SEARCH · PubMed Health
Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.
Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.
A novel nucleoside analogue, 2'-naphthylmethyl-2'-deoxytubercidine, is synthesized and incorporated in oligonucleotides that stabilize bulges in partially complementary RNA.
RNA polymerase I of Saccharomyces cerevisiae is composed of 14 subunits. All of the corresponding genes have been cloned with the exception of the RPA14 gene encoding A14, a specific polypeptide of this enzyme. We report the cloning and the characterization of RPA14. The A14 polypeptide was separated from the other RNA polymerase I subunits by reverse-phase high pressure liquid chromatography and digested with proteinase K. Based on the amino acid sequence of one of the resulting peptides, a degenerate oligonucleotide was synthesized and used to isolate the RPA14 gene from a yeast subgenomic DNA library. RPA14 is a single copy gene that maps to chromosome IV and is flanked by CYP1 and HOM2. Disruption of RPA14 is not lethal, but growth of the rpa14::URA3 mutant strain is impaired at 37 and 38 degrees C. RNA polymerase I was purified from the rpa14::URA3 strain. After two purification steps, the enzyme did not contain the subunits A14, ABC23, and A43. This form of the enzyme was not active in a nonspecific in vitro transcription assay. These results demonstrate that A14 is a genuine subunit of RNA polymerase I and suggest that A14 plays a role in the stability of a subgroup of subunits.
Mitochondria are well known as the cellular power factory. Much less is known about these organelles as a genetic system. This is particularly true for mitochondria of plants, which subsist with respect to attention by the scientific community in the shadow of the chloroplasts. Nevertheless the mitochondrial genetic system is essential for the function of mitochondria and thus for the survival of the plant. In plant mitochondria the pathway from the genetic information encoded in the DNA to the functional protein leads through a very diverse RNA world. How the RNA is generated and what kinds of regulation and control mechanisms are operative in transcription are current topics in research. Furthermore, the modes of posttranscriptional alterations and their consequences for RNA stability and thus for gene expression in plant mitochondria are currently objects of intensive investigations. In this article current results obtained in the examination of plant mitochondrial transcription, RNA processing, and RNA stability are illustrated. Recent developments in the characterization of promoter structure and the respective transcription apparatus as well as new aspects of RNA processing steps including mRNA 3' processing and stability, mRNA polyadenylation, RNA editing, and tRNA maturation are presented. We also consider new suggestions concerning the endosymbiont hypothesis and evolution of mitochondria. These novel considerations may yield important clues for the further analysis of the plant mitochondrial genetic system. Conversely, an increasing knowledge about the mechanisms and components of the organellar genetic system might reveal new aspects of the evolutionary history of mitochondria.
The nucleocapsid (NC) protein of the human immunodeficiency virus-1 (HIV-1) plays an important role in the encapsidation of viral RNA and assembly of viral particle. Since the NC protein is resistant for mutation, it might be an excellent target for the anti-viral therapy. RNA aptamers that bind to the mature form of the NC protein were isolated from a RNA library. Surface plasmon resonance measurement and gel shift assay showed that the RNA aptamers specifically bind to the NC protein with high affinity and compete for the psi RNA binding to the NC protein. Mapping of the RNA aptamer showed at least two sites for the protein binding, suggesting a multiple and cooperative binding by the NC to RNA. In addition, the circular form of RNA avidly binds to the NC protein as a linear counter does. Stabilized RNA aptamer is expected to act as an inhibitor for the viral packaging.
