SEARCH · PubMed Health

Results for “Enhancer mapping”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 289 records · Page 16Linked to original sources

PubMed2000

Different activation of vascular mitogen-activated protein kinases in spontaneously and DOCA-salt hypertensive rats.

Regulation mechanisms of the activity of vascular mitogen-activated protein (MAP) kinases, enzymes believed to be involved in the pathway for cell proliferation, may be altered in hypertension. To examine whether vascular MAP kinase activation mechanisms are altered in hypertension, we measured the activity of MAP kinases in rat aorta strips from spontaneously hypertensive rats (SHR) and from deoxycorticosterone acetate (DOCA)-salt hypertensive rats, and examined whether vascular angiotensin and endothelin systems are responsible for the alteration of MAP kinase activation in these hypertensive models. Endothelium-denuded aorta strips were incubated at 37 degrees C in medium. MAP kinase activity after incubation was increased in rat aorta strips. The MAP kinase activation was greater in 9- and 15-week-old SHR aorta strips than in age-matched Wistar Kyoto rats (WKY) aorta strips. Similarly, MAP kinase activation was enhanced in aorta strips from DOCA-salt hypertensive rats. In aorta strips from these kinds of rats, the angiotensin receptor antagonist, losartan, and the endothelin receptor antagonist, cyclo (D-alpha-aspartyl-L-prolyl-D-valyl-L-leucyl-D-tryptophyl) (BQ123), inhibited the MAP kinase activation. The losartan-induced, but not BQ123-induced, inhibition of MAP kinase activation was enhanced in 15-week-old SHR aorta strips, whereas the BQ123-induced, but not losartan-induced, inhibition of MAP kinase activation was enhanced in DOCA-salt hypertensive rat aorta strips. Angiotensin II-induced MAP kinase activation was enhanced in 15-week-old SHR aorta strips, whereas it was depressed in DOCA-salt hypertensive rat aorta strips. These results indicate that MAP kinase activation function is enhanced in aorta strips from both kinds of hypertensive rats. It appears that the enhancement of MAP kinase activation results partly from enhanced vascular angiotensin system in SHR and from enhanced vascular endothelin system in DOCA-salt hypertensive rats.

Angiotensin II↗

PubMed1999

Hoxa5 gene regulation: A gradient of binding activity to a brachial spinal cord element.

The Hox genes cooperate in providing positional information needed for spatial and temporal patterning of the vertebrate body axis. However, the biological mechanisms behind spatial Hox expression are largely unknown. In transgenic mice, gene fusions between Hoxa5 (previously called Hox-1.3) 5' flanking regions and the lacZ reporter gene show tissue- and time-specific expression in the brachial spinal cord in day 11-13 embryos. A 604-bp regulatory region with enhancer properties directs this spatially specific expression. Fine-detail mapping of the enhancer has identified several elements involved in region-specific expression, including an element required for expression in the brachial spinal cord. Factors in embryonic day 12.5 nuclear extracts bind this element in electrophoretic mobility shift assays (EMSA) and protect three regions from DNase digestion. All three sites contain an AAATAA sequence and mutations at these sites reduce or abolish binding. Furthermore, this element binds specific individual embryonic proteins on a protein blot. The binding activity appears as a gradient along the anterior-posterior axis with two- to threefold higher levels observed in extracts from anterior regions than from posterior regions. In parallel with the EMSA, the proteins on the protein blot also show reduced binding to probes with mutations at the AAATAA sites. Most importantly, transgenic mice carrying Hoxa5/lacZ fusions with the three AAATAA sites mutated either do not express the transgene or have altered transgene expression. The brachial spinal cord element and its binding proteins are likely to be involved in spatial expression of Hoxa5 during development.

Animals↗

PubMed2001

Map Manager QTX, cross-platform software for genetic mapping.

