PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “Stage shift”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 271 records · Page 15Linked to original sources
PubMed1998

Differential expression and internal feedback regulation of 1-aminocyclopropane-1-carboxylate synthase, 1-aminocyclopropane-1-carboxylate oxidase, and ethylene receptor genes in tomato fruit during development and ripening.

We investigated the feedback regulation of ethylene biosynthesis in tomato (Lycopersicon esculentum) fruit with respect to the transition from system 1 to system 2 ethylene production. The abundance of LE-ACS2, LE-ACS4, and NR mRNAs increased in the ripening fruit concomitant with a burst in ethylene production. These increases in mRNAs with ripening were prevented to a large extent by treatment with 1-methylcyclopropene (MCP), an ethylene action inhibitor. Transcripts for the LE-ACS6 gene, which accumulated in preclimacteric fruit but not in untreated ripening fruit, did accumulate in ripening fruit treated with MCP. Treatment of young fruit with propylene prevented the accumulation of transcripts for this gene. LE-ACS1A, LE-ACS3, and TAE1 genes were expressed constitutively in the fruit throughout development and ripening irrespective of whether the fruit was treated with MCP or propylene. The transcripts for LE-ACO1 and LE-ACO4 genes already existed in preclimacteric fruit and increased greatly when ripening commenced. These increases in LE-ACO mRNA with ripening were also prevented by treatment with MCP. The results suggest that in tomato fruit the preclimacteric system 1 ethylene is possibly mediated via constitutively expressed LE-ACS1A and LE-ACS3 and negatively feedback-regulated LE-ACS6 genes with preexisting LE-ACO1 and LE-ACO4 mRNAs. At the onset of the climacteric stage, it shifts to system 2 ethylene, with a large accumulation of LE-ACS2, LE-ACS4, LE-ACO1, and LE-ACO4 mRNAs as a result of a positive feedback regulation. This transition from system 1 to system 2 ethylene production might be related to the accumulated level of NR mRNA.

Alkenes↗
PubMed1982

NMR redox studies of Desulfovibrio vulgaris Cytochrome c3. Electron transfer mechanisms.

The 300-MHz proton NMR spectra of the tetrahaem cytochrome c3 from Desulfovibrio vulgaris were examined while varying the pH and the redox potential. The analysis of the complete NMR reoxidation pattern was done taking into account all the 16 redox states that can be present in the redox titration of a tetra-redox-center molecule. A network of saturation transfer experiments performed at different oxidation stages, between the fully reduced and the fully oxidized states, allowed the observation of different resonances for some of the haem methyl groups. In the present experimental conditions, some of the haems show a fast intramolecular electron exchange rate, but the intermolecular electron exchange is always slow. In intermediate reoxidation stages, large shifts of the resonances of some haem methyl groups were observed upon changing the pH. These shifts are discussed in terms of a pH dependence of the haem midpoint redox potentials. The physiological relevance of this pH dependence is discussed.

Chemical Phenomena↗
PubMed2005

Inducible effects of icariin, icaritin, and desmethylicaritin on directional differentiation of embryonic stem cells into cardiomyocytes in vitro.

AIM: To investigate the possible inducible effects of icariin, icaritin, and desmethylicaritin on the directional differentiation of embryonic stem (ES) cells into cardiomyocytes in vitro. METHODS: ES cells were cultivated as embryoid bodies (EBs) in hanging drops with icariin, icaritin, or desmethylicaritin. ES cells treated with retinoic acid and with solvent were used as positive and negative controls, respectively. The cardiomyocytes derived from the ES cells were verified using immunocytochemistry. The expression of cardiac developmental-dependent genes was detected using the reverse transcription-polymerase chain reaction (RT-PCR) method. Cell cycle distribution and apoptosis were analyzed using flow cytometry to determine the partly inducible effect mechanisms involved. RESULTS: The total percentage of beating EBs treated with 10(-7) mol/L icariin, icaritin, or desmethylicaritin was 87% (P<0.01), 59% (P<0.01), and 49%, respectively. All the beating cardiomyocytes derived from the ES cells expressed cardiac-specific proteins for a-actinin and troponin T. Among them, 10(-7) mol/L icariin treatment resulted in a significantly advanced and increased mRNA level of a-cardiac major histocompatibility complex (MHC) and myosin light chain 2v (MLC-2v) in EBs in the early cardiac developmental stage. Before shifting to the cardiomyocyte phenotype, icariin could evoke the accumulation of ES cells in G0/G1 and accelerate apoptosis of the cell population (P<0.05). CONCLUSION: Icariin facilitated the directional differentiation of ES cells into cardiomyocytes at a concentration of 10(-7) mol/L. The promoting effect of icariin on cardiac differentiation was related to increasing and accelerating gene expression of a-cardiac MHC and MLC-2v, as well as regulating the cell cycles and inducing apoptosis.

