PubMed Health⌕ Search

Biomedical subjects

William F Loomis

Publications and source records attributed to William F Loomis.

At least 19 recordsLinked to original sources
PubMed2006

Genetic evidence that the acyl coenzyme A binding protein AcbA and the serine protease/ABC transporter TagA function together in Dictyostelium discoideum cell differentiation.

The acyl coenzyme A (CoA) binding protein AcbA is cleaved to form a peptide (SDF-2) that coordinates spore encapsulation during the morphogenesis of Dictyostelium discoideum fruiting bodies. We present genetic evidence that the misspecification of cell types seen in mutants of the serine protease/ABC transporter TagA results from the loss of normal interactions with AcbA. Developmental phenotypes resulting from aberrant expression of the TagA protease domain, such as the formation of supernumerary tips on aggregates and the production of excess prestalk cells, are suppressed by null mutations in the acbA gene. Phenotypes resulting from the deletion of tagA, such as overexpression of the prestalk gene ecmB and the misexpression of the prespore gene cotB in stalk cells, are also observed in acbA mutants. Moreover, tagA- mutants fail to produce SDF-2 during fruiting body morphogenesis but are able to do so if they are stimulated with exogenous SDF-2. These results indicate that the developmental program depends on TagA and AcbA working in concert with each other during cell type differentiation and suggest that TagA is required for normal SDF-2 signaling during spore encapsulation.

ATP-Binding Cassette Transporters↗
PubMed2006

GABA induces terminal differentiation of Dictyostelium through a GABAB receptor.

When prespore cells approach the top of the stalk in a Dictyostelium fruiting body, they rapidly encapsulate in response to the signalling peptide SDF-2. Glutamate decarboxylase, the product of the gadA gene, generates GABA from glutamate. gadA is expressed exclusively in prespore cells late in development. We have found that GABA induces the release of the precursor of SDF-2, AcbA, from prespore cells. GABA also induces exposure of the protease domain of TagC on the surface of prestalk cells where it can convert AcbA to SDF-2. The receptor for GABA in Dictyostelium, GrlE, is a seven-transmembrane G-protein-coupled receptor that is most similar to GABA(B) receptors. The signal transduction pathway from GABA/GrlE appears to be mediated by PI3 kinase and the PKB-related protein kinase PkbR1. Glutamate acts as a competitive inhibitor of GABA functions in Dictyostelium and is also able to inhibit induction of sporulation by SDF-2. The signal transduction pathway from SDF-2 is independent of the GABA/glutamate signal transduction pathway, but the two appear to converge to control release of AcbA and exposure of TagC protease. These results indicate that GABA is not only a neurotransmitter but also an ancient intercellular signal.

ATP-Binding Cassette Transporters↗
PubMed2006

Dictyostelium discoideum chemotaxis: threshold for directed motion.

The chemotactic response of Dictyostelium discoideum cells to stationary, linear gradients of cyclic adenosine 3',5'-monophosphate (cAMP) was studied using microfluidic devices. In shallow gradients of less than 10(-3) nM/microm, the cells showed no directional response and exhibited a constant basal motility. In steeper gradients, cells moved up the gradient on average. The chemotactic speed and the motility increased with increasing steepness up to a plateau at around 10(-1) nM/microm. In very steep gradients, above 10 nM/microm, the cells lost directionality and the motility returned to the sub-threshold level. In the regime of optimal response the difference in receptor occupancy at the front and back of the cell is estimated to be only about 100 molecules.

Animals↗
PubMed2006

Transcriptional regulation of post-aggregation genes in Dictyostelium by a feed-forward loop involving GBF and LagC.

