SEARCH · PubMed Health

Results for “duplex sequencing”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 181 records · Page 10Linked to original sources

PubMed1993

Homologous recognition promoted by RecA protein via non-Watson-Crick bonds between identical DNA strands.

The RecA protein of Escherichia coli forms a nucleoprotein filament that promotes homologous recognition and subsequent strand exchange between a single strand and duplex DNA via a three-stranded intermediate. Recognition of homology within three-stranded nucleoprotein complexes, which is probably central to genetic recombination, is not well understood as compared with the mutual recognition of complementary single strands by Watson-Crick base pairing. Using oligonucleotides, we examined the determinants of homologous recognition within RecA nucleoprotein filaments. Filaments that contained a single strand of DNA recognized homology not only in a complementary oligonucleotide but also in an identical oligonucleotide, whether their respective sugar-phosphate backbones were antiparallel or parallel, and a filament that contained duplex DNA showed the same polymorphic versatility in the recognition of homology. Recognition of self by a filament that contains a single strand reveals that RecA filaments can recognize homology via non-Watson-Crick hydrogen bonds. Recognition of multiple forms of the same sequence by duplex DNA in the filament shows that it primarily senses base-sequence homology, and suggests that recognition can be accomplished prior to the establishment of new Watson-Crick base pairs in heteroduplex products. However, unlike the initial recognition of homology, strand exchange is stereospecific, requiring the proper antiparallel orientation of complementary strands.

Bacteriophage M13↗

PubMed1998

GG versus AG Platination: A Kinetic Study on Hairpin-Stabilized Duplex Oligonucleotides.

The kinetics of the reactions between the diaqua form of the antitumor drug cisplatin, cis-[Pt(NH(3))(2)(H(2)O)(2)](2+), and two hairpin-stabilized duplex oligonucleotides, d(TATGGTATTTTTATACCATA) (I) and d(TATAGTATTTTTATACTATA) (II), were investigated. Oligonucleotides I and II were used as models for GG and AG sequences within duplex DNA, which are known as the major sites of platinum binding. The two GG guanines of I are shown to react with similar rates (k(5)(') = 18 +/- 2 and k(3)(') = 15 +/- 1 M(-)(1) s(-)(1)), roughly twice as fast as the AG guanine of II (k(3)(') = 9 +/- 1 M(-)(1) s(-)(1)). Platination of the AG adenine of II was also observed to a minor extent (k(5)(') = 1.5 +/- 0.3 M(-)(1) s(-)(1)), whereas no other adenine of I or II was platinated to a detectable extent. The overall platination rate of I is approximately three times larger than that of II. The 3'-monoadduct of I undergoes chelation to the GG intrastrand adduct with a rate 10.5 times larger than the 5'-monoadduct (k(3)(')(c) = (1.9 +/- 0.1) x 10(-)(3) s(-)(1) and k(5)(')(c) = (0.18 +/- 0.05) x 10(-)(3) s(-)(1)). For II, the chelation rate constants of the guanine- and adenine-bound monoadducts are k(5)(')(c) = 0.3 +/- 0.1 and k(3)(')(c) = 0.08 +/- 0.01 s(-)(1), respectively. These results are discussed in relation to the platination kinetics determined for other model systems.

Journal Article↗

PubMed1998

Targeted gene knockout mediated by triple helix forming oligonucleotides.

Triple helix forming oligonucleotides (TFOs) recognize and bind sequences in duplex DNA and have received considerable attention because of their potential for targeting specific genomic sites. TFOs can deliver DNA reactive reagents to specific sequences in purified chromosomal DNA (ref. 4) and nuclei. However, chromosome targeting in viable cells has not been demonstrated, and in vitro experiments indicate that chromatin structure is incompatible with triplex formation. We have prepared modified TFOs, linked to the DNA-crosslinking reagent psoralen, directed at a site in the Hprt gene. We show that stable Hprt-deficient clones can be recovered following introduction of the TFOs into viable cells and photoactivation of the psoralen. Analysis of 282 clones indicated that 85% contained mutations in the triplex target region. We observed mainly deletions and some insertions. These data indicate that appropriately constructed TFOs can find chromosomal targets, and suggest that the chromatin structure in the target region is more dynamic than predicted by the in vitro experiments.

