SEARCH · PubMed Health

Results for “RNA, Transfer, Pro”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 271 records · Page 15Linked to original sources

PubMed1987

Isolation of novel human retrovirus-related sequences by hybridization to synthetic oligonucleotides complementary to the tRNA(Pro) primer-binding site.

Synthetic oligonucleotides complementary to putative retroviral primer-binding sites were used as hybridization probes to detect novel retroviruslike sequences. An 8.1-kilobase element with structural features of a retroviral provirus was isolated from a human genomic library by this approach. Nucleotide sequence analysis of its 600-base-pair long terminal repeats revealed characteristic motifs known as regulatory signals for RNA polymerase II transcription: CCAAT, TATA, and ATTAAA. In addition, a putative pol gene displays apparent homologies to conserved regions of retroviral reverse transcriptase. The 5' long terminal repeat is flanked at its 3' end by a putative primer-binding site for reverse transcription with homology to tRNA(Pro). This element is therefore termed HuRRS-P (human retrovirus-related sequence-proline). There are 20 to 40 copies of HuRRS-P homologous sequences in DNAs of human and simian origin.

Animals↗

PubMed2006

TRAF6 regulates cell fate decisions by inducing caspase 8-dependent apoptosis and the activation of NF-kappaB.

Tumor necrosis factor receptor-associated factor 6 (TRAF6) functions as an adaptor, positively regulating the NF-kappaB pathway. Here we report a new function of human TRAF6, the direct stimulation of apoptosis. The mechanism of apoptosis induction results from the capacity of human TRAF6 to interact and activate caspase 8. Both the C-terminal TRAF domain of human TRAF6, which directly interacts with the death effector domain of pro-caspase 8, and the N-terminal RING domain, which is required for activation of caspase 8, are necessary for the induction of apoptosis. The role of endogenous TRAF6 in regulating apoptosis was confirmed by extinguishing TRAF6 expression with specific small-hairpin RNA that resulted in diminished spontaneous apoptosis and resistance to induced apoptosis. In contrast to the human molecule, murine TRAF6 displayed less ability to induce apoptosis and a greater capacity to stimulate NF-kappaB activity. Human and murine TRAF6 are similar except in the region between zinc finger 5 and the TRAF domains. Reciprocal transfer of this connecting region completely exchanged the ability of human and murine TRAF6 to induce apoptosis and activate NF-kappaB. Unique regions of TRAF6 therefore play an important role in determining cell fate.

Animals↗

PubMed2004

Expression and purification of rat recombinant aminopeptidase B secreted from baculovirus-infected insect cells.

Aminopeptidase B (Ap-B) is a ubiquitous enzyme and its physiological function still remains an open question. This Zn2+ -exopeptidase catalyzes the amino-terminal cleavage of basic residues of peptide or protein substrates, indicating a role in precursor processing. In addition, the enzyme exhibits a residual capacity to hydrolyze leukotriene A4 (LTA4) into the pro-inflammatory lipid mediator leukotriene B4 (LTB4) in vitro. This potential bi-functional nature of Ap-B is supported by a close structural relationship with LTA4 hydrolase, which hydrolyzes LTA4 into LTB4, in vivo, and exhibits an aminopeptidase activity, in vitro. Structural studies are necessary for the detailed understanding of the bi-functional enzymatic mechanism of Ap-B. In this study, we report cDNA cloning, baculovirus expression, and purification of the rat Ap-B (rAp-B). The Ap-B cDNA was constructed from extracted rat testes total RNA and introduced into the pBAC1 baculovirus transfer vector to generate recombinant baculoviruses. rAp-B expression, with or without COOH-hexahistidine tag, was tested in two different insect cell hosts (Sf9 and H5). The enzyme is secreted into the insect cell culture medium, which allowed a rapid purification of the protein. The His-tagged rAp-B was purified using metal affinity resin while the native recombinant rAp-B was partially purified using a single step DEAE Trisacryl ion exchange column. Although the recombinant rAp-B exhibits biochemical properties equivalent to those of the rat testes purified protein, the presence of the histidine-tag seems to partially inhibit the exopeptidase activity. However, this report shows that baculovirus-infected cells are a useful system to produce rat Ap-B for use in studying enzymatic mechanisms in vitro and 3D structure.

