PubMed Health⌕ Search

Biomedical subjects

Yaw-Don Hsu

Publications and source records attributed to Yaw-Don Hsu.

12 recordsLinked to original sources
PubMed2007

Increased risk of cerebral hemorrhage in Chinese male heavy drinkers with mild liver disorder.

BACKGROUND: Epidemiological evidence suggests that heavy alcohol consumption increases the risk for either stroke or liver disease. The goal of this study was to determine whether heavy drinkers with mild liver disorder (MLD) are at risk of hemorrhagic stroke. METHODS: All of the 524 patients recruited were males with a first-ever acute stroke and were consecutively admitted to the Tri-Service General Hospital between January 2000 and December 2001. The risk factors, liver function, stroke subtypes, and hemostatic factors were assessed among 68 patients defined as heavy drinker stroke (HDS) and 456 patients as non-heavy drinker stroke (NHDS). RESULTS: HDS patients had a significantly higher incidence of hemorrhagic stroke than NHDS patients. HDS patients were also associated with significantly higher occurrence of cigarette smoking, hyperuricemia, liver dysfunction, and significantly lower platelet counts. HDS patients with MLD were more likely to have hemorrhagic stroke (76.5%) than HDS patients without MLD (33.3%) and NHDS patients with (40.3%) or without (26.7%) MLD. HDS patients with MLD also exhibited a significantly higher glutamic oxaloacetic transaminase/glutamic pyruvic transaminase ratio (2.0 +/- 1.2) and lower platelet number (185,000 +/- 85,000 per microl) when compared with HDS patients without MLD (1.4 +/- 0.5; 206,000 +/- 59,000 per microl) and NHDS patients with (1.1 +/- 1.0; 256,000 +/- 97,000 per microl) or without (1.4 +/- 0.7; 216,000 +/- 68,000 per microl) MLD. CONCLUSIONS: HDS patients with MLD are at higher risk for hemorrhagic stroke in part due to the changes in hemostatic factors, although other factors may also contribute to hemorrhagic stroke.

Acute Disease↗
PubMed2007

Laryngeal reinnervation by ansa cervicalis nerve implantation for unilateral vocal cord paralysis in humans.

BACKGROUND: Ansa cervicalis (AC)-recurrent laryngeal nerve anastomosis (RLN) is usually not desirable for correction of paralytic dysphonia when it is difficult to find a viable distal stump of the recurrent laryngeal nerve. Nerve implantation of the thyroarytenoid muscle with the ansa cervicalis is a simple alternative method. STUDY DESIGN: Ten patients with unilateral vocal cord paralysis were prospectively designed to receive nerve implantation. A minimum period of 12 months after onset of paralysis was allowed to elapse to permit possible spontaneous reinnervation or compensation. Patients were followed long enough (at least 2 years) to determine if the procedure was successful. All patients were subjected to preoperative and postoperative voice recording, acoustic analysis, and videolaryngoscopy. Some of them underwent laryngeal electromyography. RESULTS: Ten patients underwent nerve implantation of the thyroarytenoid muscles by using the ansa cervicalis, and 8 of 10 (80%) had improved phonatory quality. Laryngeal electromyography showed that the procedure produced satisfactory reinnervation of the thyroarytenoid muscle. CONCLUSIONS: Nerve implantation of the thyroarytenoid muscle by the anso cervicalis is a simple and efficient alternative to nerve transfer if dense scarring at the cricothyroid articulation and lack of a viable distal stump of the recurrent laryngeal nerve preclude the procedure of nerve transfer. But careful selection of the appropriate candidate seems to be the earliest prerequisite for a successful procedure.

Adolescent↗
PubMed2005

Nitric oxide induces prion protein via MEK and p38 MAPK signaling.