Animals↗

PubMed1999

Abasic sites in duplex DNA: molecular modeling of sequence-dependent effects on conformation.

Molecular modeling calculations using JUnction Minimization of Nucleic Acids (JUMNA) have been used to study sequence effects on the conformation of abasic sites within duplex DNA. We have considered lesions leading to all possible unpaired bases (X), adenine, guanine, cytosine, or thymine contained within two distinct sequence contexts, CXC and GXG. Calculations were carried out on DNA 11-mers using extensive conformational search techniques to locate the most stable abasic conformations and using Poisson-Boltzmann corrected electrostatics to account for solvation effects. The results, which are in very good agreement with available experimental data, point to strong sequence effects on both the position of the unpaired base (intra or extrahelical) and on the overall curvature induced by the abasic lesion. For CXC, unpaired purines are found to lie within the helix, while unpaired pyrimidines are either extrahelical or in equilibrium between the intra and extrahelical forms. For GXG, all unpaired bases lead to intrahelical forms, but with marked, sequence-dependent differences in induced curvature.

Base Pairing↗

PubMed1995

Chiral recognition of deoxyoligonucleotides by delta- and lambda-tris(ethylenediamine)cobalt(III).

59Co NMR and CD measurements show for both stereoisomers of Co(en)3(3+) a similar trend in the sequence dependence of DNA recognition, as was reported previously for Co(NH3)6(3+). In particular, specific binding is evident to DNA molecules possessing runs of two or more same-strand guanine residues. The binding of either isomer to such sequences induces structural transitions toward A-DNA characteristics. Such measurements also show significant differences between the two stereoisomers in terms of how they recognize specific duplex DNA sequences. delta-Co(en)3(3+) binds more tightly than lambda-Co(en)3(3+) to right-handed, guanine-rich DNA, whereas lambda-Co(en)3(3+) binds more tightly than delta-Co(en)3(3+) to left-handed DNA. The two stereoisomers bind in an indistinguishable manner to AT-rich DNA.

Base Sequence↗

PubMed2001

Triplex targeting of human PDGF-B (c-sis, proto-oncogene) promoter specifically inhibits factors binding and PDGF-B transcription.

Human c-sis/PDGF-B proto-oncogene has been shown to be overexpressed in a large percentage of human tumor cells establishing a growth-promoting, autocrine growth circuit. Triplex forming oligonucleotides (TFOs) can recognize and bind sequences in duplex DNA, and have received considerable attention because of their potential for targeting specific genomic sites. The c-sis/PDGF-B promoter contains a unique homopurine/homopyrimidine sequence (SIS proximal element, SPE), which is crucial for binding nuclear factors that provoke transcription. In order to develop specific transcriptional inhibitors of the human c-sis/PDGF-B proto-oncogene, 20 potential TFOs targeting part or all of the SPE were screened by gel mobility analysis. DNase I footprinting shows that the TFOs we designed can form a sequence-specific triplex with the target. Protein binding assays demonstrate that triplex formation inhibits nuclear factors binding the c-sis/PDGF-B promoter. Both transient and stable transfection experiments demonstrate that the transcriptional activity of the promoter is considerably inhibited by the TFOs. We propose that TFOs represent a therapeutic potential to specifically diminish the expression of c-sis/PDGF-B proto-oncogene in various pathologic settings where constitutive expression of this gene has been observed.

Base Sequence↗

PubMed1999

Padlock oligonucleotides for duplex DNA based on sequence-specific triple helix formation.