Aminopeptidases↗

PubMed1985

Fine structure-activity analysis of mutations at position 51 of tyrosyl-tRNA synthetase.

Residue Thr-51 at the active site of tyrosyl-tRNA synthetase (Bacillus stearothermophilus) has been replaced with all the smaller amino acids by protein engineering to investigate direct and indirect effects of mutation on substrate binding and catalysis. The gamma-hydroxyl group of Thr-51 was thought to be 0.5 A too far from the ribose ring oxygen of ATP to form a hydrogen bond. Consistent with this, it is found that mutation of Thr-51----Cys-51, which should place the gamma-thiol group within its correct distance for hydrogen bonding, increases the affinity of the enzyme for ATP. Other mutations (Ser-51, Ala-51, and Gly-51) show the contributions to binding of the other atoms in the side chain of Thr-51. A family of enzymes has been produced, TyrTS(Thr-51) (wild type), TyrTS(Ala-51), TyrTS(Cys-51), and TyrTS(Pro-51), in which the value of kcat/KM for ATP in aminoacylation increases along the series. This is achieved by the value of KM decreasing significantly (2.5, 1.25, 0.29, and 0.019 mM, respectively) while there are smaller decreases in kcat (4.7, 4.0, 2.9, and 1.8 s-1, respectively). These variations cause each one of the enzymes to be more active than the others at particular concentrations of ATP. For example, at concentrations of ATP greater than 5.9 mM, TyrTS(Thr-51) is the most active, while TyrTS(Ala-51), TyrTS(Cys-51), and TyrTS(Pro-51) are the most active at 5.9-2.2, 2.2-0.42, and less than 0.42 mM ATP, respectively. Interestingly, position 51 shows variation in tyrosyl-tRNA synthetases isolated from different organisms.

Adenosine Triphosphate↗

PubMed2000

Hydrolytic editing by a class II aminoacyl-tRNA synthetase.

Editing reactions catalyzed by aminoacyl-tRNA synthetases are critical for accurate translation of the genetic code. To date, this activity, whereby misactivated amino acids are hydrolyzed either before or after transfer to noncognate tRNAs, has been characterized extensively only in the case of class I synthetases. Class II synthetases have an active-site architecture that is completely distinct from that of class I. Thus, findings on editing by class I synthetases may not be applicable generally to class II enzymes. Class II Escherichia coli proline-tRNA synthetase is shown here to misactivate alanine and to hydrolyze the noncognate amino acid before transfer to tRNA(Pro). This enzyme also is capable of rapidly deacylating a mischarged Ala-tRNA(Pro) variant. A single cysteine residue (C443) that is located within the class II-specific motif 3 consensus sequence was shown previously to be dispensable for proline-tRNA synthetase aminoacylation activity. We show here that C443 is critical for the hydrolytic editing of Ala-tRNA(Pro) by this class II synthetase.

Amino Acyl-tRNA Synthetases↗

PubMed1997

Guanosine binds to the Tetrahymena ribozyme in more than one step, and its 2'-OH and the nonbridging pro-Sp phosphoryl oxygen at the cleavage site are required for productive docking.