Hydrogen bond networks stabilize RNA secondary and tertiary structure and are thus essentially important for protein recognition. During structure refinements using either NMR or X-ray techniques, hydrogen bonds were usually inferred indirectly from the proximity of donor and acceptor functional groups. Recently, quantitative heteronuclear J(N,N)-HNN COSY NMR experiments were introduced that allowed the direct identification of donor and acceptor nitrogen atoms involved in hydrogen bonds. However, protons involved in base pairing interactions in nucleic acids are often not observable due to exchange processes. The application of a modified quantitative J(N,N)-HNN COSY pulse scheme permits observation of(2h)J(N,N) couplings via non-exchangeable protons. This approach allowed the unambiguous identification of the A27.U23 reverse Hoogsteen base pair involved in a U-A.U base triple in the HIV-2 transactivation response element-argininamide complex. Despite a wealth of NOE information, direct evidence for this interaction was lacking due to the rapid exchange of the U23 imino proton. The ability to directly observe hydrogen bonds, even in D(2)O and in the presence of rapid exchange, should facilitate structural studies of RNA.
The proposed single-hammerhead structure of the self-cleaving newt RNA is unstable due to a weak stem III and therefore is unable to mediate self-cleavage. A double-hammerhead structure with greater theoretical stability has been shown to mediate the self-cleavage of this RNA (Forster et al., 1988, Nature 334, 265). We have found that the double-hammerhead mediated self-cleavage reaction of a 40 base RNA containing the newt sequence (termed nCG) can be converted to a single-hammerhead reaction by increasing the size of stem III and/or of its loop, thereby enabling a single-hammerhead structure to form. In addition, the 5'-self-cleavage fragment of the nCG RNA can act in trans to mediate the self-cleavage of a full-length RNA by the formation of a partial double-hammerhead structure.
SUMMARY: This paper attempts to determine an optimal fixation protocol for stabilizing RNA during microdissection so as to obtain high-quality RNA from specific cell populations procured from esophageal carcinoma specimens, and to develop a manual microdissection that can facilitate the procurement. The special features of our protocol include one-step dehydration of tissue sections in 100% ethanol immediately after cryosectioning, a self-made T-shape plate (T plate) and "exclusion microdissection" procedure. The quality of RNA isolated from dissected cells was analyzed by neutral agarose gel electrophoresis and reverse transcription-polymerase chain reaction (RT-PCR) to detect genes of different abundance levels. One-step 100% ethanol fixation of cryosections effectively stabilized RNA integrity for agelong period of time while maintaining histological morphology comparable to that using the conventional procedure, indicating that it is a valid protocol for preservation of RNA in microdissected samples. In conjunction with the application of the T plate and 'exclusion microdissection' procedure, which efficiently simplifies manual microdissection procedure, allowing maximal procurement of target cells from complex primary tissues, full use of every single specimen for maximal procurement of target cells from the sections was allowed. The RNA isolated from 5 different stage-specific cell populations of an esophageal carcinoma specimen was of high quality and sufficient in quantity for various downstream molecular analyses. Our method is suitable for a wide spectrum of expression analysis in diverse clinical settings.
RNA secondary structure, stability and melting curves are calculated for a model of a possible ribozyme corresponding to the RNA directed RNA polymerase (ribopolymerase) required in the RNA world. From these calculations, rates of folding and hybridisation are estimated and used in a stochastic simulation of the dynamics of a population of ribopolymerase molecules. Two models are considered: one synthesising a conventional antiparallel reverse complementary transcript and one synthesising a parallel complementary transcript. It was found that the latter system can operate much more effective in the higher temperatures thought to prevail during the RNA world.
Cyclooxygenase-2 (COX-2) expression is normally tightly regulated. However, constitutive overexpression plays a key role in colon carcinogenesis. To understand the molecular nature of enhanced COX-2 expression detected in colon cancer, we examined the ability of the AU-rich element-containing (ARE-containing) 3' untranslated region (3'UTR) of COX-2 mRNA to regulate rapid mRNA decay in human colon cancer cells. In tumor cells displaying enhanced growth and tumorigenicity that is correlated with elevated COX-2, vascular endothelial growth factor (VEGF), and IL-8 protein levels, the corresponding mRNAs were transcribed constitutively and turned over slowly. The observed mRNA stabilization is owing to defective recognition of class II-type AREs present within the COX-2, VEGF, and IL-8 3'UTRs; c-myc mRNA, containing a class I ARE decayed rapidly in the same cells. Correlating with cellular defects in mRNA stability, the RNA-binding of trans-acting cellular factors was altered. In particular, we found that the RNA-stability factor HuR binds to the COX-2 ARE, and overexpression of HuR, as detected in tumors, results in elevated expression of COX-2, VEGF, and IL-8. These findings demonstrate the functional significance rapid mRNA decay plays in controlling gene expression and show that dysregulation of these trans-acting factors can lead to overexpression of COX-2 and other angiogenic proteins, as detected in neoplasia.
