PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “ASCOMYCETES”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 271 records · Page 15Linked to original sources
PubMed1998

Genome analysis of filamentous fungi: identification and characterization of an unusual GT-rich minisatellite in the ascomycete Podospora anserina.

A genomic DNA fragment, PaGT7-5, of Podospora anserina was cloned that contains three different repetitive sequence motifs including a minisatellite with an unusual structure. This element, PaMin1, consists of ten copies of a 16 bp repeat unit with five GT dinucleotide repeats. Adjacent to PaMin1, a short poly(GT) stretch and four repeats of a 12 bp sequence were identified. Six alleles which differ in the number of the minisatellite unit were demonstrated in 18 different P. anserina strains. The flanking sequences of PaMin1 did not display any sequence alterations. A PCR analysis of total DNA from cultures of different age revealed no sequence changes, indicating that this repetitive DNA remains stable during aging. Southern-blot hybridization experiments of DNA from different strains detected only minor fragment length polymorphisms in the immediate vicinity of PaMin1. In contrast, major polymorphisms were observed at a greater distance from the locus indicating that this locus can be used as an informative probe to discriminate between different P. anserina strains.

Alleles↗
PubMed2001

Molecular characterisation and polymorphism of MinLm1, a minisatellite from the phytopathogenic ascomycete Leptosphaeria maculans.

A sequence-characterised amplified region marker was identified in the phytopathogenic fungus Leptosphaeria maculans, which generated a single-banding pattern corresponding to six alleles showing size polymorphism between L. maculans field isolates. The size polymorphism was due to 2-7 tandem repeats of the 23-bp motif 5' TCTTACTTACATACACACCTCCC 3'. The repeated sequence, termed MinLm1, shares many features specific to minisatellites, e.g. a very strong G/C strand asymmetry, the presence of 6-bp direct repeats at both ends of the sequence and its occurrence in a region rich in microsatellites such as (CT)n, (ATG)n, (GTG)n and (CAT)n. MinLm1 shows a very high degree of conservation of the bases from one repeat to another and from one isolate to another (percent match range: 99.6-100%), whatever their geographical or temporal relatedness. MinLm1 is a single-locus minisatellite located on chromosomes sized 2.79 Mb and 2.48 Mb, of L. maculans isolates a.2 and H5, respectively. In agricultural populations of L. maculans, two alleles of MinLm1 were prevalent, corresponding to 2x and 5x repeats of the core motif. Differences in allele frequencies were observed in some cropping conditions, suggesting that MinLm1 is an informative marker for epidemiological studies of the pathogen.

Alleles↗
PubMed2001

Agrobacterium tumefaciens-mediated genetic transformation of the phytopathogenic ascomycete Calonectria morganii.

Conidia of the phytopathogenic fungus Calonectria morganii were transformed to hygromycin B resistance using the hph gene of Escherichia coli as the selective trait, governed by a heterologous fungal promoter and the Aspergillus nidulans trpC terminator. Agrobacterium tumefaciens-mediated transformation yielded stable hygromycin B-resistant clones (average number (106 per 10(7)) [corrected] conidia). Putative transformants appeared to be mitotically and meiotically stable. The presence of the hph gene was checked by PCR. In four randomly chosen transformants, single-copy integrations of the marker gene at different chromosomal sites were proven by Southern analysis.

Agrobacterium tumefaciens↗
PubMed1997

A meiotically reproducible chromosome length polymorphism in the ascomycete fungus Ophiostoma ulmi (sensu lato).