The dynamics of binding of various guanosine, or G, substrates to the Tetrahymena thermophila L-21 ScaI ribozyme have been investigated by fluorescence-detected stopped-flow experiments. Upon rapid mixing of various G substrates with a preformed complex of the ribozyme and the fluorescent 5' splice site analogue CCUCUepsilonA, fluorescence transients that provide rates for binding of G substrates and the rate-limiting step for transesterification are observed. The measured apparent bimolecular rate constant for binding of pG is 10(3) M-1 s-1, much slower than expected for diffusion. pG appears to bind to the preformed complex of the ribozyme and CCUCUepsilonA in at least two steps, a bimolecular step followed by at least one conformational change. This two-step binding of pG, involving a rapid pre-equilibrium, leads to the slow apparent rate constant for binding of pG. Furthermore, the 2'-OH of pG and of the 3' terminal G of the G substrate GUCG and the nonbridging pro-Sp phosphoryl oxygen atom at the site of phosphoryl transfer on CCUCUepsilonA appear to mediate formation of a properly conformed docked ternary complex of the G substrate, 5' splice site, and ribozyme which may represent an intermediate required for initiation of transesterification. It is possible that the 2'-OH of pG and this nonbridging pro-Sp phosphoryl oxygen interact, directly or indirectly, with one another.

Animals↗

PubMed1994

Differential expression of an E-selectin ligand (SLex) by two Chinese hamster ovary cell lines transfected with the same alpha (1,3)-fucosyltransferase gene (ELFT).

The mammalian cDNA encoding alpha (1,3)-fucosyltransferase (alpha (1,3)Fuc-T) termed ELAM-1 ligand fucosyltransferase (ELFT) or Fuc-TIV was previously cloned by three groups who reported different results from transfection studies Goelz et al. (Goelz, S. E., Hession, C., Goff, D., Griffiths, B., Tizard, R., Newman, B., Chi-Rosso, G., and Lobb, R. (1990) Cell 63, 1349-1356) found that Chinese hamster ovary (CHO) cells expressing the ELFT cDNA had alpha (1,3)Fuc-T activity and were able to bind to E-selectin. In contrast, Lowe et al. (Lowe, J. B., Kukowska-Latallo, J. F., Nair, R. P., Larsen, R. D., Marks, R. M., Macher, B. A., Kelly, R. J., and Ernst, L. K. (1991) J. Biol. Chem. 266, 17467-17477) and Kumar et al. (Kumar, R., Potvin, B., Muller, W. A., and Stanley, P. (1991) J. Biol. Chem. 266, 21777-21783) found no binding to E-selectin of CHO transfectants expressing the same alpha (1,3)Fuc-T gene; nor did the latter transfectants synthesize a known E-selectin ligand, sialylated Lex (SLex), although they had substantial alpha (1,3)Fuc-T activity. We now show that these discrepant results were due to a difference between the parental CHO cell lines. Following transfection of ELFT cDNA into Pro-5 or dihydrofolate reductase (DHFR)- CHO cells, only the DHFR- transfectants expressed SLex and bound to E-selectin. Indirect evidence from monoclonal antibody and lectin binding studies indicates that the range of carbohydrate structures synthesized by the Pro-5 and DHFR- CHO cell lines differs. Since DHFR-/ELFT transfectants expressed cell surface SLex but transferred fucose poorly to sialylated substrates in vitro, ELFT may be able to fucosylate a complex carbohydrate missing from Pro-5 cells. Alternatively, either CHO line may have an activity (such as an alpha (2,3)-sialyltransferase), that modifies alpha (1,3)-fucosylated lactosamines.

Animals↗

PubMed2006

Whole genome sequencing of a novel temperate bacteriophage of P. aeruginosa: evidence of tRNA gene mediating integration of the phage genome into the host bacterial chromosome.

Whole genome sequencing of a novel Pseudomonas aeruginosa temperate bacteriophage PaP3 has been completed. The genome contains 45 503 bp with GC content of 52.1%, without more than 100 bp sequence hitting homologue in all sequenced phage genomes. A total of 256 open reading frames (ORFs) are found in the genome, and 71 ORFs are predicated as coding sequence (CDS). All 71 CDS are divided into the two opposite direction groups, and both groups meet at the bidirectional terminator site locating the near middle of the genome. The genome is dsDNA with 5'-protruded cohesive ends and cohesive sequence is 'GCCGGCCCCTTTCCGCGTTA' (20 mer). There are four tRNA genes (tRNA(Asn), tRNA(Asp), tRNA(Tyr) and tRNA(Pro)) clustering at the 5'-terminal of the genome. Analysis of integration site of PaP3 in the host bacterial genome confirmed that the core sequence of (GGTCGTAGGTTCGAATCCTAC-21mer) locates at tRNA(Pro) gene within the attP region and at tRNA(Lys) gene in the attB region. The results indicated that 3'-end of tRNA(Pro) gene of the PaP3 genome is involved in the integration reaction and 5'-end of tRNA(Lys) gene of host bacteria genome is hot spot of the integration.

