enzyme with an essential RNA component. Embedded within the telomerase RNA is a template sequence for telomere synthesis. We have characterized the structure of the 5' regions of the human and mouse telomerase-RNA genes, and have found a striking difference in the location of the template sequence: Whereas the 5'-end of the human telomerase RNA lies 45 nt from the telomerase-RNA template sequence, the 5'-end of the mouse telomerase RNA lies just 2 nt from the telomerase-RNA template sequence. Analysis of genomic sequences flanking the 5'-end of the human and mouse telomerase RNA-coding sequences reveals similar promoter-element arrangements typical of mRNA-type promoters: a TATA box-like element and an upstream region containing a consensus CCAAT box. This putative promoter structure contrasts with that of the ciliate telomerase-RNA genes whose structure resembles RNA polymerase III U6 small nuclear RNA (snRNA) promoters. These and other comparisons suggest that, during evolution, both the RNA-polymerase specificity of telomerase RNA-gene promoters and, more recently, the position of the template sequence in the telomerase RNA changed.

Animals↗

PubMed1996

Reconstitution of human telomerase activity and identification of a minimal functional region of the human telomerase RNA.

Telomerase is a ribonucleoprotein that catalyzes telomere elongation through the addition of TTAGGG repeats in humans. Activation of telomerase is often associated with immortalization of human cells and cancer. To dissect the human telomerase enzyme mechanism, we developed a functional in vitro reconstitution assay. After removal of the essential 445 nucleotide human telomerase RNA (hTR) by micrococcal nuclease digestion of partially purified human telomerase, the addition of in vitro transcribed hTR reconstituted telomerase activity. The activity was dependent upon and specific to hTR. Using this assay, truncations at the 5' and 3' ends of hTR identified a functional region of hTR, similar in size to the full-length telomerase RNAs from ciliates. This region is located between positions 1-203. Furthermore, we found that residues 1-44, 5' to the template region (residues 46-56) are not essential for activity, indicating a minimal functional region is located between residues 44-203. Mutagenesis of full-length hTR between residues 170-179, 180-189 or 190-199 almost completely abolished the ability of the hTR to function in the reconstitution of telomerase activity, suggesting that sequences or structures within this 30 nucleotide region are required for activity, perhaps by binding telomerase protein components.

Animals↗

PubMed1995

The RNA component of human telomerase.

Eukaryotic chromosomes are capped with repetitive telomere sequences that protect the ends from damage and rearrangements. Telomere repeats are synthesized by telomerase, a ribonucleic acid (RNA)-protein complex. Here, the cloning of the RNA component of human telomerase, termed hTR, is described. The template region of hTR encompasses 11 nucleotides (5'-CUAACCCUAAC) complementary to the human telomere sequence (TTAGGG)n. Germline tissues and tumor cell lines expressed more hTR than normal somatic cells and tissues, which have no detectable telomerase activity. Human cell lines that expressed hTR mutated in the template region generated the predicted mutant telomerase activity. HeLa cells transfected with an antisense hTR lost telomeric DNA and began to die after 23 to 26 doublings. Thus, human telomerase is a critical enzyme for the long-term proliferation of immortal tumor cells.

Animals↗

PubMed1995

Cataloging altered gene expression in young and senescent cells using enhanced differential display.

Recently, a novel PCR-based technique, differential display (DD), has facilitated the study of differentially expressed genes at the mRNA level. We report here an improved version of DD, which we call Enhanced Differential Display (EDD). We have modified the technique to enhance reproducibility and to facilitate sequencing and cloning. Using EDD, we have generated and verified a catalog of genes that are differentially expressed between young and senescent human diploid fibroblasts (HDF). From 168 genetags that were identified initially, 84 could be sequenced directly from PCR amplified bands. These sequences represent 27 known genes and 37 novel genes. By Northern blot analysis we have confirmed the differential expression of a total of 23 genes (12 known, 11 novel), while 19 (seven known, 12 novel) did not show differential expression. Several of the known genes were previously observed by others to be differentially expressed between young and senescent fibroblasts, thereby validating the technique.