An oligonucleotide was circularized around double-stranded DNA thanks to triple helix formation. Short oligonucleotides are known to be able to form DNA triple helices by binding into the DNA major groove at an oligopurine.oligopyrimidine sequence. After sequence-specific recognition of a double-stranded DNA target through triple helix formation, the ends of the triplex-forming oligonucleotide were joined through the action of T4 DNA ligase, thus creating a circular DNA molecule catenated to the plasmid containing the target sequence. The labeling of the double-stranded DNA sequence has been carried out without any chemical or enzymatic modification of this sequence. These "padlock" oligonucleotides provide a tool to attach a noncovalent tag in an irreversible way to supercoiled plasmid or other double-stranded DNAs. Such a complex may find applications in the development of new techniques for duplex DNA detection or plasmid delivery methods for gene therapy.

Animals↗

PubMed1998

Antiparallel DNA duplex formation between alternating alpha d(GA)n and beta d(GA)n sequences.

Alternating polypurine d(GA)n, sequences exhibit a considerable polymorphism. Here we report that alpha d(GA) x d(GA) sequences form an antiparallel stranded duplex DNA at neutral pH. The spectroscopic, electrophoretic and thermodynamic properties of the alpha/beta chimeric oligodeoxynucleotide, 5'-d(GA)4(T)4 alpha d(AG)4T-3', support the formation of a hairpin structure with antiparallel strands in the stem. The optical properties of this novel antiparallel structure are different from the parallel stranded homoduplex formed by d(GA)G7. This alpha/beta hairpin has a remarkably high Tm of 44.5 degrees C in 0.4 M NaCl with a van't Hoff enthalpy comparable to that of a parallel d(GA)n duplex. Base pairing was confirmed by T4 polynucleotide ligase catalyzed joining of the alpha/beta hairpin to an antiparallel bimolecular duplex and by non-denaturing gel electrophoresis using duplexes containing sequence constraints. Both support the presence of alphaG-G and alphaA-A base pairing in the antiparallel 5'-d(GA)4(T)4 alpha d(AG)4T-3' intramolecular duplex. This study adds to the polymorphic nature of alternating d(GA)n sequences as well as providing novel homopurine base pairing approaches for probing polypurine polypyrimidine sequences.

Adenine↗

PubMed1992

Triple-helix formation by oligonucleotides containing the three bases thymine, cytosine, and guanine.

A homopurine-homopyrimidine sequence of human immunodeficiency virus (HIV) proviral DNA was chosen as a target for triple-helix-forming oligonucleotides. An oligonucleotide containing three bases (thymine, cytosine, and guanine) was shown to bind to its target sequence under physiological conditions. This oligonucleotide is bound in a parallel orientation with respect to the homopurine sequence. Thymines recognize A.T base pairs to form T.A.T base triplets and guanines recognize a run of G.C base pairs to form G.G.C base triplets. A single 5-methylcytosine was shown to stabilize the triple helix when incorporated in a stretch of thymines; it recognizes a single G.C base pair in a run of A.T base pairs. These results provide some of the rules required for choosing the more appropriate oligonucleotide sequence to form a triple helix at a homopurine-homopyrimidine sequence of duplex DNA. A psoralen derivative attached to the oligonucleotide containing thymine, 5-methylcytosine, and guanine was shown to photoinduce cross-linking of the two DNA strands at the target sequence in a plasmid containing part of the HIV proviral DNA sequence. Triplex formation and cross-linking were monitored by inhibition of Dra I restriction enzyme cleavage. The present results provide a rational basis for the development of triplex-forming oligonucleotides targeted to specific sequences of the HIV provirus integrated in its host genome.

Base Sequence↗

PubMed1997

Molecular modeling of the conformational complexity of (+)-anti-B[a]PDE-adducted DNA using simulated annealing.