Expression profiles of developmental genes in Dictyostelium were determined on microarrays during development of wild type cells and mutant cells lacking either the DNA binding protein GBF or the signaling protein LagC. We found that the mutant strains developed in suspension with added cAMP expressed the pulse-induced and early adenylyl cyclase (ACA)-dependent genes, but not the later ACA-dependent, post-aggregation genes. Since expression of lagC itself is dependent on GBF, expression of the post-aggregation genes might be controlled only by signaling from LagC. However, expression of lagC in a GBF-independent manner in a gbfA- null strain did not result in expression of the post-aggregation genes. Since GBF is necessary for accumulation of LagC and both the DNA binding protein and the LagC signal transduction pathway are necessary for expression of post-aggregation genes, GBF and LagC form a feed-forward loop. Such network architecture is a common motif in diverse organisms and can act as a filter for noisy inputs. Breaking the feed-forward loop by expressing lagC in a GBF-independent manner in a gbfA+ strain does not significantly affect the patterns of gene expression for cells developed in suspension with added cAMP, but results in a significant delay at the mound stage and asynchronous development on solid supports. This feed-forward loop can integrate temporal information with morphological signals to ensure that post-aggregation genes are only expressed after cell contacts have been made.

Adenylyl Cyclases↗
PubMed2006

cis-Acting site controlling bidirectional transcription at the growth-differentiation transition in Dictyostelium discoideum.

A pair of adjacent genes, impA and dia1, are divergently transcribed but expressed at different stages in the life cycle of Dictyostelium discoideum. The intervening 654-bp region carries cis-acting regions that are essential for transcription in both directions as well as repression of dia1 in growing cells. We have focused on a 112-bp region proximal to dia1 that is essential for bidirectional transcription. Analyses of a set of internal deletions showed that the sequence between positions 80 and 97 (TTTGAATTTTTTGAATTT) is critical and that bases outside this region are dispensable. Site-directed mutations within this critical region confirmed the importance of this sequence for transcription both to the right and to the left. However, insertions of either 6 or 24 Ts into the run of 6 Ts separating the repeated GAA sequence had little effect on the functioning of the site in either direction, suggesting that factors recognize the half-sites TTGAATT separately. Inversion of the bases between positions 80 and 97 greatly reduced expression in both directions, indicating that orientation is critical for expression of both the nearby impA gene and the distal dia1 gene, which is more than 500 bp away. Comparison of 38 mutant constructs with multiple random variations in the region indicated that transcription factors may bind to a range of related sequences and still retain function. All functional constructs directed transcription both leftward and rightward, while all nonfunctional constructs were impaired for transcription in both directions. It appears that the same transcription complex controls transcription of both impA and dia1.

Animals↗
PubMed2006

Retention and loss of amino acid biosynthetic pathways based on analysis of whole-genome sequences.

Plants and fungi can synthesize each of the 20 amino acids by using biosynthetic pathways inherited from their bacterial ancestors. However, the ability to synthesize nine amino acids (Phe, Trp, Ile, Leu, Val, Lys, His, Thr, and Met) was lost in a wide variety of eukaryotes that evolved the ability to feed on other organisms. Since the biosynthetic pathways and their respective enzymes are well characterized, orthologs can be recognized in whole genomes to understand when in evolution pathways were lost. The pattern of pathway loss and retention was analyzed in the complete genomes of three early-diverging protist parasites, the amoeba Dictyostelium, and six animals. The nine pathways were lost independently in animals, Dictyostelium, Leishmania, Plasmodium, and Cryptosporidium. Seven additional pathways appear to have been lost in one or another parasite, demonstrating that they are dispensable in a nutrition-rich environment. Our predictions of pathways retained and pathways lost based on computational analyses of whole genomes are validated by minimal-medium studies with mammals, fish, worms, and Dictyostelium. The apparent selective advantages of retaining biosynthetic capabilities for amino acids available in the diet are considered.

Amino Acids↗
PubMed2006

The Genome of Dictyostelium discoideum.

The Dictyostelium discoideum genome has been sequenced, assembled and annotated to a high degree of reliability. The parts-list of proteins and RNA encoded by the six chromosomes can now be accessed and analyzed. One of the initial surprises was the remarkably large number of genes that are shared with plants, animals, and fungi that must have been present in their common progenitor over a billion years ago. The genome encodes a total of about 10,300 proteins including protein families involved in cytoskeletal control, posttranslational protein modification, detoxification, secondary metabolism, cell adhesion, and signal transduction. The genome has a higher proportion of homopolymeric tracts and simple sequence repeats, such as [CAA]n, than most other genomes. Triplet repeats in translated regions produce the highest known proportion of polyglutamine tracts in any known proteome. Phylogenetic analyses based on complete proteomes confirm that the amoebozoa are a sister group to the animals and fungi, distinct from plants and early diverging species such as Leishmania, Plasmodium, or Giardia. The completed Dictyostelium sequence opens the door to large-scale functional exploration of its genome.