The prion diseases or transmissible spongiform encephalopathy, such as human Creutzfeldt-Jakob disease (CJD) and so-called mad cow disease, are attributed to the causative agent, the scrapie variant of prion protein (PrP(Sc)) which causes fatal neurodegeneration. To investigate if stresses such as nitric oxide (NO) induced the cellular isoform of prion protein (PrP(C)), lipopolysaccharide, and sodium nitroprusside were used to treat N2a and NT2 cells, which resulted in elevated levels of the PRNP mRNA and prion protein. The signaling pathway for the NO-induced PrP(C) production involved guanylyl cyclase, MEK, and p38 MAPK as shown by the effect of specific pharmacological inhibitors ODQ, PD98059, and SB203580, respectively. Knowing the PrP induction by the biologically existing stimulus, this study provides useful information about the possible cellular mechanism and strategies for the treatment of CJD.

Animals↗
PubMed2005

Skeletal muscle dihydropyridine-sensitive calcium channel (CACNA1S) gene mutations in chinese patients with hypokalemic periodic paralysis.

BACKGROUND: Thyrotoxic periodic paralysis (TPP), familial periodic paralysis (FPP), and sporadic periodic paralysis (SPP) are common causes of hypokalemic periodic paralysis and have similar clinical presentations, thus possibly sharing the identical mutations. METHODS: We analyzed the role of the three known CACNA1S gene mutations (R528H, R1239H, and R1239G) in Chinese patients, including two FPP families, 36 TPP patients, 12 SPP patients, and their relatives. Fifty unrelated healthy subjects were also studied. Genomic DNA was prepared from the peripheral blood of all patients, their family members, and healthy subjects. Mutations of the CACNA1S gene were screened using polymerase chain reaction-based restriction analysis. RESULTS: Two FPP families had the R528H point mutation, but with incomplete penetrance occurring more commonly in men than in women. Only one SPP patient had a de novo mutation (R528H). None of the TPP patients had mutations in the three hot spots. CONCLUSION: Patients with FPP have R528H mutations in the CACNA1S gene. Only a few patients with SPP may share similar mutations with FPP. TPP patients do not carry any of the three known gene mutations.

Adult↗
PubMed2004

Valproate pretreatment protects dopaminergic neurons from LPS-induced neurotoxicity in rat primary midbrain cultures: role of microglia.

Parkinson's disease is a neurodegenerative disorder characterized by progressive degeneration of dopaminergic (DA) neurons in the substantia nigra. Accumulating evidence supports the notion that neuroinflammation is involved in the pathogenesis of this disease. Valproate (VPA) has long been used for the treatment of seizures and bipolar mood disorder. In vivo and in vitro studies have demonstrated that VPA has neuroprotective and neurotrophic actions. In this study, using primary neuron-glia cultures from rat midbrain, we demonstrated that VPA is a potent neuroprotective agent against lipopolysaccharide (LPS)-induced neurotoxicity. Results showed that pretreatment with 0.6 mM VPA for 48 h robustly attenuated LPS-induced degeneration of dopaminergic neurons as determined by [(3)H] dopamine uptake and counting of the number of TH-ir neurons. The neuroprotective effect of VPA was concentration-dependent and was mediated, at least in part, through a decrease in levels of pro-inflammatory factors released from activated microglia. Specifically, LPS-induced increase in the release of TNFa, NO, and intracellular reactive oxygen species was markedly reduced in cultures pretreated with VPA. These anti-inflammatory effects of VPA were time and concentration-dependent correlated with a decrease in the number of microglia. Thus, our results demonstrate that protracted VPA pretreatment protects dopaminergic neurons from LPS-induced neurotoxicity through a reduction in levels of released pro-inflammatory factors, and further suggest that these anti-inflammatory effects may be contributed by VPA-induced reduction of microglia cell number. Taken together, our study reinforces the view that VPA may have utility in treating Parkinson's disease.

Analysis of Variance↗
PubMed2004

Generalized chorea associated with bilateral chronic subdural hematoma.

