PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “Mutation spectrum”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 181 records · Page 10Linked to original sources
PubMed2004

Branchio-oto-renal syndrome: the mutation spectrum in EYA1 and its phenotypic consequences.

EYA1 mutations cause branchio-oto-renal (BOR) syndrome. These mutations include single nucleotide transitions and transversions, small duplications and deletions, and complex genomic rearrangements. The last cannot be detected by coding sequence analysis of EYA1. We sought to refine the clinical diagnosis of BOR syndrome by analyzing phenotypic data from families segregating EYA1 disease-causing mutations. Based on genotype-phenotype analyses, we propose new criteria for the clinical diagnosis of BOR syndrome. We found that in approximately 40% of persons meeting our criteria, EYA1 mutations were identified. Of these mutations, 80% were coding sequence variants identified by SSCP, and 20% were complex genomic rearrangements identified by a semiquantitative PCR-based screen. We conclude that genetic testing of EYA1 should include analysis of the coding sequence and a screen for complex rearrangements.

Branchio-Oto-Renal Syndrome↗
PubMed2000

Elastin: mutational spectrum in supravalvular aortic stenosis.

Supravalvular aortic stenosis (SVAS) is a congenital narrowing of the ascending aorta which can occur sporadically, as an autosomal dominant condition, or as one component of Williams syndrome. SVAS is caused by translocations, gross deletions and point mutations that disrupt the elastin gene (ELN) on 7q11.23. Functional hemizygosity for elastin is known to be the cause of SVAS in patients with gross chromosomal abnormalities involving ELN. However, the pathogenic mechanisms of point mutations are less clear. One hundred patients with diagnosed SVAS and normal karyotypes were screened for mutations in the elastin gene to further elucidate the molecular pathology of the disorder. Mutations associated with the vascular disease were detected in 35 patients, and included nonsense, frameshift, translation initiation and splice site mutations. The four missense mutations identified are the first of this type to be associated with SVAS. Here we describe the spectrum of mutations occurring in familial and sporadic SVAS and attempt to define the mutational mechanisms involved in SVAS. SVAS shows variable penetrance within families but the progressive nature of the disorder in some cases, makes identification of the molecular lesions important for future preventative treatments.

Alternative Splicing↗
PubMed2002

Mutation spectrum in Australian pedigrees with hereditary hyperferritinaemia-cataract syndrome reveals novel and de novo mutations.

Hereditary hyperferritinaemia-cataract syndrome (HHCS) (OMIM #600886) is a rare autosomal dominant condition identified by high serum ferritin levels with normal iron saturation and distinctive bilateral cataract. It may be misdiagnosed as haemochromatosis and such patients become anaemic as a result of inappropriate venesection. The elevated serum ferritin is due to a mutation in the iron-responsive element (IRE) of the l-ferritin gene, resulting in excessive l-ferritin production. We report the identification of three Australian pedigrees; one with a previously described mutation at position 40, a pedigree with a novel mutation at position 39 and an individual with a de novo mutation at position 32 of the l-ferritin IRE.

Adult↗
PubMed1996

Mutation spectrum of p53 gene in highly malignant human osteosarcomas.

In this study, we analyzed the spectrum of p53 tumor suppressor gene mutations in 40 highly malignant osteosarcomas, one osteosarcoma metastasis, and one osteoblastoma with malignant transformation. Using predominantly formalin-fixed and paraffin-embedded material, we performed polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis of exons 4-8 and direct sequencing. Molecular genetic findings were correlated with immunohistochemical detection of p53 protein. A total of eight alterations (19%) were identified. Two splice mutations were detected in one case of a highly malignant osteosarcoma and its metastasis, and in one osteoblastoma with focal malignant transformation. Four of the mutations were missense mutations, one was of the silent type. These data correspond to the results found in the literature on bone and soft tissue tumors. Therefore, retrospective studies of p53 gene turn out to be quite appropriate for molecular biologic examinations.

Adolescent↗
PubMed1998

Reduced joining of DNA double strand breaks with an abnormal mutation spectrum in rodent mutants of DNA-PKcs and Ku80.