Base Sequence↗

PubMed1994

Recombinant human erythrocyte cytochrome b5.

The gene encoding the human erythrocyte form of cytochrome b5 (97 residues in length) has been prepared by mutagenesis of an expression vector encoding lipase-solubilized bovine liver microsomal cytochrome b5 (93 residues in length) (Funk et al., 1990). Efficient expression of this gene in Escherichia coli has provided the first opportunity to obtain this protein in quantities sufficient for physical and functional characterization. Comparison of the erythrocytic cytochrome with the trypsin-solubilized bovine liver cytochrome b5 by potentiometric titration indicates that the principal electrostatic difference between the two proteins results from two additional His residues present in the human erythrocytic protein. The midpoint reduction potential of this protein determined by direct electrochemistry is -9 +/- 2 mV vs SHE at pH 7.0 (mu = 0.10 M, 25.0 degrees C), and this value varies with pH in a fashion that is consistent with the presence of a single ionizable group that changes pKa from 6.0 +/- 0.1 in the ferricytochrome to 6.3 +/- 0.1 in the ferrocytochrome with delta H degrees = -3.2 +/- 0.1 kcal/mol and delta S degrees = -11.5 +/- 0.3 eu (pH 7.0, mu = 0.10). The 1D 1H NMR spectrum of the erythrocytic ferricytochrome indicates that 90% of the protein binds heme in the "major" orientation and 10% of the protein binds heme in the "minor" orientation (pH 7.0, 25 degrees C) with delta H degrees = -2.9 +/- 0.3 kcal/mol and delta S degrees = -5.4 +/- 0.9 eu for this equilibrium.

Amino Acid Sequence↗

PubMed1993

Characterization of wild-type and an active-site mutant in Escherichia coli of short-chain acyl-CoA dehydrogenase from Megasphaera elsdenii.

The objective of this work is to determine the molecular mechanism and regulation of short-chain acyl-CoA dehydrogenase (SCAD) from Megasphaera elsdenii. To achieve this, the gene coding for SCAD from M. elsdenii was cloned and sequenced. Site-directed mutagenesis was then used to identify an amino acid residue that is required for the proposed mechanism. To clone the gene, the amino acid sequence of the 50 N-terminal residues of SCAD from M. elsdenii was determined. This sequence information was utilized to synthesize two sets of mixed oligonucleotide primers which were then used to generate a 120-bp specific probe from M. elsdenii DNA by the polymerase chain reaction (PCR) method. The 120-bp probe was used to screen a M. elsdenii genomic DNA library cloned into Escherichia coli. The gene encoding M. elsdenii SCAD was identified from this library, sequenced, and expressed. The cloned SCAD gene contained an open reading frame which revealed a high degree of sequence identity with an open reading frame protein sequence of the human SCAD and the rat medium-chain acyl-CoA dehydrogenase (MCAD) (44% and 36% identical residues in paired comparisons for human SCAD and rat MCAD, respectively). Recombinant SCAD expressed from a pUC119 vector accounted for 35% of the cytosolic protein in the Escherichia coli crude extract. The expressed protein had similar activity, redox potential properties, and nearly identical amino acid composition to native M. elsdenii SCAD. In addition, a site-directed Glu367 Gln mutant of SCAD expressed from a pUC119 vector was shown to have minimal reductive and oxidative pathway activity with butyryl-CoA and crotonyl-CoA, respectively.(ABSTRACT TRUNCATED AT 250 WORDS)

Acyl-CoA Dehydrogenase↗

PubMed1993

Transmutation of a heme protein.