A variety of acquired disorders cause chorea, such as hypoxia-ischemia injury, drugs, toxins, infections, autoimmune disorders, and endocrine and electrolyte abnormalities, but rarely subdural hematoma. We report the case of a 76-year-old woman who presented with sudden onset of generalized choreiform movements 1 day prior to admission. Computed tomography revealed a bilateral lateral convexity subdural effusion, which was later confirmed by magnetic resonance imaging as a chronic subdural hematoma. After surgical evacuation of the subdural hematoma, the choreoathetoid movements ceased completely. We propose that transient ischemia in the bilateral subcortical regions was from compression and distortion of the brain by the bilateral hematomas and resulted in generalized chorea.

Aged↗
PubMed2004

Effects of potassium supplementation on the recovery of thyrotoxic periodic paralysis.

Potassium supplements have been recommended to hasten recovery and prevent cardiopulmonary complications in patients with thyrotoxic periodic paralysis (TPP). However, this recommendation has not yet been proven efficacious. Thirty-two patients with acute attacks of TPP over a 3-year-period were divided into 2 groups. Group A (n = 12) was a control group treated with normal saline infusion 125 mL/hr only. Group B (n = 20) received intravenous KCl administration at a rate of 10 mmol/hr in normal saline 125 mL/hr. During the attack and for 6 hours after muscle recovery, hemodynamics were continuously recorded and muscle strength and plasma K(+) concentration were measured hourly. The sex, age, muscle strength, thyroid function, biochemical values including plasma K(+) levels, as well as the time from attack to therapy (3.6 +/- 1.6 v 3.3 +/- 1.0 hr) were not significant between the 2 groups. However, recovery time was significantly shorter in the KCl group than the control (6.3 +/- 3.8 v 13.5 +/- 7.5 hr, P < .01). Rebound hyperkalemia greater than 5.5 mmol/L occurred in 40% patients receiving KCl. The dose of KCl administered and peak K(+) concentration were positively correlated (r = 0.85, P < .001). In conclusion, KCl therapy proves to help the recovery of paralysis in TPP associated with rebound hyperkalemia. KCl supplementation should be given as small as possible (<10 mmol/hr) to avoid rebound hyperkalemia unless there are cardiopulmonary complications.

Adult↗
PubMed2004

Muscular dystrophy: from pathogenesis to strategy.

Muscular dystrophies are a genetically heterogeneous group of degenerative muscle disorders. It characterized by progressive muscle wasting and weakness of variable distribution and severity. There are several subgroups including Duchenne/Becker, fascioscapulohumeral, limb-girdle, oculopharngeal, and congenital muscular dystrophy. Diagnosis is dependent to the characteristic clinical features in distribution of predominant muscle weakness, disease course and age onset as well as variable serum concentration creatine kinase, muscle histology, and genetic inheritance. Nearly 30 genes and encoded proteins are known to give rise to various forms of muscular dystrophy. Development of new prospects therapy for the muscular dystrophies is a big challenge. The target of strategies is aimed at inducing of a functional protein and improving the function of muscle weakness. These strategies include gene, cell and pharmacological therapies. However, efficiency of systemic delivery vectors to targets, immune reaction to vector and gene products, and toxicity to vector that must be solved before an effective treatment is available.

Animals↗
PubMed2004

Fibromuscular dysplasia of the vertebral artery presenting with lateral medullary syndrome: a case report.

We have recently encountered a rare case of fibromuscular dysplasia (FMD) of the vertebral artery (VA) presenting as lateral medullary syndrome. A 39-year-old male was admitted to our hospital due to vertigo, dysarthria and numbness of the left face and the right limbs. A magnetic resonance imaging (MRI) and magnetic resonance angiography (MRA) of brain revealed lateral medullary infarction in the territory of the left posterior inferior cerebellar artery (PICA). The angiography of the VA revealed tubular stenosis of the left extracranial VA and a focal vascular kinking as well as web in the right extracranial VA, confirming the diagnosis of FMD. We present this rare case to emphasize that FMD could be one of the risk factors causing lateral medullary syndrome in young people.