We have followed the transmission of Ophiostoma ulmi s.l. chromosome length polymorphisms (CLPs) into the F2 generation to determine the reproducibility of a genome rearrangement culminating in the conversion of a 1.0 Mb chromosome into a 800 kb chromosome. The 1.0 Mb chromosome in strain CESS16K is thus far unique among O ulmi s.l. wild-type strains, as no other wild-type strains have been observed with chromosomes smaller than 2.3 Mb. It has been previously shown that the 1.0 Mb chromosome is mitotically stable, carries at least one normally expressed gene, and is transmitted through meiosis. In this study, a series of crosses were performed to further elucidate the pattern of inheritance of the 1.0 Mb chromosome and the process of conversion of the 1.0 Mb species to 800 kb. In crosses where the 1.0 Mb chromosome was allowed to pair with itself or with the 800 kb chromosome, all progeny inherited a copy of the 1.0 Mb or 800 kb form, further demonstrating the A-type nature of these small chromosomes. When a cross was repeated between the strains CESS16K (1.0 Mb chromosome) and FG245Br-O (no 1.0 Mb or 800 kb chromosome), the occurrence of a 800 kb chromosome was observed in 9% of the progeny. A reciprocal cross between an 800 kb strain and a strain with no 800 kb or 1.0 Mb chromosome was conducted, and a progeny strain containing a 1.0 Mb chromosome was recovered. The reproducibility and reciprocality of the 1.0 Mb to 800 kb chromosome conversion demonstrates that meiotic processes are responsible for this CLP, and that O. ulmi s.l. strains with various divergent genome architectures can remain sexually compatible.

Ascomycota↗
PubMed1997

Allelic variation at a hypervariable compound microsatellite locus in the ascomycete Ascochyta rabiei.

The genome of the fungal chickpea pathogen Ascochyta rabiei was screened for polymorphisms by microsatellite-primed PCR. While ethidium-bromide staining of electrophoretically separated amplification products showed only limited polymorphism among 24 Tunisian A. rabiei isolates, Southern hybridization of purified PCR fragments to restriction digests of fungal DNA revealed polymorphic DNA fingerprints. One particular probe that gave rise to a hypervariable single-locus hybridization signal was cloned from the Syrian isolate AA6 and sequenced. It contained a large compound microsatellite harbouring the penta- and decameric repeat units (CATTT)n, (CATTA)n, (CATATC-ATTT)n and (TATTT)n. We call this locus ArMS1 (Ascochyta rabiei microsatellite 1). Unique flanking sequences were used to design primer pairs for locus-specific microsatellite amplification and direct sequencing of additional ArMS1 alleles from Tunisian and Pakistani isolates. A high level of sequence variation was observed, suggesting that multiple mutational mechanisms have contribute to polymorphism. Hybridization and PCR analyses were performed on the parents and 62 monoascosporic F1 progeny derived from a cross between two different mating types of the fungus. Progeny alleles could be traced back to the parents, with one notable exception, where a longer than expected fragment was observed. Direct sequencing of this new length allele revealed an alteration in the copy number of the TATTT repeat [(TATTT)53 to (TATTT)65], while the remainder of the sequence was unchanged.

Ascomycota↗
PubMed2000

Ambient pH signalling in ascomycetous yeasts involves homologues of the Aspergillus nidulans genes palF and paIH.

In Yarrowia lipolytica, the transcription factor Rim101p mediates both pH regulation and control of mating and sporulation. Like its homologues PacC of Aspergillus nidulans and Rim101p of Saccharomyces cerevisiae, Y1Rim101p is activated by proteolytic C-terminal processing, which occurs in response to a signal transduced by a pathway involving several PAL gene products. We report here the cloning and sequencing of two of these genes, PAL2 and PAL3. PAL2 encodes a putative 632-residue protein with six possible transmembrane segments, which differs from the transmembrane proteins Rim9p of S. cerevisiae and Pall of A. nidulans, but is homologous to A. nidulans Pa1H and to the product of the ORF YNL294c, a predicted polypeptide of unknown function in S. cerevisiae. PAL3 encodes an 881-residue polypeptide that is homologous to PalF of A. nidulans and to a newly identified putative polypeptide of S. cerevisiae. Both PAL2 and PAL3 are expressed constitutively, regardless of ambient pH. Mutations in these genes affect growth at alkaline pH and sporulation in both Y. lipolytica and in S. cerevisiae. They affect invasiveness of haploid strains in S. cerevisiae only, and conjugation in Y. lipolytica only. These results highlight the conservation of the Pal pathway initially described in A. nidulans.

