SEARCH · PubMed Health
Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.
Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.
Endoscopic word database systems are not standardized. An endoscopic word reference has been developed by the World Organization for Gastrointestinal Endoscopy. The suggestion is made to develop a standard software program for gastrointestinal endoscopy based on this system or one similar.
A system was implemented using a commercial database management program and a microcomputer for computerising references from journals and other sources. In addition to the citation, the user can enter the address of the institution where the study was carried out, a description of the article and of the work, key words, and an abstract. References are added, edited, searched for, displayed on screen, typed on paper, or sent to a text file, using selection criteria entered by the user. When a search is performed the printout will include the abstract of each paper, similar to that obtained from larger bibliographic services. The computer also writes requests for reprints. This program now holds over 30 000 references and has been in use for over three years. Such a system is beneficial for personal study, for writing books, articles, and theses, and for use by institutions, departments, and small libraries.
The purpose of this study is to compose a list of allergenic chemicals. Each chemical is described in a monograph. The objective of such a monograph program is to collect from the international scientific literature available relevant experimental, chemical, and epidemiological data on chemicals to which humans are known to be exposed and sensitized. A list of 721 chemicals, with related synonyms and trade names, that induce allergic responses and hypersensitivities was prepared. The chemicals were selected on the basis of evidence of human exposure and sensitization. Each monograph contains several data considered relevant to the evaluation of the sensitizing hazards of chemical substances. The data are divided in three sections: chemical identity, sensitizing power, and occurrence. All the data contained in the monographs along with the references and the synonyms are stored in a database application computer program. Preliminary results of 308 of 721 monographs analyzed are reported.
A major problem in the review and synthesis of citations resulting from multidatabase searching is overlap in coverage among the databases. The ability to identify and eliminate duplicate references from a multidatabase search provides an important service and significant time savings for the end user. The Upjohn Company's Corporate Technical Library has developed software to detect and eliminate duplicates from literature searches captured in electronic format. Methods for the identification of duplicates and the merging and sorting of unique citations are discussed, together with the library's procedures for electronic data capture.
New users often are surprised at how chaotic the Internet appears. They have heard so much about it and then find that it is a jumble of menus and resources. Even so, it is possible to find answers to reference questions on the Internet. This paper outlines a method for doing so. The method involves five steps: gather information and tools, learn the terminology, assemble a manual, write a strategy, and make bookmarks. The paper offers medical reference scenarios that illustrate how to search a database, find a program, find a document, and telnet to another site on the Internet.
A compendium of reviews and mini-reviews in biochemistry and molecular biology published in the second half of 1991 is presented. In all 880 titles are listed from 108 different publications. This compendium presents the references by journal name--the most suitable format for a hardcopy of this information. Keywords have been included with each reference to increase the value of the collection. Keyword and author cross-reference indexes are not included but are available in the electronic database from which this version was constructed. Should anyone wish to have this information in electronic form it can be distributed on MS-DOS formatted floppy disks in either Reference Manager or Medline format. The author should be contacted for details of the number of pre-formatted floppy disks required.
1. A compendium of reviews and mini-reviews in Biochemistry and Molecular Biology published in the first half of 1992 is presented. In all 499 titles are listed from 95 different publications. 2. This compendium presents the references by Journal Name. Keywords have been included with each reference to increase the value of the collection. Keyword and author cross-reference indexes are not included but are available in the electronic database from which this version was constructed. Should anyone wish to have this information in electronic form it can be distributed on MS-DOS formatted floppy disks in either Reference Manager or Medline format. The author should be contacted for details of the number of preformatted floppy disks required.