Chromosomes, Bacterial↗

PubMed2006

Blockade of endothelin-1 release contributes to the anti-angiogenic effect by pro-opiomelanocortin overexpression in endothelial cells.

Pro-opiomelanocortin (POMC) is the precursor of several neuropeptides, such as corticotropin (ACTH), alpha-melanocyte-stimulating hormone (MSH), and the endogenous opioid, beta-endorphin (EP). ACTH-dependent Cushing's syndrome is characterized by ACTH overproduction and is associated with an increased risk of cardiovascular disease. Endothelial dysfunction has been recognized as an early marker of cardiovascular disease. However, the mechanism underlying endothelial dysfunction by ACTH overexpression in Cushing's patients remains elusive. Endothelial cells, the primary cells producing endothelin (ET)-1, are both the source and target of POMC-derived peptides. In the present study, we generated adenovirus vectors (Ad) encoding POMC (Ad-POMC) and green fluorescent protein (GFP; Ad-GFP) to investigate whether POMC gene transfer altered the ET-1 homeostasis and angiogenic functions in human EA.hy926 endothelial cells. Via adenovirus gene delivery, the POMC-transduced EA.hy926 cells released significantly elevated ACTH and beta-EP levels (P < 0.001). In addition, POMC gene delivery significantly decreased the ET-1 release (P < 0.001) without affecting the ET-1 messenger RNA (mRNA) level. Despite no effect on the secretion of matrix metalloproteinases (MMPs) and cell proliferation, POMC gene delivery significantly inhibited the migration (P < 0.01) and tube-forming capability (P < 0.01) of endothelial cells. Moreover, the POMC-induced inhibition of tube formation could be partially reversed by adding exogenous ET-1 (P < 0.05). In summary, the attenuated ET-1 release and angiogenic processes by POMC overexpression may contribute to endothelial dysfunction, thereby providing a link between Cushing's syndrome and cardiovascular diseases.

Adenoviridae↗

PubMed2004

Adjuvant oil induces waves of arthritogenic lymph node cells prior to arthritis onset.

A single intradermal injection of the adjuvant-oil squalene induces T cell mediated arthritis in DA rats. The chain of events leading from nonspecific provocation of the immune system to arthritis is largely unknown. Previous studies have demonstrated that lymph node (LN) cells are of pathogenic importance, i.e. cells from LNs draining the injection site can transfer arthritis to naïve DA rats. Recently we have demonstrated cellular uptake of adjuvant oil in draining lymph nodes but also that nondraining LNs become hyperplastic and harbour arthritogenic cells. Here, we aimed to determine from which time-point prior to arthritis onset arthritogenic cells appear in draining inguinal and nondraining axillary/brachial LNs, respectively. We demonstrated that the ability to transfer arthritis was strongly dependent on the time-point after adjuvant-injection with clear-cut differences between draining and nondraining LN cells. Cells harvested at day 5 postinjection (p.i) were not able to transfer arthritis, while at day 8 p.i, a first wave of arthritogenic cells appeared in draining LNs. The ability to transfer arthritis was associated with a pro-inflammatory cytokine profile as indicated by the IL-1beta and IFNgamma expression in cells from draining LNs. Subsequently, at day 11 p.i., just before arthritis onset, arthritogenic cells appeared also in nondraining LNs. These results shed new light on the induction of arthritic diseases, implicating a two step mechanism for the development of pathogenic cells. Firstly, a pro-inflammatory burst in responding lymphoid organs leading to a local pool of arthritogenic cells and, secondly, a transmission of arthritogenecity to other LNs and precipitation of disease in peripheral joints.

