PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “duplex sequencing”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 235 records · Page 13Linked to original sources

Antiparallel DNA duplex formation between alternating alpha d(GA)n and beta d(GA)n sequences.

Alternating polypurine d(GA)n, sequences exhibit a considerable polymorphism. Here we report that alpha d(GA) x d(GA) sequences form an antiparallel stranded duplex DNA at neutral pH. The spectroscopic, electrophoretic and thermodynamic properties of the alpha/beta chimeric oligodeoxynucleotide, 5'-d(GA)4(T)4 alpha d(AG)4T-3', support the formation of a hairpin structure with antiparallel strands in the stem. The optical properties of this novel antiparallel structure are different from the parallel stranded homoduplex formed by d(GA)G7. This alpha/beta hairpin has a remarkably high Tm of 44.5 degrees C in 0.4 M NaCl with a van't Hoff enthalpy comparable to that of a parallel d(GA)n duplex. Base pairing was confirmed by T4 polynucleotide ligase catalyzed joining of the alpha/beta hairpin to an antiparallel bimolecular duplex and by non-denaturing gel electrophoresis using duplexes containing sequence constraints. Both support the presence of alphaG-G and alphaA-A base pairing in the antiparallel 5'-d(GA)4(T)4 alpha d(AG)4T-3' intramolecular duplex. This study adds to the polymorphic nature of alternating d(GA)n sequences as well as providing novel homopurine base pairing approaches for probing polypurine polypyrimidine sequences.

Adenine↗

Triple-helix formation by oligonucleotides containing the three bases thymine, cytosine, and guanine.

A homopurine-homopyrimidine sequence of human immunodeficiency virus (HIV) proviral DNA was chosen as a target for triple-helix-forming oligonucleotides. An oligonucleotide containing three bases (thymine, cytosine, and guanine) was shown to bind to its target sequence under physiological conditions. This oligonucleotide is bound in a parallel orientation with respect to the homopurine sequence. Thymines recognize A.T base pairs to form T.A.T base triplets and guanines recognize a run of G.C base pairs to form G.G.C base triplets. A single 5-methylcytosine was shown to stabilize the triple helix when incorporated in a stretch of thymines; it recognizes a single G.C base pair in a run of A.T base pairs. These results provide some of the rules required for choosing the more appropriate oligonucleotide sequence to form a triple helix at a homopurine-homopyrimidine sequence of duplex DNA. A psoralen derivative attached to the oligonucleotide containing thymine, 5-methylcytosine, and guanine was shown to photoinduce cross-linking of the two DNA strands at the target sequence in a plasmid containing part of the HIV proviral DNA sequence. Triplex formation and cross-linking were monitored by inhibition of Dra I restriction enzyme cleavage. The present results provide a rational basis for the development of triplex-forming oligonucleotides targeted to specific sequences of the HIV provirus integrated in its host genome.

Base Sequence↗

Molecular modeling of the conformational complexity of (+)-anti-B[a]PDE-adducted DNA using simulated annealing.

Benzo[a]pyrene (B[a]P), a potent mutagen/carcinogen, reacts with DNA following metabolism to its corresponding (+)-anti-7,8-diol-9,10-epoxide [(+)-anti-B[a]PDE], giving a major adduct (+)-trans-anti-B[a]P-N2-dG. Evidence suggests that this adduct is responsible for most of the different kinds of mutations (e.g. G-->T, G-->A, etc.) induced by (+)-anti-B[a]PDE, raising the question of how can a single adduct cause many different kinds of mutations? One hypothesis is that different mutations are induced depending upon the conformation of this adduct when bypassed during DNA replication. If true, then it becomes imperative to explore different reasonable conformations for this adduct. Herein a simulated annealing protocol is employed to study the conformation of (+)-trans-anti-B[a]P-N2-dG with the B[a]P moiety in the minor groove and pointing toward the base on its 5'-side in a 5'-CGC-3' sequence context in duplex DNA. This conformation and sequence were chosen because there is a structure derived from NMR constraints for comparison. A four step procedure is followed: the adduct is docked in canonical B-DNA, after which the structure is subjected to an initial conjugate gradient minimization, followed by simulated annealing and a final conjugate gradient minimization. The quality and final energy of structures is assessed as a function of changes in six parameters, including the length of the DNA helix, the initial annealing temperature (T0), the annealing time (t), the molecular dynamics time step (tau) and two other parameters. While there is no single set of optimum parameters, reasonable low energy structures were obtained using the values t approximately 40 ps (or longer), T0 approximately 750 K and tau approximately 1.0 fs with a helix length of 7 bp. The structures that emerge all retain the basic features of the input structure, being B-DNA-like with the B[a]P moiety in the minor groove pointing toward the base on the 5'-side. However, within this broad category there are at least six subclasses of structures, of which four have lowest energy members that differ by < approximately 5 kcal/mol. The fact that a variety of distinct but related structures emerge from a single starting structure as this parameter set is varied suggests that the use of a large but manageable number of simulated annealing runs should be considered in the search for a cohort of related structures. This is especially important given that this breadth of potentially relevant structures of approximately the same energy may indeed be relevant to the hypothesis that different mutations arise from a single adduct in different conformations.