Animals↗
PubMed2005

Transcriptional switch of the dia1 and impA promoter during the growth/differentiation transition.

When growth stops due to the depletion of nutrients, Dictyostelium cells rapidly turn off vegetative genes and start to express developmental genes. One of the early developmental genes, dia1, is adjacent to a vegetative gene, impA, on chromosome 4. An intergenic region of 654 bp separates the coding regions of these divergently transcribed genes. Constructs carrying the intergenic region expressed a reporter gene (green fluorescent protein gene) that replaced impA in growing cells and a reporter gene that replaced dia1 (DsRed) during development. Deletion of a 112-bp region proximal to the transcriptional start site of impA resulted in complete lack of expression of both reporter genes during growth or development. At the other end of the intergenic region there are two copies of a motif that is also found in the carA regulatory region. Removing one copy of this repeat reduced impA expression twofold. Removing the second copy had no further consequences. Removing the central portion of the intergenic region resulted in high levels of expression of dia1 in growing cells, indicating that this region contains a sequence involved in repression during the vegetative stage. Gel shift experiments showed that a nuclear protein present in growing cells recognizes the sequence GAAGTTCTAATTGATTGAAG found in this region. This DNA binding activity is lost within the first 4 h of development. Different nuclear proteins were found to recognize the repeated sequence proximal to dia1. One of these became prevalent after 4 h of development. Together these regulatory components at least partially account for this aspect of the growth-to-differentiation transition.

Animals↗
PubMed1986

Infancy.

Research on the psychology of infancy in the 1980s was prolific and diverse. At least four different perspectives have been taken. The first views the infant as information processor, adopts the methods and assumptions of experimental psychology, and focuses on such fundamental processes as attention, perception, emotion, learning and memory, search and exploration, and cognition. The second views the infant as an infant, as part of the natural world, and focuses on the important developmental milestones that uniquely characterize the period of infancy, such as walking, talking, forming relationships, and developing a sense of self. The third perspective views the infant as an eventual adult, emphasizes differences among individuals, and focuses on continuities across age and experiences such as biological risk factors, characteristics of rearing environments, and planned intervention that influence the kinds of adults infants will turn out to be. The fourth perspective focuses not on the infant per se, but on the general process of development; the issues examined concern the description and explanation of development, in terms of the existence of shifts and stages, the relationship of early attainments to later ones, the bidirectional influence of genes and environments, the timing of experience, individuals' contributions to their own experiences, and the reversibility of development. Synthesis across perspectives is difficult, but remains possible. The field of infancy research is a microcosm of psychology, but one that retains a view of the organism as holistic being. As such, the study of infancy produces insights of considerable relevance to psychology as a whole.

Attention↗
PubMed2000

Sleep fragmentation, awake blood pressure, and sleep-disordered breathing in a population-based study.

