PubMed · 13744470
The source did not provide an abstract. Follow the original record for more information.
Explore connections, maps & timelines
R RUDNER. 1960. Mutation as an error in base pairing.. https://doi.org/10.1016/0006-291x(60)90239-4
Cite the original work for its findings. Save a collection to share your selection of sources.
KEEP EXPLORING
Insertion of completely complementary microRNA (miR) target sites (miRTS) into a transgene has been shown to be a valuable approach to specifically repress transgene expression in non-targeted tissues. miR-122TS have been successfully used to silence transgene expression in the liver following systemic application of cardiotropic adeno-associated virus (AAV) 9 vectors. For miR-206-mediated skeletal muscle-specific silencing of miR-206TS-bearing AAV9 vectors, however, we found this approach failed due to the expression of another member (miR-1) of the same miR family in heart tissue, the intended target. We introduced single-nucleotide substitutions into the miR-206TS and searched for those which prevented miR-1-mediated cardiac repression. Several mutated miR-206TS (m206TS), in particular m206TS-3G, were resistant to miR-1, but remained fully sensitive to miR-206. All these variants had mismatches in the seed region of the miR/m206TS duplex in common. Furthermore, we found that some m206TS, containing mismatches within the seed region or within the 3' portion of the miR-206, even enhanced the miR-206- mediated transgene repression. In vivo expression of m206TS-3G- and miR-122TS-containing transgene of systemically applied AAV9 vectors was strongly repressed in both skeletal muscle and the liver but remained high in the heart. Thus, site-directed mutagenesis of miRTS provides a new strategy to differentiate transgene de-targeting of related miRs.
A series of novel benzimidazoles were efficiently synthesized using both solution- and solid-phase chemistry. These compounds were found to bind to the bacterial 16S ribosomal RNA A-site with micromolar affinities using unique mass spectrometry-based assays.
Proton exchange and NMR spectroscopy have been used to define the effects of Mg2+ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson-Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg2+ ions. The results reveal that Mg2+ lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na+ counterions to the same helix containing Mg2+ counterions shows that these stabilizing effects result, in large part, from Mg2+ ions closely associated with the DNA. Moreover, the effects are site-specific and depend on the number and location of protonated cytosines relative to the observed base. These findings provide new insights into the molecular roles of C+*GC triads in determining the stability of DNA triple-helical structures.