7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide↗

Exoquence DNA sequencing.

We have developed a strategy for DNA sequencing based on exonuclease III digestion followed by double strand specific endonuclease digestion and direct dideoxynucleotide sequencing reaction. This strategy eliminates the need for subcloning, oligonucleotide primers, and prior knowledge of the DNA to be sequenced. All template and primer duplexes needed for sequencing a complete insert can be prepared in one day from uncharacterized starting DNA. Sequence information can be obtained from different regions of the DNA simultaneously. The method uses double-stranded DNA to generate single-stranded template and primer, and thus produces high quality sequence results. Commercially available dideoxy-sequencing kits are well suited for this method. The strategy should be applicable for both automatic and routine laboratory DNA sequencing.

Exodeoxyribonucleases↗

Binding of a porphyrin conjugate of Hoechst 33258 to DNA. II. NMR spectroscopic studies detect multiple binding modes to a 12-mer nonself-complementary duplex DNA.

We have probed by 1H NMR spectroscopy the molecular basis of the interaction between Hoechst 33258 conjugated to a des-metalloporphyrin and a non self-complementary duplex DNA sequence, designed on the known chemical nuclease selectivity of this system. The imino NMR spectra are consistent with two distinct families of structure, that is, PORHOE binding either way along the duplex. 2D spectral, T2, and linewidth data suggest multiple species within the two conformational families.

Binding Sites↗

NMR studies of echinomycin bisintercalation complexes with d(A1-C2-G3-T4) and d(T1-C2-G3-A4) duplexes in aqueous solution: sequence-dependent formation of Hoogsteen A1.T4 and Watson--Crick T1.A4 base pairs flanking the bisintercalation site.

We report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-T4) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets recorded in H2O and D2O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding the dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A change in sugar pucker from the C2'-endo range to the C3'-endo range is detected at C2 on formation of the d(ACGT) and d(TCGA) complexes. In addition, the sugar ring protons of C2 exhibit upfield shifts and a large 1 ppm separation between the H2' and H2" protons for both complexes. The L-Ala amide protons undergo large downfield complexation shifts consistent with their participation in intermolecular hydrogen bonds for both tetranucleotide complexes.(ABSTRACT TRUNCATED AT 250 WORDS)

Base Sequence↗

1H NMR and optical spectroscopic investigation of the sequence-dependent dimerization of a symmetrical cyanine dye in the DNA minor groove.

A symmetrical cyanine dye was previously shown to bind as a cofacial dimer to alternating A-T sequences of duplex DNA. Indirect evidence suggested that dimerization of the dye occurred in the minor groove. 1H NMR experiments reported here verify this model based on broadening and shifting of signals due to protons on carbon 2 of adenine and imino protons at the central five A-T pairs of the 11 base pair duplex: 5'-GCGTATATGCG-3'/3'-CGCATATACGC-5'. This binding mode is similar to that of distamycin A, even though the dye lacks the hydrogen-bonding groups used by distamycin for sequence-specific recognition. Surprisingly, the third base pair (G-C) was also implicated in the binding site. UV-vis experiments were used to compare the extent of dimerization of the dye for 11 different sequence variants. These experiments verified the importance of a G-C pair at the third position: replacing this pair with A-T suppressed dimerization. These results indicate that the dye binding site spans six base pairs: 5'-GTATAT-3'. The initial G-C pair seems to be important for widening the minor groove rather than for making important contacts with the dye molecules since inverting its orientation to C-G or replacing it with I-C still led to favorable dimerization of the dye.