Arousal from sleep produces transient increases in systemic blood pressure, leading to the suggestion that repeated arousals are associated with a sustained increase in daytime blood pressure. Using data from the Wisconsin Sleep Cohort Study, a population-based study, we tested the hypothesis that sleep fragmentation is associated with elevated awake blood pressure. Sleep, breathing, and seated blood pressure measurements from 1,021 participants (age 42 +/- 8 yr; 590 males) were analyzed. Sleep fragmentation was defined as the total number of awakenings and shifts to Stage 1 sleep divided by the total sleep time (sleep fragmentation index: SFI). To reduce the confounding influence of sleep-disordered breathing, which is related to both increased daytime blood pressure and sleep fragmentation, all participants with an apnea-hypopnea index (AHI) > or = 1 were analyzed separately. Accounting for the influences of sex, age, body mass index, and antihypertensive medication use, the SFI was significantly associated with higher levels of awake systolic blood pressure in people with an AHI < 1; a 2 standard deviation increase in the SFI was associated with a 3.1 mm Hg rise in awake systolic blood pressure. In participants with an AHI > or = 1, there was no independent association between the SFI and awake blood pressure after controlling for the influence of the AHI.

Adult↗
PubMed1979

Psychosocial concomitants of biological maturation in preadolescence.

The authors studied 8 sets of healthy twins, ranging in physical maturity from prepubertal to late pubertal, and their parents to assess psychological changes in early adolescence. Interview and questionnaire data suggested that self-doubt, avoidance of responsiblity, resentment of parents, and anxiety about social relationships peaked in early puberty; emotional upset peaked in early puberty to mid-puberty. The results support a hypothesis of phase-specific psychosocial regression correlated with the biological onset of puberty. Children in all pubertal stages were shifting their interests away from parents and toward peers.

Adult↗
PubMed2026

Hepatic metabolic adaptation to endurance exercise: temporal and sex differences by multiomics integration and validation.

BACKGROUND: Although endurance exercise benefits liver health, sex-specific adaptive trajectories remain unclear. This study mapped dynamic liver adaptation in males and females during prolonged training and identified underlying molecular programs. METHODS: Using publicly available time-resolved liver multi-omics data generated by the Molecular Transducers of Physical Activity Consortium (MoTrPAC), we established a computational pipeline for differential analysis of transcriptomic, proteomic, phosphoproteomic, and metabolomic data with FDR correction, followed by FGSEA pathway enrichment. Kinase activities were inferred through ortholog mapping and PhosphoSitePlus. Cross-omics co-expression networks were constructed using WGCNA and topological overlap to link omics features with physiological phenotypes. For experimental validation, liver tissues were collected from endurance-trained Sprague-Dawley rats, and key nodes were confirmed by Western blotting, qRT-PCR, and immunofluorescence/immunohistochemical staining. Public scRNA-seq data were further integrated to map multi-omics signals to single-cell resolution and assess functional changes in specific cell types. RESULTS: The hepatic response to exercise stress was stage-specific, shifting from early transcriptional activation to later proteomic and metabolic remodeling. Multi-omics integration revealed distinct sex-associated adaptive trajectories: males were more strongly associated with energy metabolism, redox-related programs, and amino acid/organic acid catabolism, whereas females showed prominent membrane lipid remodeling, proteostasis -related programs, and mitochondrial/ribosomal translational features. Single-cell analysis showed that tissue remodeling occurred without major lineage turnover, instead involving altered communication among pre-existing cell communities. Validation of PPP1R3G identified a protein-dominant exercise-responsive marker, supporting the contribution of post-transcriptional or protein-level regulation. CONCLUSIONS: Hepatic adaptation to endurance stress follows a cross-omics evolutionary pattern with sex-specific reprogramming of energy supply and homeostatic maintenance. This time-resolved framework clarifies how exercise improves liver function and supports sex-oriented metabolic interventions and therapeutic target discovery.

Animals↗
PubMed1997

The role of pulmonary stretch receptor activation during cough in dogs.