PURPOSE: To characterize further the contribution of the DNA-PK-dependent dsb repair pathway in mammalian cells. MATERIALS AND METHODS: The efficiency and fidelity of the joining of linear plasmids by DNA-PKcs-defective mouse cells (SCID) and Ku80-defective Chinese hamster ovary cells (xrs-6) was measured using either linear or circular replicating shuttle vector pZ189. RESULTS: The authors found a 3.9-10.7-fold reduced joining of the DNA ends, as compared with wild-type cells. Mutation analysis of the joining site revealed that the joining process was not hypermutable in the mutated cells. However, the SCID and xrs-6 cells produced a different spectrum of mutations at the joining site with a significantly lower proportion of insertions or more complex mutations. CONCLUSIONS: The remaining joining ability of the mutant cells points to an alternative DNA-PK-independent pathway of dsb repair. Comparison of these data with similar data from yeast suggest that the postulated alternative pathway of dsb repair is at least as efficient and less error-prone in rodent cells.

3T3 Cells↗
PubMed2000

Relation between food habits and p53 mutational spectrum in gastric cancer patients.

p53 tumour suppressor gene mutations were analysed in gastric cancer in relation to food habits and social class in 56 patients from a high risk region of Italy. Exons 5-8 were analysed with DGGE method on amplified DNA from formalin-fixed paraffin-embedded samples. All p53 mutations were observed in patients belonging to low social class and the majority of mutations were found in intestinal type cancers. A positive association was also found with low raw vegetables, fresh, dried and preserved fruits, and ascorbic acid intake. Moreover, specific types of mutations were significantly associated with particular factors, thus suggesting the presence of specific molecular etiologic process in stomach carcinogenesis.

Adult↗
PubMed2006

Novel BRCA1 and BRCA2 germline mutations and assessment of mutation spectrum and prevalence in Italian breast and/or ovarian cancer families.

Familial aggregations of breast/ovarian cancer cases frequently depend on BRCA1/2 pathogenic mutations. Here we counselled 120 Italian breast/ovarian cancer families and selected 73 probands for BRCA1/2 mutation screening. Through this analysis we defined the prevalence of BRCA1/2 pathogenic mutations occurring in Italian breast/ovarian cancer families, enlarged the spectrum of Italian BRCA1/2 mutations by 15% and report on the identification of 13 novel variants, including two deleterious truncating mutations and two potentially pathogenic missense mutations, on the BRCA1 and BRCA2 genes. Finally in hereditary breast cancer families with three or more female breast cancer cases we observed a low mutation prevalence and a significant association with BRCA2 mutations.

BRCA1 Protein↗
PubMed2007

Mutation spectrum in UVB-exposed skin epidermis of Xpa-knockout mice: frequent recovery of triplet mutations.

Knockout mutations in both alleles of the Xpa gene give rise to a complete deficiency in nucleotide excision repair (NER) in mammalian cells. We used transgenic mice harboring the lambda-phage-based lacZ mutational reporter gene to study the effect of Xpa null mutation (Xpa(-/-)) on damage induction, repair, and mutagenesis in mouse skin epidermis after UVB irradiation. UVB induced equal amounts of cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (64PPs) in mouse skin epidermis of Xpa(-/-) and wild-type mice. Neither photolesion was removed in the Xpa(-/-) epidermis by 12 hr after irradiation whereas removal of 64PPs was observed in the epidermis of wild-type mice. Irradiation with 200 and 300 J/m(2) UVB increased the lacZ mutant frequency in the epidermis of Xpa(-/-) mice, but the induced mutant frequencies were not significantly different from those previously determined for wild-type mice. One-hundred lacZ mutants isolated from the UVB-exposed epidermis of Xpa(-/-) mice were analyzed and compared with mutant sequences previously determined for irradiated wild-type mice. The distribution of the mutations along the lacZ transgene and the preferred dipyrimidine context of the UV-specific mutations were similar in mutants from the Xpa(-/-) and wild-type mice. The spectra of the mutations in the two genotypes were both highly UV-specific and similar in a dominance of C --> T transitions at dipyrimidine sites; however, Xpa(-/-) mice had a higher frequency than wild-type mice of two-base tandem substitutions, including CC --> TT mutations, three-base tandem mutations and double base substitutions that were separated by one unchanged base in a three-base sequence (alternating mutations). These tandem/alternating mutations included a remarkably large number of triplet mutations, a recently reported, novel type of UV-specific mutation, characterized by multiple base substitutions or frameshifts within a three-nucleotide sequence containing a dipyrimidine. We conclude that the triplet mutation is a UV-specific mutation that preferably occurs in NER-deficient genetic backgrounds.