OBJECTIVE: We describe the CD4 database of the Scottish Immunology Laboratories, and its uses and limitations for making short-term predictions of a CD4 cell count less than or equal to 200 x 10(6)/l (CD4(200)) and of adult AIDS cases in Scotland. DESIGN: The date of the earlier of two consecutive samples (typically 3 months apart) both with CD4 cell counts less than or equal to 200 x 10(6)/l was taken to define when a patient had passed the CD4(200) threshold (referred to as a CD4(200) case). The CD4 database comprises HIV-1-seropositive adults in the four main risk groups [homosexual/bisexual (1), injecting drug users (IDU; 2), heterosexual contact (3), and undetermined (9)] from Scotland's three principal areas of population (Lothian, Tayside and Strathclyde) who have had a CD4 cell count of less than or equal to 500 x 10(6)/l. SETTING: Three hospitals in Scotland, the Communicable Diseases (Scotland Unit) and the Medical Research Council Biostatistics Unit, Cambridge, UK. PATIENTS, PARTICIPANTS: The CD4 database at 31 December 1990 listed 813 patients (of whom 52% were IDU): 390 were CD4(200)/AIDS cases (of whom 44% were IDU) and 192 were AIDS cases (of whom 32% were IDU). RESULTS: Individuals in risk groups 1, 2 and 3 were nearly equally represented among newly diagnosed HIV-1 infections in 1990. However, among patients with moderate immunodeficiency, IDU accounted for 50% of the total number. Co-incidence of first CD4 cell count with CD4(200) diagnosis was recorded for only 28% of IDU, but in over 50% of cases for each of the other exposure groups (57%). There was a highly significant decrease of around 80 x 10(6)/l per calendar-year-of-referral in first CD4 cell counts for patients on the CD4 database; and decreases of around 40 x 10(6)/lper decade of age at referral. Since 1988, median time from CD4(200) to AIDS diagnosis in Scotland has been approximately 2 years. Back-projection was applied to annual CD4(200)/AIDS diagnoses before 31 December 1990 and to AIDS diagnoses. From AIDS diagnoses, the central epidemic scenario underestimated past HIV-1-antibody-positive reports (up to the end of 1985). More dramatic underestimation was occasioned by back-projection from CD4(200)/AIDS diagnoses [319 inferred HIV infections compared with 445 HIV-1-antibody-positive reports to Communicable Diseases (Scotland) Unit]. CONCLUSIONS: First CD4 cell counts should complement new HIV-1 diagnoses. Past referrals for immunological monitoring were not uniform between risk groups in Scotland. Underascertainment of CD4(200) cases is a problem when CD4(200) cases are used as a basis for back-projection. More information concerning the incubation distribution from HIV seroconversion to CD4(200) diagnosis is required. It is likely that there are twice as many CD4(200)/AIDS as there are diagnosed cases of AIDS.
A dysmorphology data base can be useful for the clinician in the task of diagnosing multiple malformation syndromes in children. In this article the database POSSUM is described. Four patients with multiple anomalies referred for diagnostic syndrome evaluation are presented. They serve as examples on how POSSUM efficiently can be applied to obtain a short list of appropriate alternative syndromes, subsequently followed by a discussion on the differential diagnosis in each case. A specific, rare syndrome was diagnosed with the aid of POSSUM in all four cases. POSSUM appears to be useful for the diagnosis of dysmorphic syndromes.
Many files that index engineering, physics, or other technical literature contain references to chemical compounds. Complex chemical formulas in the title or abstract often contain special characters, for example, (,), [,], +, -, degrees, and %. Upper and lower case letters often are also included. A search of these formulas and symbols in the basic index is next to impossible because the terms in this field are usually parsed to all alphanumeric characters without sensitivity to case. It is possible for an online host to use a character-recognition algorithm to scan the title and abstract data for special characters or character strings and place them in a separate index field when such files are loaded. Such an algorithm has been designed by Fachinformationszentrun Energie, Physik, Mathematik GmbH in Karlsruhe, West Germany (FIZ Karlsruhe), the European service center of STN International, the scientific and technical information network. This algorithm recognizes and analyzes chemical formulas, material descriptions, alloys, and eutectic systems as well as nuclear reactions and dopings that appear in the title, abstract, or other fields. These character strings are converted into a standardized form and placed in a new field (the element terms field) which is supplied by the online host during the loading process. A checklist of allowed terms (symbols and chemical formulas) is used to prevent irrelevant terms from being mistaken for legitimate chemical symbols. For instance, the algorithm can recognize that CPU (central processing unit) is not a legitimate chemical formula. It is easy to demonstrate the utility this additional index supplies.(ABSTRACT TRUNCATED AT 250 WORDS)
Explore the source record for details and available documents.