Map Manager QTX (QTX) is software for analysis of genetic mapping experiments in experimental plants and animals. It includes functions for mapping both Mendelian and quantitative trait loci. QTX is an enhanced version of Map Manager QT, rewritten with the aid of cross-platform libraries (XVT, Boulder Software Foundry, Inc.), which allow it to be compiled for multiple computer platforms. It currently is distributed for Microsoft Windows and Mac OS and is available at http://mapmgr.roswellpark.org/mmQTX.html.

Animal Population Groups↗

PubMed1995

Development of a genetic map of the chicken with markers of high utility.

Microsatellites are tandem duplications with a simple motif of one to six bases as the repeat unit. Microsatellites provide an excellent opportunity for developing genetic markers of high utility because the number of repeats is highly polymorphic, and the assay to score microsatellite polymorphisms is quick and reliable because the procedure is based on the polymerase chain reaction (PCR). We have identified 404 microsatellite-containing clones of which 219 were suitable as microsatellite markers. Primers for 151 of these microsatellites were developed and used to detect polymorphisms in DNA samples extracted from the parents of two reference populations and three resource populations. Sixty, 39, 46, 49, and 61% of the microsatellites exhibited length polymorphisms in the East Lansing reference population, the Compton reference population, resource population No. 1 (developed to identify resistance genes to Marek's disease), resource population No. 2 (developed to identify genes involved in abdominal fat), and resource population No. 3 (developed to identify genes involved in production traits), respectively. The 91 microsatellites that were polymorphic in the East Lansing reference population were genotyped and 86 genetic markers were eventually mapped. In addition, 11 new random amplified polymorphic DNA (RAPD) markers and 24 new markers based on the chicken CR1 element were mapped. The addition of these markers increases the total number of markers on the East Lansing genetic map to 273, of which 243 markers are resolved into 32 linkage groups. The map coverage within linkage groups is 1,402 cM with an average spacing of 6.7 cM between loci. The utility of the genetic map is greatly enhanced by adding 86 microsatellite markers. Based on our current map, approximately 2,550 cM of the chicken genome is within 20 cM of at least one microsatellite marker.

Animals↗

PubMedDate not supplied

Segmental enhancement of the cochlea on contrast-enhanced MR: correlation with the frequency of hearing loss and possible sign of perilymphatic fistula and autoimmune labyrinthitis.

PURPOSE: To relate the finding of selective enhancement of different turns of the cochlea to the frequency range of the hearing loss measured by audiogram. METHODS: Six patients aged 23 to 53 years, four men and two women, who presented with sudden hearing loss and had segmental enhancement of different turns of the cochlea on contrast-enhanced MR imaging were included in this retrospective study. The patients were imaged on a 1.5 T MR imaging system using pre- and postcontrast axial T1-weighted images and postcontrast coronal T1-weighted images through the temporal bone. RESULTS: The basal turn of the cochlea enhanced selectively in five of the six patients and the apical turn enhanced in the sixth patient. All patients had sensorineural hearing loss. Three of the patients with basal turn enhancement had predominantly high-frequency hearing loss, whereas the patient with apical turn enhancement had predominantly low-frequency hearing loss. The two other patients with basal turn enhancement had complete hearing loss. Three patients had presumed autoimmune labyrinthitis. The other three patients had strong clinical and surgical evidence of a perilymphatic fistula. CONCLUSION: Contrast-enhanced MR imaging may demonstrate selective enhancement of different turns of the cochlea. In certain patients, the areas of enhancement may correlate with specific hearing loss in the frequencies mapped by the enhancing segment. Enhancement of the cochlea may represent radiologic evidence of cochlear inflammation secondary to a perilymphatic fistula.

Adult↗

PubMed2003

Cross-talk between ERK MAP kinase and Smad signaling pathways enhances TGF-beta-dependent responses in human mesangial cells.