Residue Asn57 of bovine liver cytochrome b5 has been replaced with a cysteine residue, and the resulting variant has been isolated from recombinant Escherichia coli as a mixture of four major species: A, BI, BII, and C. A combination of electronic spectroscopy, 1H NMR spectroscopy, resonance Raman spectroscopy, electrospray mass spectrometry, and direct electrochemistry has been used to characterize these four major cytochrome derivatives. The red form A (E(m) = -19 mV) is found to possess a heme group bound covalently through a thioether linkage involving Cys57 and the alpha carbon of the heme 4-vinyl group. Form BI has a covalently bound heme group coupled through a thioether linkage involving the beta carbon of the heme 4-vinyl group. Form BII is similar to BI except that the sulfur involved in the thioether linkage is oxidized to a sulfoxide. The green form C (E(m) = 175 mV) possesses a noncovalently bound prosthetic group with spectroscopic properties characteristic of a chlorin. A mechanism is proposed for the generation of these derivatives, and the implications of these observations for the biosynthesis of cytochrome c and naturally occurring chlorin prosthetic groups are discussed.

Animals↗

PubMed1993

Expression of glycosylated and nonglycosylated human transferrin in mammalian cells. Characterization of the recombinant proteins with comparison to three commercially available transferrins.

The coding sequence for human serum transferrin was assembled from restriction fragments derived from a full-length cDNA clone isolated from a human liver cDNA library. The assembled clone was inserted into the expression vector pNUT and stably transfected into transformed baby hamster kidney (BHK) cells, leading to secretion of up to 125 mg/L recombinant protein into the tissue culture medium. As judged by mobility on NaDodSO4-PAGE, immunoreactivity, spectral properties (indicative of correct folding and iron binding), and the ability to bind to receptors on a human cell line, initial studies showed that the recombinant transferrin, is identical to three commercial human serum transferrin samples. Electrospray mass spectrometry (ESMS), anion-exchange chromatography, and urea gel analysis showed that the recombinant protein has an extremely complex carbohydrate pattern with 16 separate masses ranging from 78,833 to 80,802 daltons. Mutation of the two asparagine carbohydrate linkage sites to aspartic acid residues led to the expression and secretion of up to 25 mg/L nonglycosylated transferrin. ESMS, anion-exchange chromatography, and urea gel analysis showed a single molecular species that was consistent with the expected theoretical mass of 75,143 daltons. In equilibrium binding experiments, the nonglycosylated mutant bound to HeLa S3 cells with the same avidity and to the same extent as the glycosylated protein and the three commercial samples. These studies demonstrate conclusively that carbohydrate has no role in this function.

Animals↗

PubMed1993

CASTing for multicomponent DNA-binding complexes.

Degenerate oligonucleotides and polymerase chain reaction-based reiterative selection techniques have been used to define the consensus binding sites for an increasing number of transcription factors. The use of crude nuclear extracts rather than purified proteins permits multicomponent complexes to form, and allows the technique to generate information about the combinatorial interactions involved in gene regulation.

Base Sequence↗

PubMed1993

Heterogeneity of transcriptional activity of mutant p53 proteins and p53 DNA target sequences.

Transcriptional activity of p53 was monitored by cotransfection of pCMV expression vectors containing wild-type and mutant p53 cDNAs into the p53-null H1299 lung cancer cells along with luciferase reporter plasmids containing different p53 target sequences in the 5' regulatory region: fragment A of the ribosomal gene cluster (RGC); p53 consensus sequence (p53CON); or a tandemly linked RGC+p53CON sequence. Our results show: (1) wild-type p53 stimulates the transcription of reporter genes with p53CON and RGC in their 5' region while most p53 mutants occurring in human cancers have lost this activity; (2) the R273H mutant retains transcriptional activity for the p53CON sequence but not RGC; (3) some mutants are temperature-sensitive for the transcriptional activity with the p53CON but not the RGC sequence; (4) p53 mutants vary in their ability to inhibit wild-type p53 transactivation but there is no difference between p53CON and RGC sequences; (5) lung cancer cells with endogenous mutant p53 proteins (M246I in H23 cells and R248L in H322 cells) retain transcriptional activity for the p53CON but not the RGC sequence. We conclude that p53 DNA target sequences vary in their response to mutant p53 proteins, and that p53 mutants vary in several transactivation related functions.