Amino Acid Sequence↗
PubMed2005

Molecular characterization of a partitivirus from the plant pathogenic ascomycete Rosellinia necatrix.

The W8 isolate of the phytopathogenic fungus, Rosellinia necatrix that causes white root rot, contained three segments of double-stranded (ds) RNA, namely L1, L2 and M. Purified viral particles of about 25 nm in diameter contained an RNA segment with almost the same mobility as M-dsRNA, but the band was sensitive to S1 nuclease. Molecular analysis revealed that M-dsRNA consisted of two (RNA 1 and RNA 2) similarly sized species of 2299 and 2279 bp excluding an interrupted poly (A or U) tail of 16-51 bp. The predicted largest open reading frame in RNA 1 and RNA 2 was similar to those of RNA dependent RNA polymerase (RdRp) and coat protein (CP), respectively, encoded by the family Partitiviridae. The non-coding regions (NCR) of the two segments were similar (approximately 70% base identity) at the 5' end, but different at the 3' end. The NCR at the 3' end contained adenosine-uracil rich elements (AREs) in both segments. Northern analyses revealed RNA 1 and RNA 2 in mycelial and viral particle fractions. We coined the name Rosellinia necatrix partitivirus 1-W8 (RnPV1-W8) for M-dsRNA based on viral particle morphology and sequence information.

Amino Acid Sequence↗
PubMed1986

A cloned tryptophan-synthesis gene from the ascomycete Cochliobolus heterostrophus functions in Escherichia coli, yeast and Aspergillus nidulans.

A gene (TRP1) in the tryptophan biosynthetic pathway of the fungal plant pathogen Cochliobolus heterostrophus was isolated by complementation of an Escherichia coli trpF mutant which lacked phosphoribosylanthranilate isomerase (PRAI) activity. The cloned gene also complemented an E. coli trpC mutant lacking indoleglycerolphosphate synthase (IGPS) activity, a yeast trp1 mutant missing PRAI activity and an Aspergillus nidulans trpC mutant. It functioned in E. coli and A. nidulans without apparent rearrangement but in yeast only after the 5' end of the gene was deleted. The gene was subcloned on a 4.65-kb DNA fragment and the PRAI domain was localized to a 2.9-kb region. It showed homology to the A. nidulans trpC and Neurospora crassa trp-1 genes. There was one predominant transcript of C. heterostrophus TRP1, the same size (2.6-kb) as one of the two functional transcripts produced by A. nidulans trpC. The constitutive activity of the C. heterostrophus TRP1 gene was high whereas that of the A. nidulans trpC gene was low.

Aldose-Ketose Isomerases↗
PubMed1993

Formation of morphological differentiation patterns in the ascomycete Neurospora crassa.

Morphological differentiation patterns--among them concentric rings and radial zonations--can be induced in the band-mutant of Neurospora crassa by appropriate experimental conditions, in particular by a mere shift of certain salt concentrations in the medium. The role of initial experimental conditions is examined and, furthermore, the influences of artificially induced phase differences are analyzed with respect to pattern formation. While the concentric ring pattern is due to some (endogenous) circadian rhythmicity within every hypha, nothing is known about the underlying mechanism of radial zonation development. Various hypotheses were tested with the help of a cellular automaton model which mimics growth, branching and differentiation of a fungal mycelium. In particular, sufficient conditions are provided which imply the formation of radial spore zonations. These conditions postulate a rather homogeneous microscopic hyphal branching pattern and induction of spore differentiation by means of an activator-inhibitor system. Furthermore, a working hypothesis for the formation of spore patterns in Neurospora crassa is suggested which is based on an extracellular control of fungal differentiation.

Cell Differentiation↗
PubMed2004

Molecular species of ceramides from the ascomycete truffle Tuber indicum.