Transforming growth factor beta (TGF-beta) stimulates renal cell fibrogenesis by a poorly understood mechanism. Previously, we suggested a synergy between TGF-beta1 activated extracellular signal-regulated kinase (ERK) and Smad signaling in collagen production by human glomerular mesangial cells. In a heterologous DNA binding transcription assay, biochemical or dominant-negative ERK blockade reduced TGF-beta1 induced Smad3 activity. Total serine phosphorylation of Smad2/3, but not phosphorylation of the C-terminal SS(P)XS(P) motif, was decreased by pretreatment with the MEK/ERK inhibitors, PD98059 (10 microM) or U0126 (25 microM). This effect was not seen in the mouse mammary epithelial NMuMG cell line, indicating that ERK-dependent activation of Smad2/3 occurs only in certain cell types. TGF-beta stimulated phosphorylation of an expressed Smad3A construct, with a mutated C-terminal SS(P)XS(P) motif, was reduced by a MEK/ERK inhibitor. In contrast, MEK/ERK inhibition did not affect phosphorylation of a Smad3 construct mutated at consensus phosphorylation sites in the linker region (Smad3EPSM). Constitutively active MEK (caMEK) induced alpha2(I) collagen promoter activity, an effect blocked by co-transfected Smad3EPSM, but not Smad3A. The effects of caMEK and TGF-beta1 on collagen promoter activity were additive. These results indicate that ERK-dependent R-Smad linker region phosphorylation enhances collagen I synthesis and imply positive cross talk between the ERK and Smad pathways in human mesangial cells.

Animals↗

PubMed1997

ET-1 cooperates with EGF to induce mitogenesis via a PTX-sensitive pathway in airway smooth muscle cells.

We have examined the mitogenic effect of endothelin-1 (ET-1) alone or in combination with epidermal growth factor (EGF) in cultured airway smooth muscle cells (ASM) from guinea pig. ET-1 showed a weak mitogenic activity compared with the effect of EGF. However, when ET-1 and EGF were applied simultaneously, ET-1 synergistically enhanced the mitogenic activity of EGF. Neither inhibition of phospholipase C-beta nor depletion of protein kinase C affected this synergism. On the other hand, pertussis toxin (PTX), a Gi protein inhibitor, abolished the synergistic effect of ET-1 on EGF-induced mitogenesis. ET-1 induced a transient mitogen-activated protein (MAP) kinase activation peaking at 5 min. In contrast, EGF induced a stronger signal that was maintained for up to 20 min. However, concomitant stimulation of ASM with ET-1 and EGF caused an enhanced MAP kinase activation compared with EGF alone. Moreover, PTX abolished the enhanced MAP kinase activation observed in this condition. These results indicate that ET-1 can interact with an EGF-induced mitogenic axis through the Gi protein-dependent pathway, which is distinct from its direct mitogenic pathway.

Animals↗

PubMed1996

Comparative pharmacodynamic studies with the novel serotonin uptake-enhancing tianeptine and -inhibiting fluvoxamine utilizing EEG mapping and psychometry.

In a double-blind, placebo-controlled study, the encephalotropic and psychotropic effects of tianeptine (TIA)--a new tricyclic antidepressant, enhancing serotonin reuptake--were investigated as compared with the serotonin reuptake inhibiting antidepressant, fluvoxamine (FLU), utilizing EEG mapping, psychometric and psychophysiological measures. 16 healthy volunteers (8 males, 8 females) aged 21-35 (man 27) years received randomized and at weekly intervals single oral doses of placebo, 12.5 and 25 mg TIA and 50 mg FLU. EEG recordings, psychometric and psychophysiological tests and evaluation of pulse, blood pressure and side effects were carried out at 0, 2, 4, 6 and 8 hours; blood sampling, in addition, at hour 1. TIA plasma levels rose fast to peaks at 1-2 hours and declined rapidly as well, while the MC5 metabolite peaked in the 4th hour and declined more slowly. EEG mapping demonstrated that both TIA and FLU induced significant changes in brain function between the 1st and 8th hour, which, however, differed in their time course. 12.5 mg TIA exhibited, as compared with placebo, slight activating properties in the EEG (decrease of delta and theta, increase of alpha and beta, acceleration of the centroid), parallelled by thymopsychic improvement (mood elevation). 25 mg TIA showed EEG activation up to the 4th hour, later EEG sedation, accompanied by an initial thymopsychic improvement and differential changes thereafter (improved mood, decreased vigility), with the noopsyche improving at all times (attention, Pauli test). 50 mg FLU induced initially sedation and thereafter activation, accompanied by thymopsychic deterioration and subsequent improvement, the latter also being observed in the noopsyche (attention, memory). In pupillary and skin conductance measures, generally a slight activation occurred after placebo, which was attenuated by 25 mg TIA. Correlation maps between plasma levels and EEG changes demonstrated: the higher the TIA plasma levels, the more absolute and relative beta power, the less alpha power and the faster the centroid of the total power spectrum, reflecting CNS-activation. Topographically, the correlations were mostly seen over both fronto-temporal regions. In the latter, dominant frequency signalled desactivation in the right and activation in the left hemiphere after both antidepressants which, thereby induced changes in brain function opposite to those observed in depression. Both drugs were well tolerated.