The basic fibroblast growth factor (FGF-2) gene is transcribed bidirectionally to yield multiple sense (coding) transcripts and a unique 1.5 kb antisense transcript which may regulate sense RNA stability. The antisense RNA also contains a long open reading frame that predicts a hypothetical protein with homology to the prokaryotic MutT antimutator proteins. However, translation of this protein has not previously been demonstrated. We employed antibodies against the conserved MutT-domain of the deduced human FGF-2 antisense protein (GFG) to demonstrate expression of an immunoreactive 24 kDa protein in liver extracts from Xenopus laevis, and two proteins of 28 and 35 kDa in rat liver. In rats, GFG protein expression detected by western blot was tissue-specific and correlated with the level of FGF-2 antisense mRNA expression. These findings demonstrate that, in addition to its possible RNA regulatory function, the FGF-2 antisense transcript is translated into a conserved MutT-related protein.
The production and removal of regulatory RNAs must be controlled to ensure proper physiological responses. SsrA RNA (tmRNA), a regulatory RNA conserved in all bacteria, is cell cycle regulated and is important for control of cell cycle progression in Caulobacter crescentus. We report that RNase R, a highly conserved 3' to 5' exoribonuclease, is required for the selective degradation of SsrA RNA in stalked cells. Purified RNase R degrades SsrA RNA in vitro, and is kinetically competent to account for all SsrA RNA turnover. SmpB, a tmRNA-binding protein, protects SsrA RNA from RNase R degradation in vitro, and the levels of SmpB protein during the cell cycle correlate with SsrA RNA stability. These results suggest that SmpB binding controls the timing of SsrA RNA degradation by RNase R. We propose a model for the regulated degradation of SsrA RNA in which RNase R degrades SsrA RNA from a non-tRNA-like 3' end, and SmpB specifically protects SsrA RNA from RNase R. This model explains the regulation of SsrA RNA in other bacteria, and suggests that a highly conserved regulatory mechanism controls SsrA activity.
We used a protoplast system to study the mechanisms involved in the generation and evolution of defective interfering (DI) RNAs of tomato bushy stunt tombusvirus (TBSV). Synthetic transcripts corresponding to different naturally occurring TBSV DI RNAs, or to various artificially constructed TBSV defective RNAs, were analyzed. The relative levels of competitiveness of different DI RNAs were determined by coinoculating their corresponding transcripts into protoplasts along with helper genomic RNA transcripts and monitoring the level of DI RNA accumulation. Further studies were performed to assess the contribution of naked DI RNA stability and DI RNA encapsidation efficiency to the observed levels of competitiveness. In addition, the ability of various defective RNAs to evolve to alternative forms was tested by serially passaging protoplast infections initiated with transcripts corresponding to helper genomic RNA and a single type of defective RNA. These studies, and the analysis of the sequences of observed recombinants, indicate that (i) replication competence is a major factor dictating DI RNA competitiveness and is likely a primary determinant in DI RNA evolution, (ii) DI RNAs are capable of evolving to both smaller and larger forms, and the rates at which various transitions occur differ, (iii) DI RNA-DI RNA recombination and/or rearrangement is responsible for the formation of the evolved RNA molecules which were examined, and (iv) sequence complementarities between positive- and negative-sense strands in the regions of the junctions suggest that, in some cases, base pairing between an incomplete replicase-associated nascent strand and acceptor template may mediate selection of recombination sites. On the basis of our data, we propose a stepwise deletion model to describe the temporal order of events leading to the formation of tombusvirus DI RNAs.