Benzothiazoles↗

Peptide nucleic acid (PNA): its medical and biotechnical applications and promise for the future.

Synthetic molecules that can bind with high sequence specificity to a chosen target in a gene sequence are of major interest in medicinal and biotechnological contexts. They show promise for the development of gene therapeutic agents, diagnostic devices for genetic analysis, and as molecular tools for nucleic acid manipulations. Peptide nucleic acid (PNA) is a nucleic acid analog in which the sugar phosphate backbone of natural nucleic acid has been replaced by a synthetic peptide backbone usually formed from N-(2-amino-ethyl)-glycine units, resulting in an achiral and uncharged mimic. It is chemically stable and resistant to hydrolytic (enzymatic) cleavage and thus not expected to be degraded inside a living cell. PNA is capable of sequence-specific recognition of DNA and RNA obeying the Watson-Crick hydrogen bonding scheme, and the hybrid complexes exhibit extraordinary thermal stability and unique ionic strength effects. It may also recognize duplex homopurine sequences of DNA to which it binds by strand invasion, forming a stable PNA-DNA-PNA triplex with a looped-out DNA strand. Since its discovery, PNA has attracted major attention at the interface of chemistry and biology because of its interesting chemical, physical, and biological properties and its potential to act as an active component for diagnostic as well as pharmaceutical applications. In vitro studies indicate that PNA could inhibit both transcription and translation of genes to which it has been targeted, which holds promise for its use for antigene and antisense therapy. However, as with other high molecular mass drugs, the delivery of PNA, involving passage through the cell membrane, appears to be a general problem.

Animals↗

Terminal sequences of vesicular stomatitis virus RNA are both complementary and conserved.

The nucleotide sequences at the 5' and 3' termini of RNA isolated from the New Jersey serotype of vesicular stomatitis virus [vsV(NJ)] and two of its defective interfering (DI) particles have been determined. The sequence differs from that previously demonstrated for the RNA from the Indiana serotype of VSV at only 1 of the first 17 positions from the 3' terminus and at only 2 of the first 17 positions from the 5' terminus. The 5'-terminal sequence of VSV(NJ) RNA is the complement of the 3'-terminal sequence, and duplexes which are 20 bases long and contain the 3' and 5' termini have been isolated from this RNA. The RNAs isolated from DI particles of VSV(NJ) have the same base sequences as do the RNAs from the parental virus. These results are in sharp contrast to those obtained with the Indiana serotype of VSV and its DI particles, in which the 3'-terminal sequences differ in 3 positions within the first 17. However, with both serotypes, the 3'-terminal sequence of the DI RNA is the complement of the 5'-terminal sequence of the RNA from the infectious virus. These findings suggest that the 3' and 5' RNA termini are highly conserved in both serotypes and that the 3' terminus of DI RNA is ultimately derived by copying the 5' end of the VSV genome, as recently proposed (D. Kolakofsky, M. Leppert, and L. Kort, in B. W. J. Mahy and R. D. Barry, ed., Negative-Strand Virus and the Host Cell, 1977; M. Leppert, L. Kort, and D. Kolakofsky, Cell 12:539-552, 1977; A. S. Huang, Bacteriol. Rev. 41:811-8218 1977).

Animals↗

Structural polymorphism and dynamism in the DNA segment GATCTTCCCCCCGGAA: NMR investigations of hairpin, dumbbell, nicked duplex, parallel strands, and i-motif.