Adult↗

PubMed1992

Recombinant human interleukin-9 induces protein tyrosine phosphorylation and synergizes with steel factor to stimulate proliferation of the human factor-dependent cell line, M07e.

Human interleukin-9 (IL-9) was originally identified and cloned based on its stimulatory effect on proliferation of human myeloid cell line, M07e. IL-9 synergized with Steel factor, the ligand for the c-kit product, to stimulate M07e cell proliferation. To investigate potential mechanisms for this, IL-9 was assessed for effects on protein tyrosine kinase activities in M07e cells by immunoblotting with anti-phosphotyrosine monoclonal antibody; results were compared with those of Steel factor alone and in combination with IL-9, and those of 12-0-tetradecanoyl phorbol-13-acetate (TPA). Recombinant human IL-9 (10 ng/mL) rapidly and transiently induced or enhanced at least four tyrosine phosphorylated protein bands with molecular weights of 105, 97, 85, and 81 Kd. This tyrosine phosphorylation pattern was different from that generated by recombinant murine Steel factor or TPA stimulation and the combination of IL-9 and Steel factor did not change the IL-9-induced pattern. IL-9-induced tyrosine phosphorylated bands were completely blocked by treatment of IL-9 with anti-IL-9 antibody under conditions that also neutralized the synergistic effect of IL-9 with Steel factor on M07e cell proliferation. Genistein, a tyrosine kinase inhibitor, blocked phosphorylation of IL-9 and Steel factor-induced bands. Unlike Steel factor or TPA, IL-9 did not appear to stimulate phosphorylation of 42-Kd mitogen-activated protein (MAP) kinase or Raf-1, or enhance MAP kinase activity. MAP kinase and Raf-1 are serine/threonine kinases that are phosphorylated and activated by many growth factors and by agonists for protein kinase C. While the combination of IL-9 plus SLF did not appear to induce phosphorylation of new bands not already seen with either IL-9 or SLF alone, or enhance the phosphorylation of those bands seen with either cytokine alone, the results suggest that IL-9 activates specific and unique signal transduction pathways.

Calcium-Calmodulin-Dependent Protein Kinases↗

PubMed2002

MAP kinase/estrogen receptor cross-talk enhances estrogen-mediated signaling and tumor growth but does not confer tamoxifen resistance.

