SEARCH · PubMed Health

Results for “shared variables”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 199 records · Page 11Linked to original sources

PubMedDate not supplied

[The specificity of hygienic behavior of virtually healthy population].

An analysis of the results of a sociological study showed that both men and women aged around 50 and noting subjectively no chronic pathology regard health as a life value. Social hardships reliably worsen the preventive activity and limit its variability. An essential share of population (above 30%), while taking care of its health, does not give up such harmful habits as smoking and abuse of alcohol. The described data denote the need in not so much propagating the healthy mode of life as in motivating it. The disturbing trend towards ignoring the motivations targeted at health promotion deserves special attention; the above trend is observed in absence of age-related chronic pathologies and against the background of an improving social status especially in men.

Adult↗

PubMed2007

Gene-specific inhibition of breast carcinoma in BALB-neuT mice by active immunization with rat Neu or human ErbB receptors.

Employing the transgenic BALB-neuT mouse tumor model, we explored the in vivo biologic relevance of immunocompetent epitopes shared among the four ErbB receptors. The outcome of neu-mediated tumorigenesis was compared following vaccination with isogeneic normal rat ErbB2/Neu (LTR-Neu) or xenogeneic human ErbB receptors (LTR-EGFR, LTR-ErbB2, LTR-ErbB3 and LTR-ErbB4), each recombinantly expressed in an NIH3T3 murine cell background. Vaccination using rat LTR-Neu at the stage of atypical hyperplasia potently inhibited neu-mediated mammary tumorigenesis. Moreover, all human ErbB receptors specifically interfered with tumor development in BALB-neuT mice. Relative increase in tumor-free survival and reduction in tumor incidence corresponded to structural similarity shared with the etiologic neu oncogene, as rat orthologue LTR-Neu proved most effective followed by the human homologue LTR-ErbB2 and the other three human ErbB receptors. Vaccination resulted in high titer specific serum antibodies, whose tumor-inhibitory effect correlated with cross-reactivity to purified rat Neu extracellular domain in vitro. Furthermore, a T cell response specific for peptide epitopes of rat Neu was elicited in spleen cells of mice immunized with LTR-Neu and was remotely detectable for discrete peptides upon vaccination with LTR-ErbB2 and LTR-EGFR. The most pronounced tumor inhibition by LTR-Neu vaccination was associated with leukocyte infiltrate and tumor necrosis in vivo, while immune sera specifically induced cytotoxicity and apoptosis of BALB-neuT tumor cells in vitro. Our findings indicated that targeted inhibition of neu oncogene-mediated mammary carcinogenesis is conditional upon the immunization schedule and discrete immunogenic epitopes shared to a variable extent by different ErbB receptors.

Animals↗

PubMedDate not supplied

The syndrome of idiopathic CD4+ lymphocytopenia.

The syndrome of idiopathic CD4+ lymphocytopenia has recently been recognized and referred to as the persistent depletion of peripheral blood CD4+ T lymphocytes below 300 cells per cubic millimeter or less than 20% of total lymphocytes in the absence of either HIV infection or other known causes of immunodeficiency. The available literature indicates that neither human retroviruses (HIV-1, HIV-2, HTLV-I, HTLV-II) nor other transmissible agents play any clear-cut role in the pathogenesis. Furthermore, the epidemiologic, immunologic and clinical features of this syndrome differ substantially from those of HIV infection. The heterogeneity of both immunologic abnormalities, in addition to CD4+ depletion, and clinical course in patients with this disorder points out no common cause although in at least a subset of patients the pathogenetic pathways could be shared with common variable immunodeficiency.

Humans↗

PubMed1974

Structure of antibodies with shared idiotypy: the complete sequence of the heavy chain variable regions of two immunoglobulin M anti-gamma globulins.

The complete amino acid sequence of the heavy chain variable regions of two different molecules of immunoglobulin M anti-gamma globulin has been determined. These proteins, from different human patients, had independently been shown to share idiotypic specificity. Only eight sequence differences were discernible for the entire length of their heavy chain variable regions. Five of the differences occurred outside hypervariable regions, while three were placeable within such regions. A comparison of these molecules of anti-gamma globulin with the seven human V(H)III variable region sequences presently available for immunoglobulins without known antibody activity showed that the great majority of sequence differences between the two idiotypically similar antibodies and these seven proteins were confined to hypervariable regions. This study illustrates in precise terms a convergence of the distinct immunological properties of idiotypy, hypervariable region structure, and combining site specificity as they relate to the variable region of the immunoglobulin molecule. To a great degree these properties now appear to be a reflection of the same structural attributes of the variable region.

Amino Acid Sequence↗

PubMed1985

Variability within the rabbit C repeats and sequences shared with other SINES.