Animals↗
PubMed2006

The Dictyostelium genome.

The 34 Mb genome of Dictyostelium discoideum is carried on 6 chromosomes and has been fully sequenced by an international consortium. The sequence was assembled on the classical and physical maps that had been built up over the years and refined by HAPPY mapping. Annotation of the sequence predicted about 12,000 genes for proteins of at least 50 amino acids in length. The total number of amino acids encoded (the proteome) is more than double that in yeast and rivals that of metazoans. The genome sequence shows all the proteins available to Dictyostelium as well as definitively showing which domains have been lost since Dictyostelium diverged from the line leading to metazoans. Genomics opens the door to determining the expression patterns of all the genes during growth and development using microarrays. This approach has already uncovered a wealth of new markers for the stages of development and the various cell types. Transcription factors and their cis-regulatory sites that account for the surprising complexity of Dictyostelium development can be analyzed much more easily now that we have the complete sequence.

Animals↗
PubMed2005

Comparing the Dictyostelium and Entamoeba genomes reveals an ancient split in the Conosa lineage.

The Amoebozoa are a sister clade to the fungi and the animals, but are poorly sampled for completely sequenced genomes. The social amoeba Dictyostelium discoideum and amitochondriate pathogen Entamoeba histolytica are the first Amoebozoa with genomes completely sequenced. Both organisms are classified under the Conosa subphylum. To identify Amoebozoa-specific genomic elements, we compared these two genomes to each other and to other eukaryotic genomes. An expanded phylogenetic tree built from the complete predicted proteomes of 23 eukaryotes places the two amoebae in the same lineage, although the divergence is estimated to be greater than that between animals and fungi, and probably happened shortly after the Amoebozoa split from the opisthokont lineage. Most of the 1,500 orthologous gene families shared between the two amoebae are also shared with plant, animal, and fungal genomes. We found that only 42 gene families are distinct to the amoeba lineage; among these are a large number of proteins that contain repeats of the FNIP domain, and a putative transcription factor essential for proper cell type differentiation in D. discoideum. These Amoebozoa-specific genes may be useful in the design of novel diagnostics and therapies for amoebal pathologies.

Animals↗
PubMed2005

A collection of amino acid replacement matrices derived from clusters of orthologs.

Sequence divergence among orthologous proteins was characterized with 34 amino acid replacement matrices, sequence context analysis, and a phylogenetic tree. The model was trained on very large datasets of aligned protein sequences drawn from 15 organisms including protists, plants, Dictyostelium, fungi, and animals. Comparative tests with models currently used in phylogeny, i.e., with JTT+gamma+/-F and WAG+gamma+/-F, made on a test dataset of 380 multiple alignments containing protein sequences from all five of the major taxonomic groups mentioned, indicate that our model should be preferred over the JTT+gamma+/-F and WAG+gamma+/-F models on datasets similar to the test dataset. The strong performance of our model of orthologous protein sequence divergence can be attributed to its ability to better approximate amino acid equilibrium frequencies to compositions found in alignment columns.

Amino Acid Substitution↗
PubMed2005

Peptide signaling during terminal differentiation of Dictyostelium.

A wide variety of mechanisms have evolved for intercellular communication in metazoans, but some of the signaling molecules were already used in their predecessors. The social amoeba, Dictyostelium discoideum, is known to use peptides to trigger sporulation within fruiting bodies, but their sequences have not been defined. We found that the peptide signal spore differentiation factor 2 (SDF-2) is processed from acyl-CoA binding protein, AcbA. The mammalian homolog of AcbA is processed to diazepam binding inhibitor that binds to the GABA(A) receptor in the brain and to peripheral 1,4 benzodiazepine receptors. Although Dictyostelium has neither GABA(A) nor peripheral-type benzodiazepine receptors, we find that both a diazepam binding inhibitor peptide and diazepam (Valium) can mimic SDF-2 in a Dictyostelium bioassay. Mutants lacking AcbA sporulate well only when developed in chimeras with WT cells. Using a yeast system we show that ligand binding to the SDF-2 receptor histidine kinase, DhkA, inhibits phosphorelay, which can account for its ability to induce rapid sporulation.