The estrogen receptor alpha (ERalpha) signaling plays an essential role in breast cancer progression and endocrine therapy. Mitogen-activated protein kinase (MAPK/Erk1/2) has been implicated in ligand-independent activation of ER, resulting in the cross-talk between growth factor and ER mediated signaling. In this study, we examined the effect of the cross-talk on estradiol (E(2))-mediated signaling, tumor growth and its effect on anti-estrogen therapy. Our findings demonstrate that expression of constitutively activated mitogen activated kinase kinase (MEK1), an immediate upstream activator of MAPK in estrogen receptor positive MCF-7 breast cancer cells (MEK/MCF-7), showed an increase in ERalpha-driven transcriptional activation. In MEK/MCF-7 cells maximal transactivation levels were achieved in response to treatment with much lower E(2) concentrations (10(-10) M E(2)) when compared to MCF-7 control cells (10(-8) M E(2)). Furthermore, we have seen an increased association between ERalpha and its nuclear coactivators AIB1 or TIF-2, in MEK/MCF-7 cells relative to those seen in MCF-7 control cells. In addition, in vivo studies show that MEK/MCF-7 cell tumors are approximately threefold larger than those of MCF-7 cell, in the presence of E(2). Immunohistochemical staining demonstrates that progesterone receptor (PR) and pS2, two E(2)-regulated gene products, are significantly increased in MEK/MCF-7 cell tumors compared to those of MCF-7 control tumors, suggesting that activation of ERalpha by MAPK enhances the expression of E(2)-regulated genes and accelerates tumor growth. Remarkably, the antiestrogens tamoxifen and ICI 182,780, were shown both in vitro and in vivo studies to efficiently antagonize the stimulatory effects of E(2) on ER regulated transactivation and tumor growth in MEK/MCF-7 as well as MCF-7 cell lines. Taken together, these data suggest that MAPK/ER cross-talk enhances ERalpha-mediated signaling and accelerates E(2)-dependent tumor growth without diminishing sensitivity to the inhibitory effects of anti-estrogens.

Animals↗

PubMed1999

Vascular mitogen-activated protein kinase activity is enhanced via angiotensin system in spontaneously hypertensive rats.

The vascular structural remodeling function may be altered in genetically hypertensive animals, spontaneously hypertensive rats (SHR). To examine this possibility, we measured the activity of mitogen-activated protein (MAP) kinases, enzymes believed to be involved in the pathway for cell proliferation, in rat aorta strips, and examined whether the endothelium removal-induced MAP kinase activation function is altered in SHR and whether vascular angiotensin and endothelin systems are responsible for the alteration of MAP kinase activation in SHR. Male 4-week-old SHR and age-matched Wistar Kyoto rats (WKY) supplied by Charles River Japan were used. Endothelium-denuded aorta strips were incubated at 37 degrees C in medium. MAP kinase activity after incubation was time-dependently increased in strips from SHR and WKY. MAP kinase activation was greater in SHR than in WKY aorta strips. Similarly, MAP kinase activation was enhanced in aorta strips from 4-week-old SHR and stroke prone SHR supplied by the Diseases Model Cooperative Research Association (Kyoto, Japan). In aorta strips from SHR and WKY, the angiotensin receptor antagonist, losartan, and the endothelin receptor antagonist, cyclo (D-alpha-aspartyl-L-prolyl-D-valyl-L-leucyl-D-tryptophyl)(BQ123), caused concentration-dependent inhibition of MAP kinase activation. The losartan-induced but not BQ123-induced inhibition of MAP kinase activation was greater in SHR than in WKY aorta strips. Angiotensin II caused a concentration-dependent increase in MAP kinase activity and the angiotensin II-induced MAP kinase activation was greater in SHR than in WKY aorta strips. These results indicate that endothelium removal-induced MAP kinase activation is enhanced in aorta strips from young SHR, suggesting that vascular structural remodeling function may be enhanced in SHR. It appears that the enhancement of MAP kinase activation results, at least in part, from enhanced function of vascular angiotensin system in SHR.

Angiotensin II↗

PubMedDate not supplied

Enhancing performance measurement: NCQA's road map for a health information framework. National Committee for Quality Assurance.