The C family of short, interspersed repeats (SINES) is highly repeated in the rabbit genome, and most members have a structure suggestive of a model for their dispersal via reinsertion of a double-stranded copy of an RNA polymerase III transcribed RNA. We have determined the nucleotide sequence of additional members of the repeat family and have compiled them to obtain an improved consensus sequence. This compilation shows that although most regions of the repeat are well conserved, two regions show high variability. Some individual repeats are truncated, and one truncated repeat retains the characteristic structures of a retroposon. The consensus sequence for C repeats does not match the sequence of any other sequenced mammalian SINE over large regions, but short imperfect matches to several primate and rodent SINES are observed. A sequence similar to the 27 nucleotide consensus sequence TCCCAGCAACCACATGGGAGGCAGAGA was found in all mammalian SINES examined. The 3' portion of this sequence matches a DNA segment found at the replication origins of papovaviruses.

Animals↗

PubMed1984

Human figure drawing ability and vestibular processing dysfunction in learning-disabled children.

Explored the relationship between vestibular function as measured by duration of postrotary nystagmus and human figure drawing ability in 40 children labeled as learning disabled. Regression analysis revealed that the variable of chronological age shared the most variance with human figure drawing scores. Postrotary nystagmus durations also shared a significant amount of variance with human figure drawing scores, while the variables of IQ and sex were nonsignificant. The results provide additional support for the assertion that some learning-disabled children evidence deficits in vestibular processing ability and that these deficits may affect performance on cognitive-perceptual tasks.

Child↗

PubMed2004

The Electronic Report on Adolescent Pregnancy (ERAP).

PURPOSE: To create a data management system that: (1) standardizes antecedent, program, and outcome variables relevant to the shared goals of adolescent-oriented maternity programs while allowing users to add variables pertaining to unique aspects of their work; (2) cues providers to physiologic and psychosocial characteristics that predispose teenagers to adverse pregnancy and parenting outcomes, (3) standardizes patient care by guiding providers through adolescent-oriented prenatal, postpartum, and well baby visits, and (4) establishes the infrastructure to collect data from a nationally representative sample of pregnant and parenting teens. METHOD: We adapted a powerful, state-of-the-art relational database framework (Microsoft Access 2000) to create an easy-to-use data management system-The Electronic Report on Adolescent Pregnancy (ERAP)-that requires minimal training to use on a personal computer. RESULTS: ERAP is designed to meet the administrative and analytic needs of adolescent-oriented maternity programs. It consists of six linked core data tables (teen, pregnancy, prenatal visits, child, interconception interval, and interconception interval visits), that allow users to analyze data from these multiple views while preserving the family structure. In addition, the database standardizes methods for collecting and storing the information and automatically computing the variables needed to monitor and evaluate an adolescent-oriented maternity program. Since by adding variables and appending supplementary tables, users can modify the core database to accommodate unique aspects of their programs and/or research, ERAP is also an ideal conduit for translating research findings into clinical practice. Similarly, because ERAP actually structures the care patients receive, the database provides the infrastructure needed to develop and implement best practice guidelines for treating teen-headed families. Finally, the confidentiality of all subject data is assured because ERAP is password-protected and automatically prepares files for batched external analyses by removing personal identifiers. CONCLUSIONS: ERAP provides the infrastructure needed to create a teen-pregnancy databank at the national level and an efficient patient monitoring system at the program level. By standardizing variable definitions and data collection techniques, serving as a repository for data collected at multiple sites, and tracking the multidisciplinary aspects of the care patients receive, ERAP has the potential to facilitate collaboration between adolescent-oriented maternity programs, increase the scientific rigor of teen pregnancy research, and improve the quality of care individual teen-headed families receive by prompting compliance with best practice guidelines.

Adolescent↗

PubMed1985

Determinants of market share for a hospital's services.

This study identifies and analyzes factors under a hospital's control that can affect its market share. The study, utilizing the Multiplicative Competitive Interaction model, specifically focuses on determining the market share for each hospital within a geographic area, as opposed to the total demand for hospital services within an area. The results indicate that the effect of the number of physician affiliations on hospital patient share is statistically significant. The article investigates the variables that affect the level of physician affiliation. Besides physician affiliation, hospital location, a PROFILE factor based on a composite of a number of variables, and the proportion of affiliated physicians who are not affiliated elsewhere have a significant impact on each hospital's market share. The variables examined resulted in an R2 = 0.901 for individual hospital patient market share.

Catchment Area, Health↗

PubMed2006

Independent evolution of bitter-taste sensitivity in humans and chimpanzees.