The ceramide fractions were isolated from the chloroform/methanolic extractable of the fruiting bodies of Tuber indicum and separated into three kinds of molecular species TI-1, TI-2, and TI-3 by normal and reverse phase silica gel-column chromatography. By means of (1)H NMR and (13)C NMR spectroscopy, fast atom bombardment mass spectrometry (FAB-MS), and chemical degradation experiment, their component sphingoid base for TI-1 and TI-2 was uniformly (2S,3S,4R)-2-amino-1,3,4-octadecantriol, while the sphingoid of TI-3 was d-erythro-sphingosine, and their structures have been determined unequivocally to be (2S,2'R,3S,4R)-2-(2'-d-hydroxyalkanoylamino) octadecane-1,3,4-triol, the fatty acid composition of which consists of 2-hydroxydocosanoic, 2-hydroxytetracosanoic, and 2-hydroxytricosanoic acids (from major to minor); (2S,3S,4R)-2-(alkanoylamino)octadecane-1,3,4-triol, the fatty acid composition of which is unusual and consists of docosanoic, hexadecanoic, tricosanoic, octadecanoic and nonadecanoic acids (from major to minor); and (2S,3R,4E)-2-(alkanoylamino)-4-octadecene-1,3-diol, the component fatty acids of which were hexadecanoic (predominant) and octadecanoic acids, respectively.

Ascomycota↗
PubMed2004

Botryozyma mucatilis sp. nov., an anamorphic ascomycetous yeast associated with nematodes in poplar slime flux.

A new species of Botryozyma, Botryozyma mucatilis, was isolated from the surface of free-living nematodes, Panagrellus dubius, inhabiting slime flux from hybrid poplars, Populus deltoidesxtrichocarpa, in Oregon, USA. This species was discovered in relatively close proximity to the teleomorphic species Ascobotryozyma americana and Ascobotryozyma cognata, both collected from P. dubius nematodes inhabiting beetle galleries in Populus spp. and Populus and Salix spp., respectively. B. mucatilis is recognized as a distinct species based on molecular and morphological data. Sequence divergence in both the D1/D2 domain of the nuclear large-subunit rDNA and internal transcribed spacer region rDNA, low DNA reassociation values, notably different amplified fragment-length polymorphic fingerprints, and significantly longer cells all support the designation of a novel species.

Animals↗
PubMed2004

Genetic analysis of spore killing in the filamentous ascomycete Podospora anserina.

In the present study, we analysed different Podospora anserina strains for their ability to induce spore killing and identified three new killer strains. Test crosses of killer strains with different sensitive strains revealed different second division segregation ratios suggesting an influence of the sensitive strain on the crossing-over frequency. In crosses of killer strain O with a sensitive strain, the frequency of two-spored asci was found to vary extremely from perithecium to perithecium. Furthermore, crosses of strain O with sensitive strain Us5 led to a significant proportion of asci containing an unexpected high number of surviving spores as the result of gene conversion. Finally, for the first time, we present data demonstrating that in a number of ascospores the killer and the corresponding sensitive allele is located in one individual nucleus. Mycelia derived from such ascospores display a "sensitive killer" phenotype. Crosses of these mycelia with a killer strain as well as with a sensitive strain result in spore killing. Strikingly, heterokaryotic spores containing the recombined "sensitive/killer" allele and a nucleus with a killer allele give rise to mycelia protected against spore killing during selfing.

Alleles↗
PubMed2005

Characterisation of the mating-type locus in the genus Xanthoria (lichen-forming ascomycetes, Lecanoromycetes).