Adjuvants, Immunologic↗

PubMed1984

Halobacterium volcanii tRNAs. Identification of 41 tRNAs covering all amino acids, and the sequences of 33 class I tRNAs.

Transfer RNAs of Halobacterium volcanii, an archaebacterium, were separated by two-dimensional gel electrophoresis and sequenced by a combination of methods. A total of 41 tRNAs, at least one for each amino acid, were identified. These are five tRNAs for Leu, four for Gly, three each for Ala, Arg, Pro, and Ser, two each for Glu, Ile, Lys, Met (initiator and noninitiator), Thr, and Val, and one each for the remaining eight amino acids. As in eucaryotes, only Leu and Ser tRNAs are class II (large extra arm). The sequences of the 33 class I tRNAs, for the remaining 18 amino acids, are presented here. These cover at least 44 codons out of a possible 49 codons for the 18 amino acids. Although these archaebacterial tRNAs follow general tRNA patterns, they are in detail distinct from both eucaryotic and eubacterial tRNAs. Moreover, the initiator tRNA is unique in having a 5'-triphosphorylated end.

Amino Acids↗

PubMed1992

Correlation analysis of amino acid usage in protein classes.

We present a comparative study of residue usage correlations of various organism protein sets of diverse phylogenetic species and of open reading frames of several large human viral genomes. Our correlation analysis reveals three major tendencies: (i) charge compensation reflected by the high correlation of basic with acidic residues; (ii) the positive correlations of functionally and structurally similar amino acids including many pairs of hydrophobic amino acids, all pairs of aromatic amino acids, the anionic pair (glutamate and aspartate), but not the cationic pair (lysine and arginine), moderately the hydroxyl pair (serine and threonine), the small amino acids (glycine and alanine), and many (but not all) of those having high values in the Dayhoff substitutability matrix (characteristics such as amino acid polarity or codon usage agreement, except for the wobble position, do not necessarily imply significant positive correlations); (iii) a widespread negative correlation of the aggregate strong codon group amino acids (Ala, Gly, Pro) versus the weak codon group amino acids (Lys, Ile, Tyr, Asn, Phe). Discussion and speculations relate amino acid usage correlations to protein function/structure, cellular localization, proximity in amino acid biosynthetic pathways, amino acid relative abundances, tRNA and aminoacyl synthetase availabilities, and evolutionary processes.

Amino Acids↗

PubMedDate not supplied

The study of gap junctional intercellular communication in keratinocytes as screening of promoter effect induced by industrial and environmental toxic substances.

BACKGROUND: Disordered functioning of gap junctions between normal and initiated cells has been proposed as one possible mechanism of tumour promotion. Many putative carcinogens such as peroxisome proliferators, are known to activate various signal transduction mechanisms and modulate gap junctional intercellular communication (GJIC). They act as tumour promoters on pre-existing "initiated" cells, rather than as genotoxic initiators. OBJECTIVES: The aim of this article is to provide a screening-tool to evaluate the promoter carcinogen effect of environmental and occupational chemical contaminants, focusing on their ability to alter GJIC. METHODS: GJIC was investigated in serum-free cultured primary human keratinocytes, by directly evaluating the intercellular transfer of a microinjected fluorescent dye (Dye transfer). The expression of caspase 3, which is the ultimate target to be activated of both mitochondrial- and non-mitochondrial-linked pro-apoptotic pathways, was evaluated using Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR). RESULTS: Mercury chloride (10 nM), mono-methyl Mercury (250 nM) and Trichloroethylene (500 I1M) were shown to significantly inhibit GJIC. Conversely di-methyl mercury, lead acetate and epichloridine had no effect on GJIC. All Trans Retinoic Acid completely reversed the inhibitory effect on GJIC induced by HgCI2 but not that induced by mono-methyl mercury and trichloroethylene. The result of a RT-PCR assay on total RNA cell extract showed that treatment of keratinocytes with 10 nM HgCl2 resulted in a decrease of the pro-apoptotic caspase 3 expression. CONCLUSIONS: In this work a protocol is designed to study gap junction intercellular communication in primary cultures of human keratinocytes which could be used as a reliable screening tool to test the promoter carcinogen effect of various environmental and occupational contaminants.