It was reported over 65 years ago that chimpanzees, like humans, vary in taste sensitivity to the bitter compound phenylthiocarbamide (PTC). This was suggested to be the result of a shared balanced polymorphism, defining the first, and now classic, example of the effects of balancing selection in great apes. In humans, variable PTC sensitivity is largely controlled by the segregation of two common alleles at the TAS2R38 locus, which encode receptor variants with different ligand affinities. Here we show that PTC taste sensitivity in chimpanzees is also controlled by two common alleles of TAS2R38; however, neither of these alleles is shared with humans. Instead, a mutation of the initiation codon results in the use of an alternative downstream start codon and production of a truncated receptor variant that fails to respond to PTC in vitro. Association testing of PTC sensitivity in a cohort of captive chimpanzees confirmed that chimpanzee TAS2R38 genotype accurately predicts taster status in vivo. Therefore, although Fisher et al.'s observations were accurate, their explanation was wrong. Humans and chimpanzees share variable taste sensitivity to bitter compounds mediated by PTC receptor variants, but the molecular basis of this variation has arisen twice, independently, in the two species.

Alleles↗

PubMed1986

Variable susceptibility to immune complex glomerulonephritis among mice sharing the same major histocompatibility complex.

Three inbred strains of mice were identified which demonstrated different susceptibilities to induction of immune complex glomerulonephritis (ICGN) despite sharing the same major histocompatibility complex haplotype (H-2k). Groups of mice from each of these three strains, B10.BR, CBA and C3H/HeJ, were injected with one of two different dose schedules of horse apoferritin (HAF) for 4 weeks, after which glomerular morphology, immunoglobulin deposition, and serum anti-HAF antibody levels were examined. With either dose schedule, only those mice which demonstrated a high level antibody response developed ICGN and glomerular immunoglobulin deposition. These results suggest that susceptibility to ICGN in this model is related to the level of antigen exposure and to the magnitude of the antibody response, which is not under strict control of the major histocompatibility complex.

Animals↗

PubMed2002

Brain injury: quality of life's greatest challenge.

The objectives of this investigation were to (1) identify elements that comprise an acceptable quality of life (Q-L) post-traumatic brain injury (TBI) from the perspectives of patients and families, and (2) explore patient and family satisfaction with treatment decisions relevant to QoL. The authors created, tested, and administered two forms (patient; family) of a 35-question interview to 33 participants in a longitudinal TBI study (14 women, 19 men) and 33 associated family members. Men associated ratings of QoL with numerous variables, while women's responses revealed no significant relationships shared by QoL and other variables. Women reported a poorer QoL than did men. Older patients reported a better QoL than did younger patients. Families emphasized the family relationship, emotional control, and ability to concentrate when considering overall QoL. Patients did not. The majority of patients and families expressed satisfaction with decisions made about acute treatment. QoL research is essential to illuminate best practice models.

Adolescent↗

PubMed2005

Some rationales for risk sharing and financing adaptation.

Current climate variability and anticipated climate change challenge our water systems and our financial resources. The sharing of economic losses due to weather related hazards and the sharing of costs that result from protecting lives and property take place in different forms, but are currently insufficient. In this paper we discuss three different rationales for financing disaster losses through public and private arrangements, as well as options for financing adaptation, with a special focus on water management. We propose that financial arrangements for risk sharing and climate change adaptation should be reconsidered, in a more structured approach, to be able to deal with both disaster losses and the costs that arise because of climate change adaptation, e.g. for water management, in both developing and developed countries.

Developing Countries↗

PubMed1984

Muscular synergism--II. A minimum-fatigue criterion for load sharing between synergistic muscles.

P6new physiological criterion for muscular load sharing is developed. The criterion is based on the assumption that the endurance time of muscular contractions is maximized, hence muscular fatigue is minimized. The optimization problem is cast in the form of a linearly constrained, non-linear MINIMAX optimization. The new method predicts that: (1) there is synergistic muscle action, (2) muscle force increases non-linearly with external force (load), (3) relatively more force is allocated to muscles that have a large maximum force (large muscles), (4) relatively more force is allocated to muscles with a high percentage of slow-twitch fibers (muscles that are fatigue-resistant), (5) the load sharing does not depend on the moment arm of the muscles (although the absolute force levels do depend on this variable). The predicted load sharing between two cat muscles during standing and walking is in good agreement with direct force measurement data from the literature.

Animals↗

PubMedDate not supplied

Needle sharing behaviour among injection drug users (IDUs) in treatment in Montreal and Toronto, 1988-1989.

Injection drug users (IDUs) entering treatment programs in Montreal and Toronto were recruited for a study of drug using behaviour and risk of HIV infection. Only those who had injected within 6 months of entering their treatment program were eligible for participation. 183 subjects were recruited in Montreal and 167 in Toronto between November, 1988 and October, 1989. Each participant completed a standardized interviewer-administered questionnaire which focussed on, among other things, drug history and needle sharing behaviour. Approximately three-quarters of respondents in both cities reported sharing needles and syringes within the 6-month period prior to their entry into treatment. Our analysis, which focussed on variables associated with needle sharing revealed that having a sexual partner who injected, trouble obtaining sterile needles and syringes and cocaine injection were significantly and independently associated with needle sharing in a logistic regression model which also controlled for city of recruitment.