Animals↗
PubMed2005

Spectrum of mutations in CFTR in Finland: 18 years follow-up study and identification of two novel mutations.

BACKGROUND: The incidence of cystic fibrosis (CF) is low in the isolated Finnish population and the Finnish CF mutation spectrum has differed from many European countries. METHODS: We have analyzed the mutation spectrum and the geographical distribution of CF mutations in Finland covering the last 18 years (1987-2004). RESULTS: A total of 14 mutations were identified; two of them new, 774insT and S589T (G>C at 1,898). The overall coverage of mutations was 97% (99/102 chromosomes). The most frequent mutations were F508del and 394delTT, found in 36% (37/102) and 35% (36/102) of the CF chromosomes respectively. Of the rare mutations, a mutation of presumable Slavic origin, CFTRdele2.3 (21 kb), was enriched in a rural isolate with a frequency of 5,9% (6/102), and a mutation that possibly indicates Swedish influence, 3659delC, was scattered throughout the country with a similar frequency of 5,9% (6/102). G542X, R1162X, R117H, 3732delA, 1,898 + 3A >C, S1196X, S945L, W57R, 774insT and S589T were each identified in a number of chromosomes from one to three. CONCLUSIONS: Our observations of the Finnish CF mutation spectrum fit well with the characteristics of Finland as a population of multiple local founder effects.

Cystic Fibrosis↗
PubMedDate not supplied

The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: causes and consequences.

A total of 101 different examples of point mutations, which lie in the vicinity of mRNA splice junctions, and which have been held to be responsible for a human genetic disease by altering the accuracy of efficiency of mRNA splicing, have been collated. These data comprise 62 mutations at 5' splice sites, 26 at 3' splice sites and 13 that result in the creation of novel splice sites. It is estimated that up to 15% of all point mutations causing human genetic disease result in an mRNA splicing defect. Of the 5' splice site mutations, 60% involved the invariant GT dinucleotide; mutations were found to be non-randomly distributed with an excess over expectation at positions +1 and +2, and apparent deficiencies at positions -1 and -2. Of the 3' splice site mutations, 87% involved the invariant AG dinucleotide; an excess of mutations over expectation was noted at position -2. This non-randomness of mutation reflects the evolutionary conservation apparent in splice site consensus sequences drawn up previously from primate genes, and is most probably attributable to detection bias resulting from the differing phenotypic severity of specific lesions. The spectrum of point mutations was also drastically skewed: purines were significantly over-represented as substituting nucleotides, perhaps because of steric hindrance (e.g. in U1 snRNA binding at 5' splice sites). Furthermore, splice sites affected by point mutations resulting in human genetic disease were markedly different from the splice site consensus sequences. When similarity was quantified by a 'consensus value', both extremely low and extremely high values were notably absent from the wild-type sequences of the mutated splice sites. Splice sites of intermediate similarity to the consensus sequence may thus be more prone to the deleterious effects of mutation. Regarding the phenotypic effects of mutations on mRNA splicing, exon skipping occurred more frequently than cryptic splice site usage. Evidence is presented that indicates that, at least for 5' splice site mutations, cryptic splice site usage is favoured under conditions where (1) a number of such sites are present in the immediate vicinity and (2) these sites exhibit sufficient homology to the splice site consensus sequence for them to be able to compete successfully with the mutated splice site. The novel concept of a "potential for cryptic splice site usage" value was introduced in order to quantify these characteristics, and to predict the relative proportion of exon skipping vs cryptic splice site utilization consequent to the introduction of a mutation at a normal splice site.

Consensus Sequence↗
PubMed1996

Mutation spectrum in patients with Wiskott-Aldrich syndrome and X-linked thrombocytopenia: identification of twelve different mutations in the WASP gene.