The regulation of gene expression is a fundamental cellular process that is controlled at multiple levels. Abnormal regulation of gene expression has been directly implicated in the pathogenesis of some diseases of animals and humans and may contribute to the disease process in unrecognized ways in many others. Furthermore, novel treatment strategies for a number of different diseases may hinge upon our ability to exploit mechanisms that normally alter the expression of endogenous genes. While the study of gene regulation has traditionally focused on transcription as a major regulator of gene expression, it has recently become apparent that the post-transcriptional control of gene expression may play an equally important role. In particular, rapid, context-specific regulation of the stability of mRNA transcripts encoding highly active proteins, such as cytokines, growth factors, oncogenes and cell-cycle regulators, appears to play a key role in the control of these molecules and the processes they mediate. Many of the known regulatory pathways for mRNA stability involve proteins that interact with specific AU-rich elements in the 3'-untranslated region of the transcript. This review will address some important aspects of the normal regulation of mRNA stability and known or potential contributions of RNA stability regulation to health and disease.
We reported that RNA condensed on protamine is protected from RNase-mediated degradation and can be used for vaccination. Here, we show that such complexes are also danger signals that activate mouse cells through a MyD88-dependent pathway. Moreover, mRNA-protamine complexes stimulate human blood cells. They strongly activate DC and monocytes, leading to TNF-alpha and IFN-alpha secretion. In addition, protamine-RNA complexes directly activate B cells, NK cells and granulocytes. The detailed analysis of the activated cell types, the study of the cytokines released from PBMC cultured with protamine-RNA complexes and recently published results suggest that TLR-7 and TLR-8 may be involved in the recognition of protamine-stabilized RNA. Our data indicate that protamine-stabilized RNA, which may be similar to RNA condensed in the nucleocapsids of RNA viruses, is a strong danger signal. Thus, similarly to plasmid DNA, protamine-RNA combines antigen production and non-specific immunostimulation. The studies presented here explain the capacity of protamine-RNA to act as a vaccine, and pave the way towards the development of safe and efficient mRNA-based immunotherapies.
Site-directed mutations were introduced in the connecting loops and one of the two stem regions of the RNA pseudoknot in the tRNA-like structure of turnip yellow mosaic virus RNA. The kinetic parameters of valylation for each mutated RNA were determined in a cell-free extract from wheat germ. Structure mapping was performed on most mutants with enzymic probes, like RNase T1, nuclease S1 and cobra venom ribonuclease. An insertion of four A residues in the four-membered connecting loop L1 that crosses the deep groove of the pseudoknot reduces aminoacylation efficiency. Deletions up to three nucleotides do not affect aminoacylation or RNA pseudoknot formation. Deletion of the entire loop abolishes aminoacylation. Although elimination of the pseudoknot is presumed, this could not be demonstrated. Unlike the mutations in loop L1, all mutations in the three-membered connecting loop L2 that crosses the shallow groove of the RNA pseudoknot decrease the aminoacylation efficiency considerably. Nonetheless, the RNA pseudoknot is still present in most mutated RNAs. These results indicate that a number of mutations can be introduced in both loops without abolishing aminoacylation. Results obtained with the introduction of mismatches and A.U base-pairs in stem S1 of the pseudoknot, containing three G.C base-pairs in wild-type RNA, indicate that the pseudoknot is only marginally stable. Our estimation of the gain of free energy due to the pseudoknot formation is at most 2.0 kcal/mol. The pseudoknot structure can, however, be stabilized upon binding the valyl-tRNA synthetase.
The effects of ionic conditions, loop size and loop sequence on the formation of pseudoknots by RNA oligonucleotides have been investigated using biochemical and biophysical methods. An oligonucleotide with the sequence 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' and oligonucleotides with variations in the sequences of the two loop regions, denoted by bold face type, were studied. Each sequence with the potential to form a pseudoknot can also form two stable hairpins. The pseudoknot structure is stabilized relative to the hairpins by addition of Mg2+. Even in the presence of Mg2+, the pseudoknots formed by the sequences investigated are only marginally more stable (1.5 to 2 kcal mol-1 in free energy at 37 degrees C) than either of the constituent hairpins. The pseudoknot structure is the stable conformation in the presence of Mg2+ when the first loop region is at least three nucleotides and the second is at least four nucleotides. Further deletion of nucleotides from the loop regions stabilizes possible hairpin structures relative to the pseudoknot and equilibria among secondary and tertiary structures result.