Base Sequence↗

PubMed1993

Novel DNA binding of p53 mutants and their role in transcriptional activation.

The protein product of the normal p53 gene binds to the DNA p53CON element (GGACATGCCCGGGCATGTCC, Funk et al., 1992), thereby activating transcription from adjacent promoters. Two mutants, 248 (Arg-->Trp) and 281 (Asp-->Gly), failed to bind p53CON and to activate transcription. However, in contrast to previous reports that all p53 mutants fail to bind to the other p53 binding elements, two p53 mutants, 143 (Val-->Ala) and 273 (Arg-->His), retained both p53CON binding and transcriptional activation functions. A third mutant 175 (Arg-->His) bound to the p53CON but did not activate transcription. These data suggest that the DNA binding and transcriptional activation functions of p53 mutants in tumor cells are dependent on the specific missense mutations acquired in the p53 gene and the target sequences of p53 in the genome.

Amino Acid Sequence↗

PubMed1992

Cyclic amplification and selection of targets for multicomponent complexes: myogenin interacts with factors recognizing binding sites for basic helix-loop-helix, nuclear factor 1, myocyte-specific enhancer-binding factor 2, and COMP1 factor.

Myogenin is one of four muscle-specific basic helix-loop-helix regulatory factors involved in controlling myogenesis. We here describe various protein complexes that increase the affinity of myogenin for DNA. We mixed an oligonucleotide containing a degenerate center large enough to accommodate multiple binding sites with crude myotube nuclear extracts and used cyclic amplification and selection of targets with an antimyogenin monoclonal antibody to isolate protein-DNA complexes. Since each cycle of selection results in the enrichment for the sequences with the highest affinity, we isolated multicomponent sites in which myogenin binding was increased by its interaction with other DNA binding proteins. Myogenin interacts with members of the nuclear factor 1 family, the muscle-specific factor myocyte-specific enhancer-binding factor 2, and another factor, COMP1 (cooperates with myogenic proteins 1), that binds to the sequence TGATTGAC. Myogenin also exhibits cooperative binding with other proteins that recognize CANNTG motifs, and various constraints on spacing and orientation were observed. The application of this approach to other transcription factors should not only help identify the different functions of myogenin versus other members of the muscle basic helix-loop-helix regulatory family but also help define the general combinatorial mechanisms involved in eukaryotic gene regulation.

Base Sequence↗

PubMed1992

Preliminary crystallographic analyses of the N-terminal lobe of recombinant human serum transferrin.

The N-terminal lobe of recombinant human serum transferrin (residues 1 to 337) has been crystallized in a form suitable for high-resolution three-dimensional X-ray crystallographic analyses. Crystals are of the orthorhombic space group P2(1)2(1)2(1), with unit cell dimensions of a = 44.9 A, b = 57.0 A and c = 135.9 A, and diffract to beyond 2 A resolution. Further studies show that isomorphous crystals of specifically designed mutants of this protein can also be grown. Structural studies of both recombinant and mutant protein forms will provide a basis for understanding the mechanism by which human serum transferrin functions.

Crystallization↗

PubMed1992

Cellular and molecular advances in elucidating p53 function.

The finding that in many human tumors there is allelic loss and/or mutations in p53, in combination with recognition that these events may play a role in multi-stage carcinogenesis, has focused considerable interest on this gene. To help keep abreast of this rapidly expanding field, recent experiments on the role and potential regulation of p53 are described: these include discussions of p53 as an anti-proliferative agent, the p53 mutations found in human tumors and tumor cell lines, the conformational states of p53, phosphorylation of p53 by p34cdc2, and signals for the nuclear localization of p53. p53 may act as a transcriptional activator and the specific DNA sequences to which p53 protein binds are also discussed as is the importance of abrogation of p53 function in overcoming cellular senescence.

Base Sequence↗

PubMed1992

A transcriptionally active DNA-binding site for human p53 protein complexes.