Benzo[a]pyrene (B[a]P), a potent mutagen/carcinogen, reacts with DNA following metabolism to its corresponding (+)-anti-7,8-diol-9,10-epoxide [(+)-anti-B[a]PDE], giving a major adduct (+)-trans-anti-B[a]P-N2-dG. Evidence suggests that this adduct is responsible for most of the different kinds of mutations (e.g. G-->T, G-->A, etc.) induced by (+)-anti-B[a]PDE, raising the question of how can a single adduct cause many different kinds of mutations? One hypothesis is that different mutations are induced depending upon the conformation of this adduct when bypassed during DNA replication. If true, then it becomes imperative to explore different reasonable conformations for this adduct. Herein a simulated annealing protocol is employed to study the conformation of (+)-trans-anti-B[a]P-N2-dG with the B[a]P moiety in the minor groove and pointing toward the base on its 5'-side in a 5'-CGC-3' sequence context in duplex DNA. This conformation and sequence were chosen because there is a structure derived from NMR constraints for comparison. A four step procedure is followed: the adduct is docked in canonical B-DNA, after which the structure is subjected to an initial conjugate gradient minimization, followed by simulated annealing and a final conjugate gradient minimization. The quality and final energy of structures is assessed as a function of changes in six parameters, including the length of the DNA helix, the initial annealing temperature (T0), the annealing time (t), the molecular dynamics time step (tau) and two other parameters. While there is no single set of optimum parameters, reasonable low energy structures were obtained using the values t approximately 40 ps (or longer), T0 approximately 750 K and tau approximately 1.0 fs with a helix length of 7 bp. The structures that emerge all retain the basic features of the input structure, being B-DNA-like with the B[a]P moiety in the minor groove pointing toward the base on the 5'-side. However, within this broad category there are at least six subclasses of structures, of which four have lowest energy members that differ by < approximately 5 kcal/mol. The fact that a variety of distinct but related structures emerge from a single starting structure as this parameter set is varied suggests that the use of a large but manageable number of simulated annealing runs should be considered in the search for a cohort of related structures. This is especially important given that this breadth of potentially relevant structures of approximately the same energy may indeed be relevant to the hypothesis that different mutations arise from a single adduct in different conformations.

7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide↗

PubMed1993

Exoquence DNA sequencing.

We have developed a strategy for DNA sequencing based on exonuclease III digestion followed by double strand specific endonuclease digestion and direct dideoxynucleotide sequencing reaction. This strategy eliminates the need for subcloning, oligonucleotide primers, and prior knowledge of the DNA to be sequenced. All template and primer duplexes needed for sequencing a complete insert can be prepared in one day from uncharacterized starting DNA. Sequence information can be obtained from different regions of the DNA simultaneously. The method uses double-stranded DNA to generate single-stranded template and primer, and thus produces high quality sequence results. Commercially available dideoxy-sequencing kits are well suited for this method. The strategy should be applicable for both automatic and routine laboratory DNA sequencing.

Exodeoxyribonucleases↗

PubMedDate not supplied

Binding of a porphyrin conjugate of Hoechst 33258 to DNA. II. NMR spectroscopic studies detect multiple binding modes to a 12-mer nonself-complementary duplex DNA.

We have probed by 1H NMR spectroscopy the molecular basis of the interaction between Hoechst 33258 conjugated to a des-metalloporphyrin and a non self-complementary duplex DNA sequence, designed on the known chemical nuclease selectivity of this system. The imino NMR spectra are consistent with two distinct families of structure, that is, PORHOE binding either way along the duplex. 2D spectral, T2, and linewidth data suggest multiple species within the two conformational families.

Binding Sites↗

PubMed1988

NMR studies of echinomycin bisintercalation complexes with d(A1-C2-G3-T4) and d(T1-C2-G3-A4) duplexes in aqueous solution: sequence-dependent formation of Hoogsteen A1.T4 and Watson--Crick T1.A4 base pairs flanking the bisintercalation site.