Twelve different mutations in the WASP gene were found in twelve unrelated families with Wiskott-Aldrich syndrome (WAS) or X-linked thrombocytopenia (XLT). Four frameshift, one splice, one nonsense mutation, and one 18-base-pair deletion were detected in seven patients with WAS. Only missense mutations were found in five patients diagnosed as having XLT. One of the nucleotide substitutions in exon 2 (codon 86) results in an Arg to Cys replacement. Two other nucleotide substitutions in this codon, R86L and R86H, have been reported previously, both giving rise to typical WAS symptoms, indicating a mutational hot spot in this codon. The finding of mutations in the WASP gene in both WAS and XLT gives further evidence of these syndromes being allelic. The relatively small size of the WASP gene facilitates the detection of mutations and a reliable diagnosis of both carriers and affected fetuses in families with WAS or XLT.

Base Sequence↗
PubMed2003

Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations.

Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found three gene deletions. When the 20 mutations were depicted in a 3-dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease.

Adolescent↗
PubMed2006

Mutational spectrum of classical galactosaemia in Spain and Portugal.

Classical galactosaemia is an autosomal recessive inherited metabolic disorder due to deficient galactose-1-phosphate uridyltransferase (GALT). Over 180 different base changes and disease-causing mutations have been reported in the GALT gene. Mutation p.Q188R was found to be the most common molecular defect among caucasian classical galactosaemia patients. We have characterized the spectrum of GALT mutations in a group of 51 Spanish families and 32 Portuguese families with this disease. p.Q188R is also the most prevalent mutation in the Spanish and Portuguese population, accounting for 50% and 57.8% of galactosaemic alleles, respectively. An additional 15 mutations were also identified in Spanish patients, four of which were novel: p.D28H, p.S181A, c.658dupG and c.377+53_1059+87del. In the Portuguese population, 11 different mutations were found, three of which were novel: p.R33H, p.P185S, and p.S192G. The differences observed between the genotypes identified in Portuguese and Spanish galactosaemic populations are notable. Only mutations p.Q188R, p.R148Q and c.820+13g>a were identified in both populations. In spite of the geographical proximity of Spain and Portugal, it seems that they have received genetic influences from different populations. The repeated migrations that occurred in the Iberian Peninsula throughout centuries may explain such variability.

Alleles↗
PubMed2005

The TP53 mutational spectrum and frequency of CHEK2*1100delC in Li-Fraumeni-like kindreds.

Li-Fraumeni syndrome (LFS) is a dominantly inherited cancer predisposition syndrome characterized by a wide spectrum of neoplasms occurring at young age. Germline mutations in the TP53 tumor suppressor gene have been identified in approximately 71 of LFS patients and 22 of Li-Fraumeni-like (LFL) patients. Mutations within the cell cycle checkpoint gene CHEK2 have also been reported in some patients with LFS, LFL, and phenotypically suggestive of LFS (PS-LFS) not carrying a TP53 mutation. In this study, we show that 7 of the 23 patients with LFS/LFL tested positive for deleterious mutations in p53. Fifteen of the remaining sixteen were not found to carry the CHEK2* 1100delCmutation. These results indicate that CHEK2*1100delC is not a common cause of LFS, LFL, or PS-LFS in North American kindreds not carrying a TP53 mutation. Of note, two patients were found to carry p53* R72P, which is of unknown clinical significance. Lack of segregation of this allele in one of these kindreds provides strong evidence that the R72P allele is not disease-causing. While mutations in p53 account for a proportion of patients with LFS/LFL, future studies are needed to determine if other genes are responsible for LFS/LFL families not carrying germline p53 mutations.

Adolescent↗
PubMed1998

Mutation spectrum and genotype-phenotype analyses in Cowden disease and Bannayan-Zonana syndrome, two hamartoma syndromes with germline PTEN mutation.