Measuring the quality of health care delivery is one of the most critical challenges facing US health care. Performance measurement can be used to track the quality of care that health plans and medical groups deliver, but effective performance measurement requires timely access to detailed and accurate data. In 1996, the National Committee for Quality Assurance (NCQA) commissioned a report to learn what actions would improve health plans' capacity to electronically report performance data for the Health Plan Employer Data and Information Set (HEDIS). Tracking clinical performance will require not just clinical data stored in information systems, but an integrated health information framework. Seven features are essential to this framework: (1) it specifies data elements; (2) it establishes linkage capability among data elements and records; (3) it standardizes the element definitions; (4) it is automated to the greatest possible extent; (5) it specifies procedures for continually assessing data quality; (6) it maintains strict controls for protecting security and confidentiality of the data; and (7) it specifies protocols for sharing data across institutions under appropriate and well-defined circumstances. Health plans should anticipate the use of computerized patient records and prepare their data management for an information framework by (1) expanding and improving the capture and use of currently available data; (2) creating an environment that rewards the automation of data; (3) improving the quality of currently automated data; (4) implementing national standards; (5) improving clinical data management practices; (6) establishing a clear commitment to protecting the confidentiality of enrollee information; and (7) careful capital planning. Health care purchasers can provide the impetus for implementing the information framework if they demand detailed, accurate data on the quality of care.

Forms and Records Control↗

PubMed1996

An intron 1 regulatory region from the murine adenosine deaminase gene can activate heterologous promoters for ubiquitous expression in transgenic mice.

Ubiquitously expressed genes contain regulatory features which allow expression in virtually all cell types. In an effort to understand the molecular basis for this regulatory feature, the chromatin structure of the murine adenosine deaminase gene was examined by DNase I digestion in nuclei of several tissues. The promoter contained a strong hypersensitive site in all tissues examined, including those with very high and very low levels of ADA expression. Transgenic mouse studies revealed that a 3.3 kb EcoRI (3.3EE) fragment from intron I was required to generate a strong promoter DNase I hypersensitive site, and to produce ubiquitous expression. The 3.3EE fragment also contained a thymic enhancer activity which mapped to sequences conserved with the human ADA gene T-lymphocyte enhancer. Mutational analysis indicated that ubiquitous expression was not dependent on the presence of a functional thymic enhancer. Both the thymic enhancer and the ubiquitous activator within the 3.3EE fragment functioned with heterologous promoters in transgenic mice.

Adenosine Deaminase↗

PubMed1984

Xenon-enhanced computerised tomographic cerebral blood flow mapping.

Explore the source record for details and available documents.

Cerebrovascular Circulation↗

PubMed1998

The role of purinergic and adrenergic transmitters of the sympathetic system in the control of arterial blood pressure variability.

Variability of mean arterial pressure (MAP) was examined in chronically instrumented, conscious, freely moving rats with pharmacologically altered efferent sympathetic influences on the cardiovascular system. MAP was recorded for 30 min beat-to-beat, using a computer under both control and experimental conditions: after administration of adrenoceptor antagonists (prazosin or phentolamine) or under P2X receptor inactivation produced either by desensitization with alpha, beta-methylene ATP or by PPADS blockade. Inhibition of adrenergic sympathetic effects on the cardiovascular system produced long-lasting and stable decrease in MAP. Prazosin did not modify MAP variability whereas phentolamine enhanced it. Under P2X receptor desensitization MAP decreased, the hypotensive effect being accompanied by a significant increase in MAP variability. A similar increase in MAP variability was observed after PPADS administration, while MAP level was not changed. Administration of PPADS in combination with phentolamine increased MAP variability more significantly than each of the drugs given separately. Changes in MAP variability under the various experimental conditions were not consistently correlated with changes in heart rate variability. We propose that ATP, being a mediator of sympathetic vasoconstriction, participates in baroreceptor-induced stabilization of MAP level.

Adenosine Triphosphate↗

PubMed1997

Angiotensin type 2 receptor dephosphorylates Bcl-2 by activating mitogen-activated protein kinase phosphatase-1 and induces apoptosis.

