SEARCH · PubMed Health

Results for “duplex sequencing”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 289 records · Page 16Linked to original sources

PubMed1991

Selective cleavage of human DNA: RecA-assisted restriction endonuclease (RARE) cleavage.

Current methods for sequence-specific cleavage of large segments of DNA are severely limited because of the paucity of possible cleavage sites. A method is described whereby any Eco RI site can be targeted for specific cleavage. The technique is based on the ability of RecA protein from Escherichia coli to pair an oligonucleotide to its homologous sequence in duplex DNA and to form a three-stranded complex. This complex is protected from Eco RI methylase; after methylation and RecA protein removal, Eco RI restriction enzyme cleavage was limited to the site previously protected from methylation. When pairs of oligonucleotides are used, a specific fragment can be cleaved out of genomes. The method was tested on lambda phage, Escherichia coli, and human DNA. Fragments exceeding 500 kilobases in length and yields exceeding 80 percent could be obtained.

Base Sequence↗

PubMed1998

Nuclear magnetic resonance structure of d(GCATATGATAG). d(CTATCATATGC): a consensus sequence for promoters recognized by sigma K RNA polymerase.

The three-dimensional structure of d(GCATATGATAG).d(CTATCATATGC), from the promoter region of a gene regulating sporulation in Bacillus subtilis mother cells, was determined utilizing two-dimensional nuclear Overhauser effect (2D NOE) and double-quantum-filtered COSY (2QF-COSY) spectra. To minimize the effect of methods used to obtain restraints and refine structure, several variables were studied. Interproton distance bounds were calculated very conservatively by running the complete relaxation matrix program MARDIGRAS hundreds of times using 2D NOE spectra for exchangeable and for nonexchangeable protons at different mixing times, assuming different overall correlation times and different starting structures. The 435 distance restraints were used with two different structural refinement methods: restrained molecular dynamics (rMD) and restrained Monte Carlo calculations (rMC). Refinement using different procedures and starting structures resulted in essentially the same structure (<0.8 A rmsd), indicating that the structure is defined by experimental restraints and not the refinement method or variables used. R factors indicate the structures fit the experimental NOE data very well. Some helical parameters, notably large negative X displacement, are characteristic of A-DNA, but others are characteristic of B-DNA. As with TG.CA steps in other duplex DNA sequences studied in our laboratory, the two TG.CA steps have a positive roll, with T6-G7 exhibiting the largest, and consequently a bent helix axis. The converged structure represents a time-averaged structure. However, multiple conformations, especially in deoxyriboses, were evident from vicinal coupling constants obtained from quantitative simulations of 2QF-COSY cross-peaks and from persistent inconsistencies in experimental distances due to nonlinear conformational averaging.

Base Sequence↗

PubMedDate not supplied

[Effect of DNA local conformation on the affinity and binding specificity of bis-netropsins to DNA].

The interaction of short nucleotide duplexes with bis-netropsins, in which netropsin fragments are linked in the tail-to-tail orientation via cis-diammineplatinum group (<--Nt-Pt(NH3)-Nt-->) or aliphatic pentamethylene chain (<--Nt-(CH2)5-Nt-->), has been studied. Both the bis-netropsins have been shown to bind to DNA oligomer 5'-CCTATATCC-3' (I) as a hairpin with parallel orientation of netropsin fragments in 1:1 stoichiometry. Monodentate binding has been detected upon binding of bis-netropsins to other duplexes of sequences 5'-CCXCC-3'--where X = TTATT (II), TTAAT (III), TTTTT (IV), and AATTT (V)--along with the binding of bis-netropsins as a hairpin. The formation of dimeric antiparallel motif between the halves of two bound bis-netropsin molecules has been observed in the complexes of <--Nt-(CH2)5-Nt--> with DNA oligomers IV and V. The ratio of binding constant of bis-netropsin as a hairpin (K2) to monodentate binding constant (K1) has been shown to correlate with the width and/or conformational lability of DNA in the binding site. The share of bis-netropsin bound as a hairpin decreases in the order: TATAT > TTATT > TTAAT > TTTTT > AATTT, whereas the contribution of monodentate binding rises. The minimal strong binding site for <--Nt-Pt(NH3)-Nt--> and <--Nt-(CH2)5-Nt--> binding as a hairpin has been found to be DNA duplex 5'-CGTATACG-3'.

Anti-Bacterial Agents↗

PubMed1995

Overcoming potassium-mediated triplex inhibition.