Amino Acid Sequence↗
PubMed2005

Intracellular role of adenylyl cyclase in regulation of lateral pseudopod formation during Dictyostelium chemotaxis.

Cyclic AMP (cAMP) functions as the extracellular chemoattractant in the aggregation phase of Dictyostelium development. There is some question, however, concerning what role, if any, it plays intracellularly in motility and chemotaxis. To test for such a role, the behavior of null mutants of acaA, the adenylyl cyclase gene that encodes the enzyme responsible for cAMP synthesis during aggregation, was analyzed in buffer and in response to experimentally generated spatial and temporal gradients of extracellular cAMP. acaA- cells were defective in suppressing lateral pseudopods in response to a spatial gradient of cAMP and to an increasing temporal gradient of cAMP. acaA- cells were incapable of chemotaxis in natural waves of cAMP generated by majority control cells in mixed cultures. These results indicate that intracellular cAMP and, hence, adenylyl cyclase play an intracellular role in the chemotactic response. The behavioral defects of acaA- cells were surprisingly similar to those of cells of null mutants of regA, which encodes the intracellular phosphodiesterase that hydrolyzes cAMP and, hence, functions opposite adenylyl cyclase A (ACA). This result is consistent with the hypothesis that ACA and RegA are components of a receptor-regulated intracellular circuit that controls protein kinase A activity. In this model, the suppression of lateral pseudopods in the front of a natural wave depends on a complete circuit. Hence, deletion of any component of the circuit (i.e., RegA or ACA) would result in the same chemotactic defect.

3',5'-Cyclic-AMP Phosphodiesterases↗
PubMed2005

Transcriptional switch of the dia1 and impA promoter during the growth/differentiation transition.

When growth stops due to the depletion of nutrients, Dictyostelium cells rapidly turn off vegetative genes and start to express developmental genes. One of the early developmental genes, dia1, is adjacent to a vegetative gene, impA, on chromosome 4. An intergenic region of 654 bp separates the coding regions of these divergently transcribed genes. Constructs carrying the intergenic region expressed a reporter gene (green fluorescent protein gene) that replaced impA in growing cells and a reporter gene that replaced dia1 (DsRed) during development. Deletion of a 112-bp region proximal to the transcriptional start site of impA resulted in complete lack of expression of both reporter genes during growth or development. At the other end of the intergenic region there are two copies of a motif that is also found in the carA regulatory region. Removing one copy of this repeat reduced impA expression twofold. Removing the second copy had no further consequences. Removing the central portion of the intergenic region resulted in high levels of expression of dia1 in growing cells, indicating that this region contains a sequence involved in repression during the vegetative stage. Gel shift experiments showed that a nuclear protein present in growing cells recognizes the sequence GAAGTTCTAATTGATTGAAG found in this region. This DNA binding activity is lost within the first 4 h of development. Different nuclear proteins were found to recognize the repeated sequence proximal to dia1. One of these became prevalent after 4 h of development. Together these regulatory components at least partially account for this aspect of the growth-to-differentiation transition.

Animals↗
PubMed2005

Loss of SMEK, a novel, conserved protein, suppresses MEK1 null cell polarity, chemotaxis, and gene expression defects.