The tumour suppressor gene PTEN , which maps to 10q23.3 and encodes a 403 amino acid dual specificity phosphatase (protein tyrosine phosphatase; PTPase), was shown recently to play a broad role in human malignancy. Somatic PTEN deletions and mutations were observed in sporadic breast, brain, prostate and kidney cancer cell lines and in several primary tumours such as endometrial carcinomas, malignant melanoma and thyroid tumours. In addition, PTEN was identified as the susceptibility gene for two hamartoma syndromes: Cowden disease (CD; MIM 158350) and Bannayan-Zonana (BZS) or Ruvalcaba-Riley-Smith syndrome (MIM 153480). Constitutive DNA from 37 CD families and seven BZS families was screened for germline PTEN mutations. PTEN mutations were identified in 30 of 37 (81%) CD families, including missense and nonsense point mutations, deletions, insertions, a deletion/insertion and splice site mutations. These mutations were scattered over the entire length of PTEN , with the exception of the first, fourth and last exons. A 'hot spot' for PTEN mutation in CD was identified in exon 5 that contains the PTPase core motif, with 13 of 30 (43%) CD mutations identified in this exon. Seven of 30 (23%) were within the core motif, the majority (five of seven) of which were missense mutations, possibly pointing to the functional significance of this region. Germline PTEN mutations were identified in four of seven (57%) BZS families studied. Interestingly, none of these mutations was observed in the PTPase core motif. It is also worthy of note that a single nonsense point mutation, R233X, was observed in the germline DNA from two unrelated CD families and one BZS family. Genotype-phenotype studies were not performed on this small group of BZS families. However, genotype-phenotype analysis inthe group of CD families revealed two possible associations worthy of follow-up in independent analyses. The first was an association noted in the group of CD families with breast disease. A correlation was observed between the presence/absence of a PTEN mutation and the type of breast involvement (unaffected versus benign versus malignant). Specifically and more directly, an association was also observed between the presence of a PTEN mutation and malignant breast disease. Secondly, there appeared to be an interdependent association between mutations upstream and within the PTPase core motif, the core motif containing the majority of missense mutations, and the involvement of all major organ systems (central nervous system, thyroid, breast, skin and gastrointestinal tract). However, these observations would need to be confirmed by studying a larger number of CD families.

Chromosome Mapping↗
PubMed2001

Structure of human holocarboxylase synthetase gene and mutation spectrum of holocarboxylase synthetase deficiency.

Holocarboxylase synthetase (HLCS) is an enzyme that catalyzes the incorporation of biotin into apo-carboxylases, and its deficiency causes biotin-responsive multiple carboxylase deficiency. The reported sequences of cDNA for human HLCS from liver, lymphocyte, and KG-1 myeloid cell lines differ at their 5' regions. To elucidate variations of the human HLCS mRNA and longer 5' cDNA ends, we performed screening of the human liver cDNA library and rapid amplification of the cDNA ends (RACE). Our results suggest the existence of three types of HLCS mRNA that start at different exons. The first type starts at exon 1, and the second type starts at exon 3, and both are found in various human tissues. The third type, corresponding to the cDNA from the KG-1 cell, starts at exon 2 of the HLCS gene. Various splicing patterns from exons 3-6 were also observed. None of the variations of cDNA found created a new initiation codon. Mutation screening from exons 6-14, therefore, was sufficient to detect amino acid changes in HLCS in patients. Our direct sequencing strategy for screening mutations in the HLCS gene revealed mutations in five Japanese patients and seven non-Japanese patients. Our analyses involving 12 Japanese and 13 non-Japanese patients and studies by others indicate that (1) there is no panethnically prevalent mutation; (2) the Arg508Trp, Gly581Ser, and Val550Met mutations are found in both Japanese and non-Japanese populations; (3) the IVS10+5G-->A mutation is predominant and probably a founder mutation in European patients; (4) the 655-656insA, Leu237Pro, and 780delG mutations are unique in Japanese patients; (5) the spectrum of the mutations in the HLCS gene may vary substantially among different ethnic groups.

Base Sequence↗
PubMed2004

Identification of a distinctive mutation spectrum associated with high levels of transcription in yeast.

High levels of transcription are associated with increased mutation rates in Saccharomyces cerevisiae, a phenomenon termed transcription-associated mutation (TAM). To obtain insight into the mechanism of TAM, we obtained LYS2 forward mutation spectra under low- versus high-transcription conditions in which LYS2 was expressed from either the low-level pLYS2 promoter or the strong pGAL1-10 promoter, respectively. Because of the large size of the LYS2 locus, forward mutations first were mapped to specific LYS2 subregions, and then those mutations that occurred within a defined 736-bp target region were sequenced. In the low-transcription strain base substitutions comprised the majority (64%) of mutations, whereas short insertion-deletion mutations predominated (56%) in the high-transcription strain. Most notably, deletions of 2 nucleotides (nt) comprised 21% of the mutations in the high-transcription strain, and these events occurred predominantly at 5'-(G/C)AAA-3' sites. No -2 events were present in the low-transcription spectrum, thus identifying 2-nt deletions as a unique mutational signature for TAM.

Base Sequence↗