The role of pulmonary stretch receptors in the modulation of expiratory muscle activity during cough is controversial. To evaluate their potential influence on expiratory effort during cough, we compared expiratory muscle activity during unobstructed cough to that during obstructed cough in which the trachea was occluded at the end-inspiration and maintained throughout the subsequent expiration. Cough was evoked by mechanical stimulation of the intrathoracic trachea in 9 anesthetized, tracheotomized dogs. Peak triangularis sterni (TS), internal intercostal (IIC) and transversus abdominis (TA) muscle EMG were monitored to assess both rib cage and abdominal muscle activation during expiration. During cough, expiratory activity increased and peak activity shifted from Stage II to Stage I expiration. Peak expiratory muscle activation during unobstructed and occluded coughs were not significantly different: during unobstructed coughs, peak EMG's (mean +/- SE as percent of resting breathing) were TS, 212 +/- 18; IIC, 425 +/- 72; TA, 406 +/- 66; and during obstructed cough: TS, 188 +/- 24; IIC, 365 +/- 44; TA, 387 +/- 77 (n = 9). These data indicate that enhanced vagal stimulation resulting from airway occlusion does not affect expiratory activity during cough. We suggest that during cough, the expiratory muscles are activated in a stereotypical pattern by the neural network generating the cough and this pattern of activation is not affected by phasic vagal input.

Animals↗
PubMed2002

[Update on screening, diagnosis and treatment of cancer of the prostate].

Recent progress in management of prostate cancer concern screening and treatment. The use of PSA and rectal examination advances the diagnosis by 5 to 10 years and shift the stage at the time of diagnosis toward curative localized intraprostatic disease. The impact of systematic screening remains controversial. However, individual screening explains, at least in part, the decrease of specific mortality due to prostatic cancer, recently observed in USA. PSA and lymphadenectomy have also contributed to a better selection of patients referred for local treatment by prostatectomy or radiotherapy. Radical prostatectomy is recommended for patients before 70 with T2 or less, Gleason score less than 8 and PSA less than 15 ng/ml. With that selection, disease-free survival reaches 75 to 80% at 10 years. Recently, dramatic improvement in radiotherapy techniques have been achieved, leading to a better local control by increasing the dose over 70 Gy without additional toxicity. Brachytherapy is also widely used for good prognosis localized disease. Limitant acute urinary side effects have been reported and results seem similar to those reported after prostatectomy or conformal radiotherapy. Recent randomized trials have demonstrated a benefit of early hormonal therapy concurrent with radiotherapy for patients with poor prognosis localized disease. For hormonoresistant metastatic disease, chemotherapy has been used with limited palliative benefit. New drugs are currently evaluated.

Androgen Antagonists↗
PubMed1992

[Treatment of congestive heart failure using angiotensin I convertase inhibitors].

The authors describe the case of a 70-year-old female patient with ischaemic heart disease with an implanted pacemaker on account of sick-sinus syndrome, who after classical treatment with diuretics and cardiotonics suffered from frequent relapses of global decompensation of the circulation. After administration of the ACE inhibitor--Tensiomin--within a very short time (days) normalization of all indicators of previously severe congestion was found. During the subsequent follow up no relapse of decompensation occurred. The patient was shifted from stage IV to stage II in the functional classification of ischaemic heart disease according to NYHA.

Aged↗
PubMed2003

Marshall, Mannheim and contested citizenship.

In this paper we address tensions in Marshall's account of the successive emergence of civil, political and social rights in citizenship. These tensions were Marshall's implicit and typically modern assumption of human nature, his privileging of the analytical rationality that follows from it, and the disjunction between the fixity of that rationality and the 'evolution' of his central metaphor. When he returned to it by emphasizing strains between democratic, welfare and capitalist moments that were co-present in the 'hyphenated society' rather than successive, he did so in a pessimistic tone at odds with the progressive modernism of his first schema. Although Marshall noted that conflicting principles in citizenship arose 'from the very roots of our social order', he did not elaborate the point in this first tripartite model. We argue that by adopting a single and typically modern form of rationality Marshall foreclosed on the contradictions that he held to be characteristic of academic disputes over citizenship. Since Mannheim had focused on the effects of such contradictions, his work allows a fruitful revisiting of Marshall's themes. To blend the two models we read Marshall through Karl Mannheim's early studies of political knowledge. Here Mannheim had anticipated the shift from stages to co-presence, and had prefigured a resolution of Marshall's sense of impasse. In his account of liberal, socialist and conservative thought-styles--the ways of seeing and knowing that are characteristic of particular ways of life--he saw political change as a dynamic interactive effect of individually calculating, dialectically collective and culturally symbolic forms of rationality.