MEK/extracellular signal-regulated kinase (ERK) mitogen-activated protein kinase signaling is imperative for proper chemotaxis. Dictyostelium mek1(-) (MEK1 null) and erk1(-) cells exhibit severe defects in cell polarization and directional movement, but the molecules responsible for the mek1(-) and erk1(-) chemotaxis defects are unknown. Here, we describe a novel, evolutionarily conserved gene and protein (smkA and SMEK, respectively), whose loss partially suppresses the mek1(-) chemotaxis phenotypes. SMEK also has MEK1-independent functions: SMEK, but not MEK1, is required for proper cytokinesis during vegetative growth, timely exit from the mound stage during development, and myosin II assembly. SMEK localizes to the cell cortex through an EVH1 domain at its N terminus during vegetative growth. At the onset of development, SMEK translocates to the nucleus via a nuclear localization signal (NLS) at its C terminus. The importance of SMEK's nuclear localization is demonstrated by our findings that a mutant lacking the EVH1 domain complements SMEK deficiency, whereas a mutant lacking the NLS does not. Microarray analysis reveals that some genes are precociously expressed in mek1(-) and erk1(-) cells. The misexpression of some of these genes is suppressed in the smkA deletion. These data suggest that loss of MEK1/ERK1 signaling compromises gene expression and chemotaxis in a SMEK-dependent manner.

Amino Acid Sequence↗
PubMed2004

Periodic signaling controlled by an oscillatory circuit that includes protein kinases ERK2 and PKA.

Self-regulating systems often use robust oscillatory circuits. One such system controls the chemotactic signaling mechanism of Dictyostelium, where pulses of adenosine 3',5'-monophosphate (cAMP) are generated with a periodicity of 7 minutes. We have observed spontaneous oscillations in activation of the mitogen-activated protein (MAP) kinase ERK2 that occur in phase with peaks of cAMP, and we show that ERK2 modulates cAMP levels through the phosphodiesterase RegA. Computer modeling and simulations of the underlying circuit faithfully account for the ability of the cells to spontaneously generate periodic pulses during specific stages of development. Similar oscillatory processes may occur in cells of many different species.

3',5'-Cyclic-AMP Phosphodiesterases↗
PubMed2004

RasC plays a role in transduction of temporal gradient information in the cyclic-AMP wave of Dictyostelium discoideum.

To define the role that RasC plays in motility and chemotaxis, the behavior of a rasC null mutant, rasC-, in buffer and in response to the individual spatial, temporal, and concentration components of a natural cyclic AMP (cAMP) wave was analyzed by using computer-assisted two-dimensional and three-dimensional motion analysis systems. These quantitative studies revealed that rasC- cells translocate at the same velocity and exhibit chemotaxis up spatial gradients of cAMP with the same efficiency as control cells. However, rasC- cells exhibit defects in maintaining anterior-posterior polarity along the substratum and a single anterior pseudopod when translocating in buffer in the absence of an attractant. rasC- cells also exhibit defects in their responses to both the increasing and decreasing temporal gradients of cAMP in the front and the back of a wave. These defects result in the inability of rasC- cells to exhibit chemotaxis in a natural wave of cAMP. The inability to respond normally to temporal gradients of cAMP results in defects in the organization of the cytoskeleton, most notably in the failure of both F actin and myosin II to exit the cortex in response to the decreasing temporal gradient of cAMP in the back of the wave. While the behavioral defect in the front of the wave is similar to that of the myoA-/myoF- myosin I double mutant, the behavioral and cytoskeletal defects in the back of the wave are similar to those of the S13A myosin II regulatory light-chain phosphorylation mutant. Expression array data support the premise that the behavioral defects exhibited by the rasC- mutant are the immediate result of the absence of RasC function.

Animals↗
PubMed2004

Control of cell type proportioning in Dictyostelium discoideum by differentiation-inducing factor as determined by in situ hybridization.

We have determined the proportions of the prespore and prestalk regions in Dictyostelium discoideum slugs by in situ hybridization with a large number of prespore- and prestalk-specific genes. Microarrays were used to discover genes expressed in a cell type-specific manner. Fifty-four prespore-specific genes were verified by in situ hybridization, including 18 that had been previously shown to be cell type specific. The 36 new genes more than doubles the number of available prespore markers. At the slug stage, the prespore genes hybridized to cells uniformly in the posterior 80% of wild-type slugs but hybridized to the posterior 90% of slugs lacking the secreted alkylphenone differentiation-inducing factor 1 (DIF-1). There was a compensatory twofold decrease in prestalk cells in DIF-less slugs. Removal of prespore cells resulted in cell type conversion in both wild-type and DIF-less anterior fragments. Thus, DIF-1 appears to act in concert with other processes to establish cell type proportions.

Animals↗