Conserved regions of mating-type genes were amplified in four representatives of the genus Xanthoria (X. parietina, X. polycarpa, X. flammea, and X. elegans) using PCR-based methods. The complete MAT locus, containing one ORF (MAT1-2-1) coding for a truncated HMG-box protein, and two partial flanking genes, were cloned by screening a genomic lambda phage library of the homothallic X. parietina. The flanking genes, a homologue of SLA2 of Saccharomyces cerevisiae and a DNA lyase gene, served to amplify the two idiomorphs of the X. polycarpa MAT locus. Each idiomorph contains a single gene: MAT1-2-1 codes for a HMG-box protein, MAT1-1-1 encodes an alpha domain protein. The occurrence of mating-type genes in eight single spore isolates derived from one ascus was studied with a PCR assay. In the homothallic X. parietina a HMG fragment, but no alpha box fragment was found in all isolates, whereas in X. elegans, another homothallic species, all tested isolates contained a fragment of both idiomorphs. Conversely, isolates of the heterothallic X. polycarpa contained either a HMG or an alpha box fragment, but never both.

Amino Acid Sequence↗
PubMed2005

Properties of neutral cellobiose dehydrogenase from the ascomycete Chaetomium sp. INBI 2-26(-) and comparison with basidiomycetous cellobiose dehydrogenases.

The extracellular cellobiose dehydrogenase (CDH) obtained from Chaetomium sp. INBI 2-26(-) has a molecular mass of 95 kDa and an isoelectric point of 5. This novel CDH is highly specific for the oxidation of cellobiose (K(m,app) 4.5 microM) and lactose (K(m,app) 56 microM). With 2,6-dichloroindophenol (DCIP) and cytochrome c(3+) (cyt c(3+)) as electron acceptors, CDH was most active at pH 6. The turnover number of the enzyme for cellobiose, lactose, DCIP and cyt c(3+) was in the range of 9-14s(-1) at 20 degrees C and pH 6. The UV-visible spectrum revealed the flavohemoprotein nature of the enzyme. The cytochrome b domain of the enzyme was reduced by ascorbate, dithionite, as well as specifically by cellobiose in a wide range of pH. The apparent first order rate constants of the spontaneous re-oxidation of the reduced heme domain were estimated as 0.01 and 0.00039 s(-1) at pH 4.5 and 6.5, respectively. The half-inactivation time of CDH at pH 6 and 55 degrees C was ca. 100 min; the stability at pH 8 and, particularly, pH 4 was remarkably lower. Cellobiose stabilized the enzyme against thermal inactivation, whereas DCIP in turn sensitized the enzyme. The new enzyme revealed low affinity for crystalline cellulose, but was capable of binding onto H(3)PO(4)-swollen filter paper. The results show significant differences to already known CDHs and perspectives for several biotechnological applications, where CDH with maximal activity at neutral pH and high affinity for cellobiose and lactose night have some advantages.

2,6-Dichloroindophenol↗
PubMed2006

Infection of Harmonia axyridis (Coleoptera: Coccinellidae) by Hesperomyces virescens (Ascomycetes: Laboulbeniales): role of mating status and aggregation behavior.

The ectoparasitic fungus Hesperomyces virescens was studied on Harmonia axyridis in North Carolina, in the southeastern United States. A primary goal was to investigate transmission of the disease by examining the correlation between the pattern of fungal infection and seasonal change in host behavior. Beetles were collected as they arrived at their winter quarters at two sites; in one site they were also subsampled at mid- and late winter. Insects were sexed and weighed, fungal thalli were counted, and their location on the host body mapped; spermathecae of females were examined for sperm. Infection levels varied between sites, differed significantly between the sexes in one site but not the other, and increased by approximately 40% during winter. The distribution of thalli on the body changed seasonally, in concert with behavioral changes in the host. At fall flight, thalli were found most often on the posterior elytra of mated females, virgin females, and males. This is suggestive that the disease had been spread among both sexes via successful and failed copulation attempts; however, the relatively low incidence of infection on the male venter does not fit the sexual transmission scenario. During winter, thallus location shifts in concert with beetle aggregation behavior, with infections more often located on the head and legs. Fresh weight of beetles decreased by approx. 20% during winter, but was not affected by disease status. Prior to spring flight, uninfected females were preferred as mating partners, but the probable relationship between female age and infection status complicates interpretation of the data.

Animals↗