Attitude↗
PubMed1989

The nurse's role in mammography screening.

Black women in Dade Country have a substantially higher proportion of advanced breast cancer at diagnosis than white women. To shift the stage at diagnosis from later to earlier, a Cancer Early Detection Program was initiated in the fall of 1987. This program involves screening with low-cost mammography, physical breast examination, and instruction in self-breast examination as well as general cancer education about prevention, early detection, and health promotion. The educational programs are presented in conjunction with the local unit of the American Cancer Society. A mobile mammography van travels to Primary Health Care Centers to provide mammograms to a population with limited access to preventive health care. This article describes the development and implementation of the program. It focuses on the responsibilities of an oncology nurse who coordinates and directs the program. Recommendations are made for ways oncology nurses can assume expanded roles in cancer screening/early detection.

Black or African American↗
PubMed1988

[Improved method of equilibrium radionuclide ventriculography].

The commonly used method of static radionuclide ventriculography with a cardiosynchronizer does not permit obtaining a curve of ventricular function over a complete cardiac cycle, especially using computers with a small memory volume. Besides, the final segment of a curve is usually insignificant as a result of variations in a duration of the R-R interval. A method of 2-stage recording of radionuclide ventriculography has been proposed, the second stage being shifted to a certain time interval, i. e. a delay line is introduced between a synchronizing device and computer. Two methods of delay--in the software and hardware--are proposed, the latter being more preferable as it makes unnecessary extra technical devices. Particular attention is drawn to a choice of delay time depending on a computer memory volume: in a small memory volume delay time must be approximately one-third of the patient's R-R interval.

Heart↗
PubMed1988

[Diagnosis and treatment of the convulsive syndrome in children with a history of closed craniocerebral injury].

In 170 children aged 3 to 14 the convulsive syndrome was studied at the acute, rehabilitation and remote stages of the nonpenetrating head trauma (NHT). The patients were divided into groups having permanent seizures of these appearing after a certain seizure-free stage. Characteristic shifts in hemodynamic, cerebrospinal-fluid dynamic indices, sympathoadrenal system activity and electrolyte balance were shown in each group. With these leading pathogenic mechanisms of NHT-induced convulsive syndrome elucidated, and effective method of their treatment was introduced.

Adolescent↗
PubMed1984

Hospital management contracts: institutional and community perspectives.

Previous studies have shown that external management by contract can improve the performance of managed hospitals. This article presents a conceptual framework which develops specific hypotheses concerning improved hospital operating efficiency, increased ability to meet hospital objectives, and increased ability to meet community objectives. Next, changes in the process and structure of management under contractual arrangements, based on observations from two not-for-profit hospital systems, are described. Finally, the effects of these management changes over time on hospital and community objectives are presented. These effects suggest progressive stages in the development of management contracts. The first stage focuses on stabilizing hospital financial performance. Stage two involves recruitment and retention efforts to secure necessary personnel. In the third stage, attention shifts to strategic planning and marketing.

Community-Institutional Relations↗
PubMed1978

[Mitotic index in the bone marrow of children during the clinical course of acute lymphoblastic leukemia (ALL)].

From 31 children with acute lymphoblastic leukaemia the mitosis index in the bone-marrow was determined before the onset of therapy and during the clinical progress. Initially, the mean white mitosis index lay with 3.4% below that of the normal test persons, it rose significantly in the hematologic full remission and showed a decreasing tendency with a great range of dispersion in the recidive. The most lowered mitosis index was found in the final stage. Strong shifts in the kariologic distributions make a remaining in the prophase of the mitosis evident. The influence of polychemotherapy on the mitosis index and the phases of mitosis is discussed. Correlations between the mitosis index and clinical as well as paraclinical parameters were only to be found with respect to granulocytes and lymphoblasts. The considerable ranges of fluctuations of the mitosis index and the lack of congruity with the clinical progress of ALL allow no ensured assertions to be made for the single patient. It seems to be important in eosinophilia and in leukaemoid reactions.

Bone Marrow Cells↗