Structure and dynamism in a DNA segment d-GATCTTCCCCCCGGAA have been investigated by nuclear magnetic resonance (NMR) spectroscopy. At neutral pH, the molecule exists largely as a dumbbell, formed by the association of two hairpins with sticky ends. A small percentage of hairpin is also detectable. The stem of the dumbbell, which is 12 base pairs long, has two nicks separated by 4 base pairs. The three-dimensional structures of the dumbbell and also of a 12-mer duplex, the sequence of which is identical to that of the stem of the dumbbell, have been determined by NMR in conjunction with restrained molecular dynamics calculations. It is observed that the presence of nicks causes minor changes in the structure of the duplex. Fraying at the nicks is much less than at the ends of a regular duplex. The loop shows very few nuclear Overhauser effects, which is a reflection on the greater dynamism in its structure. At lower pH, the molecule undergoes a transition to an i-motif type of structure with two parallel stranded duplexes involving C-C+ pairing, interdigitating each other. The structure is highly stable, with a melting temperature >60 degrees C.

Base Composition↗

Atomic-resolution crystal structures of B-DNA reveal specific influences of divalent metal ions on conformation and packing.

Crystal structures of B-form DNA have provided insights into the global and local conformational properties of the double helix, the solvent environment, drug binding and DNA packing. For example, structures of the duplex with sequence CGCGAATTCGCG, the Dickerson-Drew dodecamer (DDD), established a unique geometry of the central A-tract and a hydration spine in the minor groove. However, our knowledge of the various interaction modes between metal ions and DNA is very limited and almost no information exists concerning the origins of the different effects on DNA conformation and packing exerted by individual metal ions. Crystallization of the DDD duplex in the presence of Mg(2+)and Ca(2+)yields different crystal forms. The structures of the new Ca(2+)-form and isomorphous structures of oligonucleotides with sequences GGCGAATTCGCG and GCGAATTCGCG were determined at a maximum resolution of 1.3 A. These and the 1.1 A structure of the DDD Mg(2+)-form have revealed the most detailed picture yet of the ionic environment of B-DNA. In the Mg(2+)and Ca(2+)-forms, duplexes in the crystal lattice are surrounded by 13 magnesium and 11 calcium ions, respectively.Mg(2+)and Ca(2+)generate different DNA crystal lattices and stabilize different end-to-end overlaps and lateral contacts between duplexes, thus using different strategies for reducing the effective repeat length of the helix to ten base-pairs. Mg(2+)crystals allow the two outermost base-pairs at either end to interact laterally via minor groove H-bonds, turning the 12-mer into an effective 10-mer. Ca(2+)crystals, in contrast, unpair the outermost base-pair at each end, converting the helix into a 10-mer that can stack along its axis. This reduction of a 12-mer into a functional 10-mer is followed no matter what the detailed nature of the 5'-end of the chain: C-G-C-G-A-ellipsis, G-G-C-G-A-ellipsis, or a truncated G-C-G-A-ellipsis Rather than merely mediating close contacts between phosphate groups, ions are at the origin of many well-known features of the DDD duplex structure. A Mg(2+)coordinates in the major groove, contributing to kinking of the duplex at one end. While Ca(2+)resides in the minor groove, coordinating to bases via its hydration shell, two magnesium ions are located at the periphery of the minor groove, bridging phosphate groups from opposite strands and contracting the groove at one border of the A-tract.

Calcium↗

Possible active origin of replication in the double stranded extended form of the left terminus of LuIII and its implication on the replication model of the parvovirus.

BACKGROUND: The palindromic termini of parvoviruses have proven to play an essential role as origins of replication at different stages during the replication of their viral genome. Sequences from the left-end telomere of MVM form a functional origin on one side of the dimer replicative form intermediate. In contrast, the right-end origin can operate in its closed replicative form hairpin configuration or as a fully duplex linear sequence derived from either arm of a palindromic tetramer intermediate. To study the possibility that the LuIII left hairpin has a function in replication, comparable to that described for MVM, the replication of a minigenome containing two copies of the LuIII left terminus (LuIII Lt-Lt) was studied. RESULTS: The data presented demonstrates that LuIII Lt-Lt was capable of replicating when NS1 helper functions were provided in trans. This extended hairpin, capable of acting as an origin of replication, lacks the arrangement of the specific domains present in the dimer duplex intermediate of MVM, the only active form of the left hairpin described for this parvovirus. CONCLUSIONS: These findings suggest that the left hairpin of LuIII has an active NS1 driven origin of replication at this terminus in the double stranded extended form. This difference between LuIII and MVM has great implications on the replication of these viruses. The presence of origins of replication at both the left and right termini in their natural hairpin form can explain the unique encapsidation pattern observed for LuIII hinting on the mechanism used by this virus for the replication of its viral genome.