We report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-T4) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets recorded in H2O and D2O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding the dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A change in sugar pucker from the C2'-endo range to the C3'-endo range is detected at C2 on formation of the d(ACGT) and d(TCGA) complexes. In addition, the sugar ring protons of C2 exhibit upfield shifts and a large 1 ppm separation between the H2' and H2" protons for both complexes. The L-Ala amide protons undergo large downfield complexation shifts consistent with their participation in intermolecular hydrogen bonds for both tetranucleotide complexes.(ABSTRACT TRUNCATED AT 250 WORDS)

Base Sequence↗

PubMed2000

Peptide nucleic acid (PNA): its medical and biotechnical applications and promise for the future.

Synthetic molecules that can bind with high sequence specificity to a chosen target in a gene sequence are of major interest in medicinal and biotechnological contexts. They show promise for the development of gene therapeutic agents, diagnostic devices for genetic analysis, and as molecular tools for nucleic acid manipulations. Peptide nucleic acid (PNA) is a nucleic acid analog in which the sugar phosphate backbone of natural nucleic acid has been replaced by a synthetic peptide backbone usually formed from N-(2-amino-ethyl)-glycine units, resulting in an achiral and uncharged mimic. It is chemically stable and resistant to hydrolytic (enzymatic) cleavage and thus not expected to be degraded inside a living cell. PNA is capable of sequence-specific recognition of DNA and RNA obeying the Watson-Crick hydrogen bonding scheme, and the hybrid complexes exhibit extraordinary thermal stability and unique ionic strength effects. It may also recognize duplex homopurine sequences of DNA to which it binds by strand invasion, forming a stable PNA-DNA-PNA triplex with a looped-out DNA strand. Since its discovery, PNA has attracted major attention at the interface of chemistry and biology because of its interesting chemical, physical, and biological properties and its potential to act as an active component for diagnostic as well as pharmaceutical applications. In vitro studies indicate that PNA could inhibit both transcription and translation of genes to which it has been targeted, which holds promise for its use for antigene and antisense therapy. However, as with other high molecular mass drugs, the delivery of PNA, involving passage through the cell membrane, appears to be a general problem.

Animals↗

PubMed1979

Terminal sequences of vesicular stomatitis virus RNA are both complementary and conserved.

The nucleotide sequences at the 5' and 3' termini of RNA isolated from the New Jersey serotype of vesicular stomatitis virus [vsV(NJ)] and two of its defective interfering (DI) particles have been determined. The sequence differs from that previously demonstrated for the RNA from the Indiana serotype of VSV at only 1 of the first 17 positions from the 3' terminus and at only 2 of the first 17 positions from the 5' terminus. The 5'-terminal sequence of VSV(NJ) RNA is the complement of the 3'-terminal sequence, and duplexes which are 20 bases long and contain the 3' and 5' termini have been isolated from this RNA. The RNAs isolated from DI particles of VSV(NJ) have the same base sequences as do the RNAs from the parental virus. These results are in sharp contrast to those obtained with the Indiana serotype of VSV and its DI particles, in which the 3'-terminal sequences differ in 3 positions within the first 17. However, with both serotypes, the 3'-terminal sequence of the DI RNA is the complement of the 5'-terminal sequence of the RNA from the infectious virus. These findings suggest that the 3' and 5' RNA termini are highly conserved in both serotypes and that the 3' terminus of DI RNA is ultimately derived by copying the 5' end of the VSV genome, as recently proposed (D. Kolakofsky, M. Leppert, and L. Kort, in B. W. J. Mahy and R. D. Barry, ed., Negative-Strand Virus and the Host Cell, 1977; M. Leppert, L. Kort, and D. Kolakofsky, Cell 12:539-552, 1977; A. S. Huang, Bacteriol. Rev. 41:811-8218 1977).

Animals↗

PubMed1997

Structural polymorphism and dynamism in the DNA segment GATCTTCCCCCCGGAA: NMR investigations of hairpin, dumbbell, nicked duplex, parallel strands, and i-motif.