We examined the cellular and signaling mechanism of angiotensin II (Ang II) type 2 (AT2) receptor-induced apoptosis in PC12W (rat pheochromocytoma cell line) cells that express abundant AT2 receptor but not Ang II type 1 receptor. In these cells, nerve growth factor (NGF) inhibited the internucleosomal DNA fragmentation induced by serum depletion, whereas Ang II antagonized this NGF cell survival action and induced apoptosis. We studied the mechanism of NGF and AT2 receptor interaction on apoptosis by examining their effects on the survival factor Bcl-2. AT2 receptor activation did affect intracellular Bcl-2 protein levels. Bcl-2 phosphorylation was stimulated by NGF, whereas AT2 receptor activation blocked this NGF effect. Pretreatment with antisense oligonucleotide of mitogen-activated protein (MAP) kinase phosphatase-1 enhanced the effects of NGF on MAP kinase activation and Bcl-2 phosphorylation but attenuated the inhibitory effects of AT2 receptor on MAP kinase, Bcl-2 phosphorylation, and apoptosis. Taken together, these results suggest that MAP kinase plays a critical role in inhibiting apoptosis by phosphorylating Bcl-2. The AT2 receptor inhibits MAP kinase activation, resulting in the inactivation of Bcl-2 and the induction of apoptosis.

Animals↗

PubMed1998

Functional map of a placenta-specific enhancer of the human leukemia inhibitory factor receptor gene.

We recently reported a placenta-specific enhancer in the human leukemia inhibitory factor receptor (LIFR) gene and now show detailed characterization of the 226-base pair enhancer (-4625/-4400 nucleotides). Four of twenty-two mutants in linker analysis showed reduced promoter activities to 45, 30, 10, and 10%, respectively. Specific binding of region A (-4617/-4602) with nuclear extract was competed by a known Oct-1 oligo and supershifted by Oct-1 antibody. Specific binding of region B (-4549/-4535) was competed by a GATA oligo, but could not be supershifted by four GATA antibodies. Nevertheless, mutagenesis showed that critical bases in region B were identical to the GATA core motif, indicating that region B may bind to a novel GATA family transcription factor. The other two adjacent regions designated as region C (-4464/-4445) showed no known consensus binding sites, and their specific placental JEG-3 nuclear extract binding was not evident in nonplacental nuclear extracts and was not competed by a trophoblast specific element (TSE), indicating that region C is a novel placenta-specific element (PSE, CATTTCCTGAACTAGTTTTT). Footprinting localized the binding boundary of PSE-binding protein (PSEB), and three Gs were found to be important for specific PSE binding. UV cross-linking showed that PSEB had a molecular mass of approximately 160 kDa, substituting the PSE with two previously reported placenta elements TSE or chorionic somatomammotropin enhancer factor 1 (CSEF-1) motifs resulted in markedly different promoter activities, indicating that PSEB is indeed different from TSE binding protein or CSEF-1. These results are the first demonstration that a novel PSE is the major element for placenta-specific enhancer activity in human LIFR gene.

Binding Sites↗

PubMed2001

Enhanced efficiency of quantitative trait loci mapping analysis based on multivariate complexes of quantitative traits.

An approach to increase the efficiency of mapping quantitative trait loci (QTL) was proposed earlier by the authors on the basis of bivariate analysis of correlated traits. The power of QTL detection using the log-likelihood ratio (LOD scores) grows proportionally to the broad sense heritability. We found that this relationship holds also for correlated traits, so that an increased bivariate heritability implicates a higher LOD score, higher detection power, and better mapping resolution. However, the increased number of parameters to be estimated complicates the application of this approach when a large number of traits are considered simultaneously. Here we present a multivariate generalization of our previous two-trait QTL analysis. The proposed multivariate analogue of QTL contribution to the broad-sense heritability based on interval-specific calculation of eigenvalues and eigenvectors of the residual covariance matrix allows prediction of the expected QTL detection power and mapping resolution for any subset of the initial multivariate trait complex. Permutation technique allows chromosome-wise testing of significance for the whole trait complex and the significance of the contribution of individual traits owing to: (a) their correlation with other traits, (b) dependence on the chromosome in question, and (c) both a and b. An example of application of the proposed method on a real data set of 11 traits from an experiment performed on an F(2)/F(3) mapping population of tetraploid wheat (Triticum durum x T. dicoccoides) is provided.

Chromosome Mapping↗