AIDS Serodiagnosis↗

PubMed1989

Shared surface epitopes among trypanosomes of the same serodeme expressing different variable surface glycoprotein genes.

African trypanosomes evade the immune response of the mammalian host by undergoing antigenic variation, caused by sequence changes in a variable surface glycoprotein (VSG). The majority of trypanosome clones analyzed thus far are not known to share surface exposed epitopes or express appreciably homologous VSGs. We show here that four clones of Trypanosoma brucei from the same serodeme express different VSGs and share exposed epitopes to varying degrees, as defined by monoclonal antibodies. Rabbit antiserum against any one of the four VSGs recognizes epitopes present on all four trypanosomes in live cell immunofluorescence assay. The expressed VSGs are partially homologous at the N-terminus with multiple point substitutions of amino acids which distinguish each of the four VSGs. The genes coding for these VSGs are members of one gene family and an expression-linked copy with a unique restriction map is present in each trypanosome. Analysis of the ontogeny of the expressed genes should reveal mechanisms of evolution in trypanosome variable antigen repertoires.

Amino Acid Sequence↗

PubMed1990

Bivariate survival models for analysis of genetic and environmental effects in twins.

Classic methods in genetics for the analysis of binary attributes, based on an assumption of a "threshold" on a normally distributed latent variable called "liability," estimate the strength of genetic and environmental effects from differences in correlations between relatives of differing genetic relatedness. Two problems that are not easily addressed by these methods are the need to take the age of onset into account (particularly in chronic diseases in which incidence rates vary considerably with age and the lengths of time at risk can vary between individuals) and the desirability of incorporating measured covariates (genetic or environmental). The standard methods of cohort analysis used in epidemiology allow for both of these features, but until recently have been restricted to independent individuals. Recent developments in survival analysis have extended the widely used "proportional hazards" model of Cox by the addition of latent variable, epsilon, reflecting the shared susceptibility of related subjects because of their shared genes or shared environment. We show how this approach can be combined with more traditional models of gene-environment interaction to allow the main effects of measured genetic markers and environmental variables to be estimated, as well as the residual variance of genetic and environment and their interactions. The approaches are applied to a cohort of female twin births in Sweden from 1886 to 1958, linked with the Swedish cancer registry from 1961 to 1982.

Adult↗

PubMed1988

Use of syllable-scale timing to discriminate words.

Assuming that only primitive, imperfect phonetic labeling of speech could be achieved by an automatic speech segmenter, words from several small vocabularies were identified using discriminant analysis, where the locations of prominent acoustic boundaries were combined in the optimum linear fashion. A set of two-syllable words that shared the same spelling in a weak alphabet (using categories like stop closure, fricative, vowel, etc.), but that differed in such features as which syllable was stressed, the tensity of the vowel, the identity of particular segments, etc., was selected. Discriminant analysis on the vector of six segmental boundaries achieved recognition accuracy 6.3 times better than chance. The words were produced by six talkers at two speaking tempos and measured by hand from sound spectrograms. Testing was performed on productions different from those used in training. When more confusable words (sharing the same stress pattern) were employed, performance was still five times better than chance. In a third experiment, the first two word sets were combined, and a subset of the variables (four of them) shared in common was employed for identification. This time recognition using temporal information was still able to do a reasonable job of discriminating the words. The results suggest that considerable information is available in segmental timing for identifying words even when the phonetic labeling of speech is weak.

Female↗

PubMed2004

Effect of fluid boundary conditions on joint contact mechanics and applications to the modeling of osteoarthritic joints.

The long-term goal of our research is to understand the mechanism of osteoarthritis (OA) initiation and progress through experimental and theoretical approaches. In previous theoretical models, joint contact mechanics was implemented without consideration of the fluid boundary conditions and with constant permeability. The primary purpose of this study was to investigate the effect of fluid boundary conditions at the articular surfaces on the contact mechanics, in terms of load sharing and fluid flow properties using variable permeability. The tested conditions included totally sealed surfaces, open surfaces, and open surfaces with variable permeability. While the sealed surface model failed to predict relaxation times and load sharing properly, the class of open surface models (open surfaces with constant permeability, and surfaces with variable permeability) gave good agreement with experiments, in terms of relaxation time and load sharing between the solid and the fluid phase. In particular, the variable permeability model was judged to be the most realistic of the three models, from a biological and physical point of view. This model was then used to simulate joint contact in the early and late stages of OA. In the early stages of OA, the model predicted a decrease in peak contact pressure and an increase in contact area, while in the late stages of OA, peak pressures were increased and contact areas were decreased compared to normal. These findings agree well with experimental observations.

Animals↗