Cloning, Molecular↗

Sequence-specific binding and cleavage of duplex DNA by a radioiodinated, intercalator-linked, triplex-forming oligonucleotide.

Applications of oligodeoxynucleotides to modulate gene expression have been the subject of much recent research. We have sought to develop a method to permanently inactivate a gene, or potentially kill cells containing abnormal genes. In this report, we show that a DNA intercalator conjugated to a triplex-forming oligonucleotide can be labeled with an Auger electron emitting radioisotope, can cleave its duplex DNA target, and can specifically bind the target sequence contained in a total of 10 kilobases of irrelevant DNA.

Autoradiography↗

Direct demonstration in synthetic oligonucleotides that N,N'-bis(2-chloroethyl)-nitrosourea cross links N1 of deoxyguanosine to N3 of deoxycytidine on opposite strands of duplex DNA.

The sequence specificity and covalent structure of the lesion caused by the DNA interstrand cross-linking reaction of N,N'-bis(2-chloroethyl)-nitrosourea (BCNU) were investigated using synthetic oligonucleotides. The efficiency of interstrand cross-linking was found to parallel the efficiency of monoadduct formation, preferring deoxyguanosine-deoxycytidine-rich duplexes and, particularly, runs of deoxyguanosine. No explicit sequence specificity was observed. Enzymatic digestion of purified, interstrand cross-linked DNA returned primarily the unmodified deoxynucleosides, along with 1-[N3-deoxycytidyl]-2-[N1-deoxyguanosyl]ethane. This substance was characterized by comparison of its mass spectrum, high-pressure liquid chromatography retention time, and UV spectrum to an authentic standard prepared by chemical synthesis. These studies provide the first direct evidence that BCNU has no strong sequence preference for interstrand cross-linking and that substance 4, which has been previously isolated from BCNU-treated DNA, derives from alkylation on opposite strands of DNA. The lack of sequence preference and lesion structure together suggest that one source of BCNU interstrand cross-links is linkage of deoxyguanosine and deoxycytidine partners from a single bp.

Animals↗

Association of Arabidopsis topoisomerase IIA cleavage sites with functional genomic elements and T-DNA loci.

Topoisomerase IIA (Topo IIA) is an essential ubiquitous enzyme involved in controlling DNA topology during multiple processes of genome function, and has been implicated in the generation of double-stranded breaks (DSB) in genomic DNA prior to DNA integration in plant genomes. Despite extensive characterization of type II topoisomerases from bacteria, viruses and animals, no studies on the specificity of plant Topo IIA-mediated DNA cleavage have been reported. We mapped and characterized Arabidopsis thaliana Topo IIA (AtTopoIIA) cleavage sites and demonstrated that they were cleaved in vivo. The consensus for the AtTopoIIA cleavage sites (ANNNRN downward arrowGTACNTNNNY) was significantly different from recognition sequences reported for Topo IIA from other organisms. The mapped cleavage sites were abundant in the Arabidopsis genome, exhibited a weak consensus, and were cleaved with relatively low efficiency. Use of the systematic evolution of ligands by exponential enrichment (SELEX) protocol identified a single, efficiently cleaved sequence TATATATATGTATATATATA that was over-represented in the genome. The mapped AtTopoIIA cleavage sites and the SELEX sites differed in their genomic distribution and associations with gene regulatory elements, matrix attachment regions, stress-induced DNA duplex destabilization sequences and T-DNA loci, suggesting different genome functions. Mapped AtTopoIIA sites but not SELEX sites were strongly associated with T-DNA integration sites, providing evidence for the involvement of AtTopoIIA-mediated DSB formation in T-DNA integration.

Amino Acid Sequence↗

Sequencing heavy- and light-chain variable genes of single B-hybridoma cells by total enzymatic amplification.