Structure and dynamism in a DNA segment d-GATCTTCCCCCCGGAA have been investigated by nuclear magnetic resonance (NMR) spectroscopy. At neutral pH, the molecule exists largely as a dumbbell, formed by the association of two hairpins with sticky ends. A small percentage of hairpin is also detectable. The stem of the dumbbell, which is 12 base pairs long, has two nicks separated by 4 base pairs. The three-dimensional structures of the dumbbell and also of a 12-mer duplex, the sequence of which is identical to that of the stem of the dumbbell, have been determined by NMR in conjunction with restrained molecular dynamics calculations. It is observed that the presence of nicks causes minor changes in the structure of the duplex. Fraying at the nicks is much less than at the ends of a regular duplex. The loop shows very few nuclear Overhauser effects, which is a reflection on the greater dynamism in its structure. At lower pH, the molecule undergoes a transition to an i-motif type of structure with two parallel stranded duplexes involving C-C+ pairing, interdigitating each other. The structure is highly stable, with a melting temperature >60 degrees C.

Base Composition↗

PubMed1999

Atomic-resolution crystal structures of B-DNA reveal specific influences of divalent metal ions on conformation and packing.

Crystal structures of B-form DNA have provided insights into the global and local conformational properties of the double helix, the solvent environment, drug binding and DNA packing. For example, structures of the duplex with sequence CGCGAATTCGCG, the Dickerson-Drew dodecamer (DDD), established a unique geometry of the central A-tract and a hydration spine in the minor groove. However, our knowledge of the various interaction modes between metal ions and DNA is very limited and almost no information exists concerning the origins of the different effects on DNA conformation and packing exerted by individual metal ions. Crystallization of the DDD duplex in the presence of Mg(2+)and Ca(2+)yields different crystal forms. The structures of the new Ca(2+)-form and isomorphous structures of oligonucleotides with sequences GGCGAATTCGCG and GCGAATTCGCG were determined at a maximum resolution of 1.3 A. These and the 1.1 A structure of the DDD Mg(2+)-form have revealed the most detailed picture yet of the ionic environment of B-DNA. In the Mg(2+)and Ca(2+)-forms, duplexes in the crystal lattice are surrounded by 13 magnesium and 11 calcium ions, respectively.Mg(2+)and Ca(2+)generate different DNA crystal lattices and stabilize different end-to-end overlaps and lateral contacts between duplexes, thus using different strategies for reducing the effective repeat length of the helix to ten base-pairs. Mg(2+)crystals allow the two outermost base-pairs at either end to interact laterally via minor groove H-bonds, turning the 12-mer into an effective 10-mer. Ca(2+)crystals, in contrast, unpair the outermost base-pair at each end, converting the helix into a 10-mer that can stack along its axis. This reduction of a 12-mer into a functional 10-mer is followed no matter what the detailed nature of the 5'-end of the chain: C-G-C-G-A-ellipsis, G-G-C-G-A-ellipsis, or a truncated G-C-G-A-ellipsis Rather than merely mediating close contacts between phosphate groups, ions are at the origin of many well-known features of the DDD duplex structure. A Mg(2+)coordinates in the major groove, contributing to kinking of the duplex at one end. While Ca(2+)resides in the minor groove, coordinating to bases via its hydration shell, two magnesium ions are located at the periphery of the minor groove, bridging phosphate groups from opposite strands and contracting the groove at one border of the A-tract.

Calcium↗

PubMed1996

Sequence-specific binding and cleavage of duplex DNA by a radioiodinated, intercalator-linked, triplex-forming oligonucleotide.

Applications of oligodeoxynucleotides to modulate gene expression have been the subject of much recent research. We have sought to develop a method to permanently inactivate a gene, or potentially kill cells containing abnormal genes. In this report, we show that a DNA intercalator conjugated to a triplex-forming oligonucleotide can be labeled with an Auger electron emitting radioisotope, can cleave its duplex DNA target, and can specifically bind the target sequence contained in a total of 10 kilobases of irrelevant DNA.

Autoradiography↗