Air Pollutants, Occupational↗

PubMed2003

Intramuscular transfer of naked calcitonin gene-related peptide gene prevents autoimmune diabetes induced by multiple low-dose streptozotocin in C57BL mice.

The imbalance of Th1/Th2 subsets is an important pathogenic mechanism for insulin-dependent diabetes mellitus (IDDM). Calcitonin gene-related peptide (CGRP) has been found to play important roles in the regulation of T lymphocytes. We hypothesize that exogenous CGRP administration during insulitis may modulate the balance of Th lymphocytes, thereby providing a therapeutic intervention for IDDM. We established CGRP gene transfer by naked plasmid injection into the skeletal muscles with electroporation enhancement. The effect of CGRP gene transfer on pathogenesis of IDDM was observedin autoimmune diabetic C57BL mice induced by multiple low-dose streptozotocin (MLDS) administration. The treatment significantly decreased morbidity of diabetes, ameliorated hyperglycemia and insulin deficiency, and inhibited lymphocyte infiltration into the islets, indicating the protection of beta cells against autoimmune destruction. CGRP gene transfer significantly inhibited T cell proliferation and secretion of the Th1 cytokine IFN-gamma, increased the level of the Th2 cytokine IL-10, but had no effect on IL-4 and TGF-beta1 secretion. CGRP gene transfer also decreased IL-12 and IFN-gamma levels in peritoneal effusion. Our results demonstrate that CGRP gene transfer selectively suppresses the pro-inflammatory Th1 subsets and promote anti-inflammatory Th2 subsets, resulting in amelioration of beta cell destruction and reduction of IDDM occurrence in mice with MLDS-induced diabetes.

Animals↗

PubMed2006

Structures of two bacterial prolyl-tRNA synthetases with and without a cis-editing domain.

Prolyl-tRNA synthetases (ProRSs) are unique among synthetases in that they have diverse architectures, notably the variable presence of a cis-editing domain homologous to the freestanding deacylase proteins YbaK and ProX. Here, we describe crystal structures of two bacterial ProRSs from the pathogen Enterococcus faecalis, which possesses an editing domain, and from Rhodopseudomonas palustris, which does not. We compare the overall structure and binding mode of ATP and prolyl-adenylate with those of the archael/eukaryote-type ProRS from Thermus thermophilus. Although structurally more homologous to YbaK, which preferentially hydrolyzes Cys-tRNA(Pro), the editing domain of E. faecalis ProRS possesses key elements similar to ProX, with which it shares the activity of hydrolyzing Ala-tRNA(Pro). The structures give insight into the complex evolution of ProRSs, the mechanism of editing, and structural differences between prokaryotic- and eukaryotic-type ProRSs that can be exploited for antibiotic design.

Adenosine Triphosphate↗

PubMed1990

Human-mouse interspecies collagen I heterotrimer is functional during embryonic development of Mov13 mutant mouse embryos.