A number of computer systems have been dedicated to some aspect of dysmorphology. These systems have generally been developed in isolation and demonstrate much variation in their design. Some systems are purely database applications designed to take advantage of computer technology in order to provide up to date syndrome compendia. Conversely, a number of research projects have endeavoured to build an intelligent system that can formulate a diagnosis, either through its own knowledge-base, or through interaction with an expert user. This report reviews computer systems in dysmorphology with reference to these two alternative design methodologies. The London Dysmorphology Database and POSSUM provide case studies in a standard database approach. The Skeletal Dysplasia Diagnostician (SDD) is described in order to demonstrate how an expert system might operate in dysmorphology. Other work in the field is reviewed in terms of the common and distinctive aspects of their design with respect to the three aforenamed systems.
A human genomic library was screened with a 30-base oligomer corresponding to the 5' end of the human calretinin cDNA. A clone that contains a minisatellite composed of 21 imperfect repeats of a 37-bp sequence was isolated. The consensus (GAGGGAGGAACTGGGACGCGTGCATGTTTGCATTCTC) incidentally shares 14 consecutive matches with the oligomer used as a probe, and it was shown that the clone did not belong to the calretinin locus. The minisatellite, named K29, was used as a probe on Southern blots at high stringency. After HaeIII, MboI, or HinfI digestion, it detected a single hypervariable locus, with 65% heterozygosity among Caucasian individuals. The probe used at low stringency revealed a fingerprint, with an average of four bands in addition to the locus-specific pattern. Mendelian inheritance was assessed on pedigrees. The K29 minisatellite was mapped by in situ hybridization to the very end of the long arm of chromosome 2 (2q37.3 band), at close proximity of the Fra2J locus, and is referred to as the D2S88 locus in the genome database.
Congestive heart failure (CHF) is the most common discharge diagnosis for elderly patients. The survival of elderly (age greater than or equal to 75 years) patients with CHF has not recently been reported, especially with reference to left ventricular ejection fraction (LVEF). A patient database was searched for the diagnosis of CHF and then screened for age greater than or equal to 75, Framingham Criteria for CHF and an LVEF evaluation. Ninety-four men fitted all criteria, including a minimum potential follow-up of 3 years. Life-table analysis was employed to compare their survival experience to an expected survival based on a sex- and age-equivalent subset of the 1980 Census data. Causes of death were determined from autopsy, medical records or death certificates. Mean age at onset of CHF was 82.5. Forty-three per cent had an LVEF greater than or equal to 0.45. There was no difference in the prevalence of potential aetiologies between those with LVEF greater than or equal to 0.45 versus LVEF less than 0.45. Life-table analysis revealed that CHF patients had a worse survival than controls for the first 5 years after diagnosis, attributable primarily to a high first-year mortality (28%) for the CHF group. There was no difference in survival between the LVEF greater than or equal to 0.45 and LVEF less than 0.45 groups.
SUMMARY: Molecular compartmentalization is vital for cellular physiology. Spatially resolved proteomics allows biologists to survey protein composition and dynamics with subcellular resolution. Here, we present PEELing, an integrated package and user-friendly web service for analyzing spatially resolved proteomics data. PEELing assesses data quality using curated or user-defined references, performs cutoff analysis to remove contaminants, connects to databases for functional annotation, and generates data visualizations-providing a streamlined and reproducible workflow to explore spatially resolved proteomics data. AVAILABILITY AND IMPLEMENTATION: PEELing and its tutorial are publicly available at https://peeling.janelia.org/ (Zenodo DOI: 10.5281/zenodo.15692517). A Python package of PEELing is available at https://github.com/JaneliaSciComp/peeling/ (Zenodo DOI: 10.5281/zenodo.15692434).