Recent studies have demonstrated transcriptional activation domains within the tumor suppressor protein p53, while others have described specific DNA-binding sites for p53, implying that the protein may act as a transcriptional regulatory factor. We have used a reiterative selection procedure (CASTing: cyclic amplification and selection of targets) to identify new specific binding sites for p53, using nuclear extracts from normal human fibroblasts as the source of p53 protein. The preferred consensus is the palindrome GGACATGCCCGGGCATGTCC. In vitro-translated p53 binds to this sequence only when mixed with nuclear extracts, suggesting that p53 may bind DNA after posttranslational modification or as a complex with other protein partners. When placed upstream of a reporter construct, this sequence promotes p53-dependent transcription in transient transfection assays.

Base Sequence↗

PubMed1991

Expression and initial characterization of five site-directed mutants of the N-terminal half-molecule of human transferrin.

Five site-directed mutants of the N-terminal half-molecule of human serum transferrin have been expressed in baby hamster kidney cells and purified to homogeneity. Expression levels and overall yields varied considerably from the wild-type protein, depending on the mutant in question. The mutants are D63S, D63C, G65R, K206Q, and H207E and are based on mutations observed in a variety of transferrins of known sequence. Their molecular masses, determined by electrospray mass spectrometry, agree with theory, except for the D63C mutant, which appears to be cysteinylated. All mutants bind iron but with varying affinities; qualitatively, in increasing order D63S approximately D63C approximately G65R much less than wild type less than or equal to H207E much less than K206Q. In general, reduction of formal negative charge within the binding cleft shifts the visible spectral maximum of the iron complex toward the blue and reduces the affinity for iron, and increasing the formal negative charge shifts the visible maximum toward the red and increases the affinity for iron. The K206Q mutant is exceptional inasmuch as its visible maximum shows a blue shift, but its affinity for iron is the greatest of all of the mutants studied. All mutants reported, in addition to the wild-type protein, exhibit very similar visible molar extinction coefficients for the iron complex and very similar changes in extinction coefficients at 240 nm on binding Fe(III) or Ga(III). These results suggest that in all cases the bound metal ion is coordinated by two tyrosyl side chains.

Amino Acid Sequence↗

PubMed1991

The nucleotide sequence of rabbit liver transferrin cDNA.

The cDNA sequence of rabbit liver transferrin has been determined. The largest cDNA was 2279 base pairs (bp) in size and encoded 694 amino acids consisting of a putative 19 amino acid signal peptide and 675 amino acids of plasma transferrin. The deduced amino acid sequence of rabbit liver transferrin shares 78.5% identity with human liver transferrin and 69.1% and 44.8% identity with porcine and Xenopus transferrins, respectively. At the amino acid level, vertebrate transferrins share 26.4% identity and 56.5% similarity. The most conserved regions correspond to the iron ligands and the anion binding region. Optimal alignment of transferrin sequences required the insertion of a number of gaps in the region corresponding to the N-lobe. In addition, the N-lobes of transferrins share less amino acid sequence similarity than the C-lobes.

Amino Acid Sequence↗

PubMed1991

Expression of cloned human lactoferrin in baby-hamster kidney cells.

Human lactoferrin was expressed from a cloned cDNA introduced into mammalian cells in tissue culture. Total RNA was extracted from human bone marrow, and lactoferrin cDNA was synthesized by primer-specific polymerase chain reaction after oligo(dT)-primed first-strand synthesis. The cDNA was sequenced to confirm its identity with previously published human lactoferrin sequences and cloned into the eukaryotic expression vector pNUT. Recombinant vector DNA containing the human lactoferrin sequence was introduced into baby-hamster kidney (BHK) cells in culture, and stable transfectants were produced by dominant marker selection. Human lactoferrin was expressed from the metallothionein promoter of pNUT by Zn2+ induction. The protein was secreted into the tissue-culture medium and was subsequently purified to homogeneity in a single step. Initial characterization suggests that the protein expressed by BHK cells is identical with native human lactoferrin.

Amino Acid Sequence↗