Adult↗
PubMed2002

Molecular modulation of expression of prion protein by heat shock.

Prion diseases (also known as transmissible spongiform encephalopathies) are associated with the conversion of the normal cellular form of the prion protein (PrPC) to an abnormal scrapie-isoform (PrP(Sc). The conversion of PrP(C) to PrP(Sc) is post-translational and is owing to protein conformational change. This has led to the hypothesis that molecular chaperones may be involved in the folding of prion proteins, and hence the disease process. By treating human NT-2 cells with heat-shock stress, we found that both the mRNA levels for prion protein (PrP) and heat shock protein 70 (HSP70) increased simultaneously after heat treatment. Western-blot analysis of PrP also showed a two-fold increase in PrP protein level 3 after heat treatment. Furthermore, two heat-shock elements (HSEs) were located at the positions of -680 bp (HSE1; GGAACTATTCTTGACATTGCT), and -1653 bp (HSE2; TGAGAACTCAGGAAG) of the rat PrP (RaPrP) gene promoter. Luciferase reporter constructs of the RaPrP promoter with HSE expressed higher luciferase activity (10- to 15-fold) than those constructs without HSE. Electrophoretic gel mobility shift assay (EMSA) and super-shift assay confirmed the interaction of HSE1 and HSE2 with the heat-shock transcription factor-1 (HSTF-1). These results suggest that cellular stress up-regulates both the transcription and translation of PrP through interaction with the HSEs on the PrP gene promoter, resulting in an increase in protein synthesis.

Animals↗
PubMed2002

Alcohol sensitivity in Taiwanese men with different alcohol and aldehyde dehydrogenase genotypes.

BACKGROUND AND PURPOSE: Previous studies demonstrated that ADH2*2, encoding for high-maximal velocity (Vmax) beta2-alcohol dehydrogenase (ADH) activity, and mutant ALDH2*2, encoding for null aldehyde dehydrogenase (ALDH) 2 activity, independently influence susceptibility to alcoholism. A single copy of the ALDH2*2 allele may protect less strongly than a single copy of ADH2*2 in individuals carrying only one copy of either ALDH2*2 or ADH2*2. Individuals with various ADH2 and ALDH2 gene status may exhibit different alcohol metabolism and alcohol sensitivity, which affects drinking behavior. To explore the underlying pharmacogenetic mechanism, alcohol metabolism and alcohol sensitivity were tested using ethanol challenge in Taiwanese men with different ADH2 and ALDH2 genotypes. METHODS: Twenty-four adults, matched by age, body mass index, nutritional state, and homozygosity at ADH3, were recruited from a population base of 304 men. Six individuals were chosen with each of the different ADH2 and ALDH2 genotypes: ADH2*1/*1, ALDH2*1/*1; ADH2*2/*2, ALDH2*1/*1; ADH2*1/*1, ALDH2*1/*2; and ADH2*2/*2, ALDH2*1/*2. After a low-to-moderate challenge with ethanol (0.3 g/kg), blood ethanol and acetaldehyde concentrations, heart rate, and facial capillary blood flow (FCBF) were measured for 130 minutes. RESULTS: All heterozygous ALDH2*2 individuals were found to be strongly responsive to low-to-moderate ethanol, as evidenced by pronounced increases in heart rate and FCBF. Conversely, there were no significant differences in alcohol metabolism and alcohol sensitivity between the ADH2*2 and ADH2*1 homozygotes with identical ALDH2 genotype. CONCLUSION: Individuals heterozygous for ALDH2*2 exhibit strong alcohol hypersensitivity caused by persistent accumulation of large amounts of acetaldehyde, but homozygosity for ADH2*2 is not dependent upon this pathway against alcoholism.

Adult↗