The objective of this study was to assess the performance of the clinical evaluation in detecting extrathoracic metastases compared with brain and abdomen CT and radionuclide bone scans in patients with newly diagnosed bronchogenic carcinoma. The included studies were selected using the MEDLARS database from 1977 through August 1992 as well as reference lists from published articles or abstracts. Studies eligible for consideration met six criteria. The most important criterion was that results of a clinical evaluation and a CT scan of the head or abdomen or a radionuclide bone scan, obtained during the initial evaluation of a patient with primary lung cancer, must be included. Data were categorized by the type of clinical evaluation performed and whether patients had a clinical evaluation suggesting metastases (positive) or not (negative). The negative predictive value (NPV) of the clinical evaluation was calculated in all studies. The sensitivity, specificity, and the positive predictive value (PPV) were calculated in studies including positive and negative clinical evaluation patients. Twenty-five studies are included in this analysis. A total of 3,089 imaging scans were obtained in the study patients after a clinical evaluation was performed. The mean NPV of the clinical evaluation for CT of the brain, abdomen, and radionuclide bone scan is 95, 94, and 89%, respectively. When an expanded clinical evaluation was performed, the NPV was even higher. The NPV was influenced by the prevalence of metastases, but still performed well in series with high prevalence rates.(ABSTRACT TRUNCATED AT 250 WORDS)
Blastocystis spp. is a zoonotic anaerobic parasite that has been identified in the large intestine of humans and many vertebrates. It is predominantly encountered in individuals with frequent contact with animals. The present study aims to identify the prevalence of Blastocystis spp. and its common genotypes in children with clinical symptoms of diarrhea in the city of Zahedan, located in the southeast of Iran. A cross-sectional descriptive study was conducted on 60 children under ten years of age with gastrointestinal symptoms, especially diarrhea. Following the collection of samples, stool samples were subjected to direct stool testing for the initial diagnosis. Following this, a microscopic diagnosis was made, after which DNA was extracted and a Polymerase Chain Reaction (PCR) test with a small subunit ribosomal RNA (SSU rRNA) gene target was performed. The PCR products were then purified and sequenced. The resulting nucleotide sequences were then subjected to a thorough review using Chromas biotechnology software version 2.4 and CLC genomic work bench software 11. The alignment of the nucleotide sequences was subsequently facilitated by utilizing the BLAST database, and these sequences were then compared with the reference genotypes of Blastocystis spp. that are stored within the gene bank. The genotyping of the sequences was conducted using CLC genomic work bench software 11, and a phylogenetic tree was constructed using MEGA7 software with the Neighbor-Joining statistical method, which applied the Kimura 2-parameter method. Out of the 60 cases that were examined, 5 children (8.33%) were found to be positive by direct microscopic and PCR tests, where a 500 (479) bp fragment in the SSU-rRNA target was detected. Subsequent genetic analysis identified four distinct subtypes, including subtypes 1, 2, 3, and 5. The percentage of nucleotide identity with the sequences in the gene bank was found to be between 93 and 100%. Given the presence of subtypes 3 and 5 in the study and the evidence of their zoonotic nature, it can be concluded that examining parasite dynamics and epidemiological principles can be effective in the control strategy.
OBJECTIVE: To study the extent of recognition by referring doctors of drug and alcohol problems in patients referred to consultation-liaison psychiatry for any reason, and the factors associated with non-recognition. DESIGN: Comparison of referring doctors' reasons for referral and psychiatrists' DSM-III-R diagnoses in 2347 inpatients referred consecutively over three years, by means of the prospective MICROCARES clinical database used by the consultation-liaison psychiatry service of each hospital involved. SETTING: Four general teaching hospitals of Monash University. RESULTS: Psychiatrists considered a psychoactive substance use disorder diagnosis likely in 336 (14%) of the referred patients; referring doctors missed 188 (56%) of these, referring instead for "depression", "anxiety" and "suicide attempt evaluation". The factors correlating with this discordance included younger age, male sex, having a personality disorder diagnosed, and having attempted self-harm. CONCLUSIONS: The extent of the failure to identify drug and alcohol problems in patients in whom some psychological problem worthy of referral to psychiatry had been detected is symptomatic of the extent of this failure in medicine generally. Education and the use of screening procedures may lead to development of coherent drug and alcohol protocols in individual institutions.