The 5' untranslated regions (UTRs) of (+)-strand RNA viruses play a variety of roles in the reproductive cycles of these infectious agents. Tomato bushy stunt virus (TBSV) belongs to this class of RNA virus and is the prototype member of the genus Tombusvirus. Previous studies have demonstrated that a T-shaped domain (TSD) forms in the 5' half of the TBSV 5' UTR and that it plays a central role in viral RNA replication. Here we have extended our structure-function analysis to the 3' half of the 5' UTR. Investigation of this region in the context of a model viral replicon (i.e., a TBSV-derived defective interfering [DI] RNA) revealed that this segment contains numerous functionally relevant structural features. In vitro solution structure probing along with comparative and computer-aided RNA secondary structure analyses predicted the presence of a simple stem loop (SL5) followed by a more complex downstream domain (DSD). Both structures were found to be essential for efficient DI RNA accumulation when tested in a plant protoplast system. For SL5, maintenance of the base of its stem was the principal feature required for robust in vivo accumulation. In the DSD, both helical and unpaired regions containing conserved sequences were necessary for efficient DI RNA accumulation. Additionally, optimal DI RNA accumulation required a TSD-DSD interaction mediated by a pseudoknot. Modifications that reduced accumulation did not appreciably affect DI RNA stability in vivo, indicating that the DSD and SL5 act to facilitate viral RNA replication.
Equilibrium unfolding (folding) studies reveal that the autoregulatory RNA pseudoknots derived from the bacteriophage T2 and T4 gene 32 mRNAs exhibit significant stabilization by increasing concentrations of divalent metal ions in solution. In this report, the apparent affinities of exchange inert trivalent Co(NH(3))(3+)(6) have been determined, relative to divalent Mg(2+), for the folded, partially folded (K(f)), and fully unfolded (K(u)) conformations of these molecules. A general nonspecific, delocalized ion binding model was developed and applied to the analysis of the metal ion concentration dependence of individual two-state unfolding transitions. Trivalent Co(NH(3))(3+)(6) was found to associate with the fully folded and partially unfolded pseudoknotted forms of these RNAs with a K(f) of 5-8 x 10(4) M(-1) in a background of 0.10 M K(+), or 3- to 5-fold larger than the K(f) obtained for two model RNA hairpins and hairpin unfolding intermediates, and approximately 40-50-fold larger than K(f) for Mg(2+). The magnitude of K(f) was found to be strongly dependent on the monovalent salt concentration in a manner qualitatively consistent with polyelectrolyte theory, with K(f) reaching 1.2 x 10(5) M(-1) in 50 mM K(+). Two RNA hairpins were found to have affinities for Co(NH(3))(3+)(6) and Ru(NH(3))(3+)(6) of 1-2 x10(4) M(-1), or approximately 15-fold larger than the K(f) of approximately 1000 M(-1) observed for Mg(2+). Additionally, the K(u) of 4,800 M(-1) for the trivalent ligands is approximately 8-fold larger than the K(u) of 600 M(-1) observed for Mg(2+). These findings suggest that the T2 and T4 gene 32 mRNA pseudoknots possess a site(s) for Mg(2+) and Co(NH(3))(3+)(6) binding of significantly higher affinity than a "duplexlike" delocalized ion binding site that is strongly linked to the thermodynamic stability of these molecules. Imino proton perturbation nmr spectroscopy suggests that this site(s) lies near the base of the pseudoknot stem S2, near a patch of high negative electrostatic potential associated with the region where the single loop L1 adenosine crosses the major groove of stem S2.