Biomedical subjects

Xiu-Qing Li

Publications and source records attributed to Xiu-Qing Li.

6 recordsLinked to original sources

PubMed2006

Towards positional cloning in Brassica napus: generation and analysis of doubled haploid B. rapa possessing the B. napus pol CMS and Rfp nuclear restorer gene.

The Polima (pol) system of cytoplasmic male sterility (CMS) and its fertility restorer gene Rfp are used in hybrid rapeseed production in Brassica napus. To facilitate map-based cloning of the Rfp gene, we have successfully transferred the pol cytoplasm and Rfp from the amphidiploid B. napus to the diploid species B. rapa and generated a doubled haploid pol cytoplasm B. rapa population that segregates for the Rfp gene. This was achieved through interspecific crosses, in vitro rescue of hybrid embryos, backcrosses, and microspore culture. Male fertility conditioned by Rfp was shown to co-segregate in this population with Rfp-specific mitochondrial transcript modifications and with DNA markers previously shown to be linked to Rfp in B. napus. The selfed-progeny of one doubled haploid plant were confirmed to be characteristic B. rapa diploids by cytogenetic analysis. Clones recovered from a genomic library derived from this plant line using the RFLP probe cRF1 fell into several distinct physical contigs, one of which contained Rfp-linked polymorphic restriction fragments detected by this probe. This indicates that chromosomal DNA segments anchored in the Rfp region can be recovered from this library and that the library may therefore prove to be a useful resource for the eventual isolation of the Rfp gene.

Brassica napus↗

PubMed2005

Inheritance and genetic mapping of tuber eye depth in cultivated diploid potatoes.

Tuber eye depth of the potato (Solanum tuberosum L.) is an important trait for the processing quality and appearance of potatoes. In the present study, we used a cultivated diploid potato family (12601) of 107 plants to dissect the mode of inheritance and to map the gene(s) controlling the trait. The family segregated for both eye depth (deep vs shallow) and tuber shape (round vs long) traits. The deep eye (Eyd) phenotype was found to be associated with round tubers (Ro) in most progeny clones. Further evaluation of this population with molecular markers including simple sequence repeats, amplified fragment length polymorphism, and sequence-characterized amplified regions revealed that the primary locus for eye depth is located on chromosome 10. This map location was confirmed by evaluating a second diploid family (12586). The results of this study led to the following conclusions: (1) there is a major locus controlling the eye depth trait; (2) deep eye (Eyd) is dominant to shallow (eyd); (3) the Eyd/eyd locus is located on chromosome 10; and (4) the Eyd/eyd locus is closely linked with the major locus for tuber shape (Ro/ro), at a distance of about 4 cM.

Agriculture↗

PubMed2005

Potato expressed sequence tag generation and analysis using standard and unique cDNA libraries.

To help develop an understanding of the genes that govern the developmental characteristics of the potato (Solanum tuberosum), as well as the genes associated with responses to specified pathogens and storage conditions, The Canadian Potato Genome Project (CPGP) carried out 5' end sequencing of regular, normalized and full-length cDNA libraries of the Shepody potato cultivar, generating over 66,600 expressed sequence tags (ESTs). Libraries sequenced represented tuber developmental stages, pathogen-challenged tubers, as well as leaf, floral developmental stages, suspension cultured cells and roots. All libraries analysed to date have contributed unique sequences, with the normalized libraries high on the list. In addition, a low molecular weight library has enhanced the 3' ends of our sequence assemblies. Using the combined assembly dataset, unique tuber developmental, cold storage and pathogen-challenged sequences have been identified. A comparison of the ESTs specific to the pathogen-challenged tuber and foliar libraries revealed minimal overlap between these libraries. Mixed assemblies using over 189,000 potato EST sequences from CPGP and The Institute for Genomics Research (TIGR) has revealed common sequences, as well as CPGP- and TIGR-unique sequences.

DNA, Complementary↗

PubMed2004

[Clinical analysis of 5 cases with acute intravascular hemolysis caused by puerarin].

OBJECTIVE: To explore the clinical characteristics of acute intravascular hemolysis caused by puerarin so as to help our prevention, diagnosis and treatment. METHODS: Analysis of 5 cases of acute intravascular hemolysis caused by puerarin was made and literature review conducted. RESULTS: All patients had the history of administering puerarin, with the pre-symptoms of acute hemolysis; the clinical characteristics of acute intravascular hemolysis were observed:sudden attacks of lumber and abdominal pain, chill, fever dyspnea, temporary conciousness loss, dark urine or hematuria, low hemoglobin, high reticular red blood cell, positive of Coombs' test. CONCLUSION: When sudden attacks of the above symptoms appear, the acute intravascular hemolysis should be taken into consideration first and the giving of the puerarin intravenously be immediately stopped Active and proper treatment should be made.

Adult↗

PubMed2003

The cryptic enhancer elements of the tCUP promoter.

Examination of the tCUP cryptic promoter from tobacco demonstrates that cryptic gene regulatory elements in the plant genome are functionally equivalent to elements responsible for the expression of plant genes. They are also organized in a similar fashion. Analysis of the expression pattern of the GUS reporter gene in transgenic Arabidopsis plants revealed that all of the information needed for strong constitutive expression was located in the truncated, -394tCUP promoter fragment. A series of 5' deletion and linker-scan mutagenesis constructs identified two separate enhancer elements. A long AT-rich region was identified between positions -350 and -161 bp relative to the transcription start site. 5' deletions that removed this A/T-rich fragment resulted in a significant decrease in promoter activity; whereas, oligomerization enhanced activity. A 21 bp sequence (TAGCCCCAATTTCAAATTCAA) spanning nucleotides -150 to -130 relative to transcription start site was also identified in a similar fashion and defined a novel cryptic constitutive enhancer element (Cce). Electrophoretic mobility-shift assays showed that tobacco nuclear proteins that interacted strongly with the tCUP promoter bound specifically to the 21-bp Cce element, suggesting that this sequence is probably a binding site(s) for transcription factors. The Cce element was dependent on the AT-rich element for activity indicating combinatorial control. The combined effects of the A/T rich and Cce elements appear to be responsible for the constitutive transcriptional activity of the tCUP promoter.

AT Rich Sequence↗

PubMed2003

Gene expression activity and pathway selection for sucrose metabolism in developing storage root of sweet potato.

Development of sweet potato (Ipomoea batatas) storage root coincides with starch accumulation made using cleaved products of imported photoassimilate sucrose. The genes and pathways are predominantly active for sucrose metabolism in developing storage root were unknown. In this study, we used both an expressed sequence tag (EST) approach and a reverse transcription-polymerase chain reaction (RT-PCR) approach to answer this question. Sucrose synthase (SuSy) was found to be significantly more frequent in storage root ESTs than in fibrous root ESTs. SuSy was the most abundant carbohydrate-metabolism gene in the storage-root ESTs. RT-PCR results confirmed this by showing that invertase was active in fibrous roots but rapidly decreased to an undetectable level during storage root development while SuSy became predominant. Invertase expression was also detectable in young immature storage root and shoot tips, suggesting an involvement in cell formation. SuSy expression pattern showed considerable similarity to that of ADP-glucose pyrophosphorylase, an essential enzyme for starch synthesis. The results indicated that (i). SuSy was the most actively expressed enzyme in sucrose metabolism in developing storage root and was correlated with sink strength, and (ii). whereas invertase was active at cell formation stages, SuSy pathway was predominant for sucrose cleavage related to starch-accumulation.

Base Sequence↗