We have devised a protocol to obtain accurate and complete sequences of the immunoglobulin heavy- and light-chain variable-region (VH and VL) genes of single B-hybridoma cells that express defined V genes. The amplification achieved ranges from 2 x 10(13)- to 1 x 10(14)-fold. Only one potential Taq DNA polymerase error was observed in 7590 nucleotides of sequence, thus permitting the identification of naturally occurring somatic mutations. The two-step nature of the amplification protocol provides sufficient DNA for a minimum of 160 sets of sequencing reactions of both the VH and VL genes from one cell without cloning. The amplification of relatively long segments of DNA in the first step of the protocol permits second-step amplification and sequencing of regions that flank VH and VL codons. Fractionating cellular lysates prior to the first step of amplification permits the separate amplification of V genes on opposite sister chromatids and possibly on opposite strands of the same DNA duplex. Accurate sequencing of VH and VL genes of defined germ-line origin that are expressed by single B cells taken directly from the animal is thus made feasible by this approach.

Animals↗

Sequence motifs in the replicator protein of parvovirus MVM essential for nicking and covalent attachment to the viral origin: identification of the linking tyrosine.

Parvoviral DNA replication has many features in common with prokaryotic rolling circle replication (RCR), including the pivotal role of an initiator protein which introduces a site-specific, single strand nick into a duplex origin sequence. In this process, the protein becomes covalently attached to the new 5' end of the DNA, while making available a 3' hydroxyl to prime de novo synthesis. Sequence comparisons of prokaryotic RCR initiators has revealed a set of three common motifs, two of which, a putative metal coordination site and a downstream active-site tyrosine motif, could be tentatively identified in parvoviral replicator proteins. We have introduced mutations into the NS1 gene of the murine parvovirus minute virus of mice (MVM), in the putative metal coordination site at H129, and into the three candidate tyrosine motifs at Y188, Y197, and Y210. Histidine-tagged mutant proteins were expressed in HeLa cells from recombinant vaccinia virus vectors and partially purified. None of the mutant proteins were able to initiate replication of origin-containing plasmids in vitro, and each showed impaired site-specific binding to the viral origin, with Y188 and Y197 being most severely defective. If this deficiency was minimized using low salt conditions, however, Y188 and Y197 mutant proteins were able to nick and become covalently attached to origin DNA, whereas Y210 and H129 mutant proteins were not, suggesting that the latter residues are part of the catalytic site of the NS1 nickase. Transfer of [32P]phosphate from substrate DNA to NS1, followed by cyanogen bromide cleavage of the complex, gave the single, labeled peptide consistent with Y210 being the linking tyrosine.

Amino Acid Sequence↗

Calving sex ratio as related to the predicted Y-chromosome-bearing spermatozoa ratio in bull ejaculates.

The first objective was to correlate calving sex-ratio data from semen lots with the semen sex ratio obtained by two duplex polymerase chain reaction (PCR)/gel electrophoresis techniques. The two techniques involved different starting DNA amounts, PCR conditions, agarose gel concentrations, sample placement on the gels, lane size, number of lanes per gel, and duration of electrophoresis. The second objective was to sequence the duplex PCR products to verify their match to genes and chromosomes for which they were designed. Thirty-six ejaculates (lots) from eight Holstein sires were collected. Semen straws were distributed among dairies in three states. Ten straws per lot were used for the different PCR techniques. Sperm DNA was extracted and PCR analysis was done using one primer set to amplify a single copy section of the factor IX precursor (X-chromosome only) and another primer set to amplify a single copy section the sex determining region (Y-chromosome only). The glyceraldehyde phosphate dehydrogenase gene was amplified as an internal control. Standard curves were designed using PCR products in known ratios. Gel electrophoresis and image analysis were used to determine predicted %Y-chromosome-bearing spermatozoa (PredPtY). Sex (male=1, female=0) was reported on 526 calves and the ratio of the number of male to total calves (proportion of male calves (PMC)) was determined between sire and lot within sire. The PredPtY and PMC were significantly correlated (r=0.82, P<0.0002). No significant variance between sires was found in PredPtY or PMC, but lots within sires was a significant variance source for both. The two PCR technologies adequately determined semen sex ratio. The technology-by-lot-within-sire interaction was a significant variance source for PredPtY. Acrosomal integrity (after a 2-h) incubation, was correlated with both PMC and PredPtY; other semen quality characteristics had no significant correlations with PMC or PredPtY. Therefore, calf crop sex ratio skewness could be controlled by screening semen for PredPtY through the use of PCR.

Animals↗