To investigate whether the human pro alpha 1(I) collagen chain could form an in vivo functional interspecies heterotrimer with the mouse pro alpha 2(I) collagen chain, we introduced the human COL1A1 gene into Mov13 mice which have a functional deletion of the endogenous COL1A1 gene. Transgenic mouse strains (HucI and HucII) carrying the human COL1A1 gene were first generated by microinjecting the COL1A1 gene into wild-type mouse embryos. Genetic evidence indicated that the transgene in the HucI strain was closely linked to the endogenous mouse COL1A1 gene and was X linked in the HucII transgenic strain. Northern (RNA) blot and S1 protection analyses showed that the transgene was expressed in the appropriate tissue-specific manner and as efficiently as the endogenous COL1A1 gene. HucII mice were crossed with Mov13 mice to transfer the human transgene into the mutant strain. Whereas homozygous Mov13 embryos die between days 13 and 14 of gestation, the presence of the transgene permitted apparently normal development of the mutant embryos to birth. This indicated that the mouse-human interspecies collagen I heterotrimer was functional in the animal. The rescue was, however, only partial, as all homozygotes died within 36 h after delivery, with signs of internal bleeding. This could have been due to a functional defect in the interspecies hybrid collagen. Extensive analysis failed to reveal any biochemical or morphological abnormalities of the collagen I molecules in Mov13-HucII embryos. This may indicate that there was a subtle functional defect of the interspecies hybrid protein which was not revealed by our analysis or that another gene has been mutated by the retroviral insertion in the Mov13 mutant strain.

Animals↗

PubMed2000

Cloning of pro-vasotocin and pro-isotocin cDNAs from the flounder Platichthys flesus; levels of hypothalamic mRNA following acute osmotic challenge.

Sequences coding for pro-vasotocin and pro-isotocin have been identified by screening a flounder (Platichthys flesus) hypothalamic cDNA library. The 1074-bp proVT and 727-bp proIT sequences contain a signal peptide and hormone, connected to a neurophysin by a Gly-Lys-Arg sequence. Both sequences also have an elongated carboxyl-terminal with a leucine-rich core resembling copeptin but lacking the amino terminal Arg residue. The levels of pro-vasotocin and pro-isotocin mRNA in the hypothalamus were measured concomitantly with pituitary AVT content and plasma AVT concentration following acute transfer of fish between freshwater and seawater. Three days after transfer from seawater to freshwater there appears to be a down regulation of the AVT hormone system with a fall in hypothalamic pro-vasotocin mRNA levels, an increase in pituitary AVT content, and a fall in plasma levels, but these changes did not achieve statistical significance compared to controls. No change in the AVT system was detected 3 days following the transfer of fish from freshwater to seawater. Hypothalamic isotocin mRNA levels did not change following hypo- or hyperosmotic challenge.

Amino Acid Sequence↗

PubMed2004

Enhanced detection of deleterious mutations by TTGE analysis of mother and child's DNA side by side.

Mitochondrial DNA (mtDNA) disorders represent a group of heterogeneous diseases that are caused by mutations in mtDNA. We examined 45 pairs of mother and the affected child, by screening the entire mitochondrial genome with temporal temperature gradient gel electrophoresis (TTGE), using 32 pairs of overlapping primers. TTGE is an effective method of mutation detection. It detects and distinguishes heteroplasmic mutations from homoplasmic mutations. By running the mother and child's DNA samples side by side and sequencing only the DNA fragments showing different TTGE patterns, excessive sequencing can be avoided, particularly because most sequence variations represent benign polymorphisms. Mutations identified by sequencing were further confirmed by PCR/ASO (allele-specific oligonucleotide) dot blot analysis or PCR/RFLP (restriction fragment length polymorphism). A total of seven differences in sequence between mother and child pairs were identified: A189G, T5580C, G5821A, C5840T, A8326G, G12207A, and G15995A. All but two mutations were novel. The most significant are the A8326G, G12207A, and G15595A mutations. The A8326G is located at the anticodon region of tRNA(Lys), right next to the first nucleotide of the triplet codon, and it is highly conserved throughout evolution. The G12207A mutation is located at the first base of tRNA(ser) (AGY). The G15995A mutation occurs at a stem region that results in the disruption of the first base pair at the anticodon loop of tRNA(Pro) and is highly conserved throughout evolution from sea urchins to mammals. Running TTGE side by side with DNAs from mother and the affected child is a novel method to detect deleterious mutations.

Child↗