Sequence-specific duplex DNA recognition by oligonucleotide-directed triple helix formation is a possible approach to in vivo gene inhibition. However, triple helix formation involving guanine-rich oligonucleotides is inhibited by physiological ions, particularly K+, most likely due to oligonucleotide aggregation via guanine quartets. Three oligodeoxynucleotide (ODN) derivatives were tested for their ability to resist guanine quartet-mediated aggregation, yet form stable triplexes. Electrophoretic mobility shift and dimethyl sulfate footprinting assays were used to analyze the formation of triplexes involving these oligonucleotide derivatives. In the absence of K+, all ODNs had similar binding affinities for the duplex target. Triplexes involving a 14mer ODN derivative containing 7-deazaxanthine substituted for three thymine bases or an 18mer ODN containing two additional thymines on both the 5' and 3' termini were abolished by 50 mM K+. Remarkably, triplexes involving an ODN derivative containing four 6-thioguanine bases substituted for guanine resisted K+ inhibition up to 200 mM. We hypothesize that the increased radius and decreased electronegativity of sulfur in the 6-position of guanine destabilize potential guanine quartets. These results improve the prospects for creating ODNS that might serve as specific and efficient gene repressors in vivo.

Animals↗

PubMed1996

Minor groove hydration of DNA in aqueous solution: sequence-dependent next neighbor effect of the hydration lifetimes in d(TTAA)2 segments measured by NMR spectroscopy.

The hydration in the minor groove of double stranded DNA fragments containing the sequences 5'-dTTAAT, 5'-dTTAAC, 5'-dTTAAA and 5'-dTTAAG was investigated by studying the decanucleotide duplex d(GCATTAATGC)2 and the singly cross-linked decameric duplexes 5'-d(GCATTAACGC)-3'-linker-5'-d(GCGTTAATGC)-3' and 5'-d(GCCTTAAAGC)-3'-linker-5'-d(GCTTTAAGGC)-3' by NMR spectroscopy. The linker employed consisted of six ethyleneglycol units. The hydration water was detected by NOEs between water and DNA protons in NOESY and ROESY spectra. NOE-NOESY and ROE-NOESY experiments were used to filter out intense exchange cross-peaks and to observe water-DNA NOEs with sugar 1' protons. Positive NOESY cross-peaks corresponding to residence times longer than approximately 0.5 ns were observed for 2H resonances of the central adenine residues in the duplex containing the sequences 5'-dTTAAT and 5'-dTTAAC, but not in the duplex containing the sequences 5'-dTTAAA and 5'-dTTAAG. In all nucleotide sequences studied here, the hydration water in the minor groove is significantly more mobile at both ends of the AT-rich inner segments, as indicated by very weak or negative water-A 2H NOESY cross-peaks. No positive NOESY cross-peaks were detected with the G 1'H and C 1'H resonances, indicating that the minor groove hydration water near GC base pairs is kinetically less restrained than for AT-rich DNA segments. Kinetically stabilized minor groove hydration water was manifested by positive NOESY cross-peaks with both A 2H and 1'H signals of the 5'-dTTAA segment in d(GCATTAATGC)2. More rigid hydration water was detected near T4 in d(GCATTAATGC)2 as compared with 5'-d(GCATTAACGC)-3'-linker-5'-d(GCGTTAATGC)-3', although the sequences differ only in a single base pair. This illustrates the high sensitivity of water-DNA NOEs towards small conformational differences.

Base Sequence↗

PubMed2026

Mutation timing, accumulation, and selection in the male germline shape inheritance risk for developmental disorders.

De novo mutations (DNMs) in the paternal germline are a major cause of developmental disorders, but how mutation timing, paternal age, and spermatogonial selection jointly shape transmissible risk within individual fathers is unclear. We combined trio whole-genome sequencing from 167 families with deep targeted NanoSeq profiling of sperm from 127 fathers of children with confirmed pathogenic DNMs. Transmitted DNM burden and paternal sperm mutation burden, spectra, and selection landscape were indistinguishable from population reference cohorts. Six fathers carried pathogenic early mosaic variants detectable in sperm at variant allele fractions (VAFs) of 0.7%-14.8%, creating individual recurrence-risk outliers. However, early mosaics accounted for ∼8% of the cohort-aggregated pathogenic burden exome-wide, compared with ∼18% from known positively selected drivers and ∼74% from other rare variants accumulating with paternal age. Thus, paternal de novo disease risk is shaped primarily by universal age-associated mutation and selection, while early mosaicism creates uncommon but clinically important high-risk individuals.

DNMs↗

PubMed1989

Identification of 2-deoxyribonolactone at the site of neocarzinostatin-induced cytosine release in the sequence d(AGC).

Neocarzinostatin- (NCS) induced release of cytosine from the deoxycytidylate residues of d(AGC) sequences of duplex oligonucleotides leaves a damaged sugar residue with intact phosphodiester linkages [Kappen, L.S., Chen, C., & Goldberg, I.H. (1988) Biochemistry 27, 4331-4340]. In order to isolate and characterize the sugar damage product, drug-treated duplex d(AGCGAGC*G) (the single target C* residue has 3H in its 5- and 5'-positions) was enzymatically digested to mononucleosides. High-pressure liquid chromatographic analysis of the digest revealed drug-induced products which could be cleanly separated by thin-layer chromatography (TLC) into two components: product a (Rf0.47) and product 1 (Rf0.87). The more polar product a was further purified by adsorption onto DEAE-Sephadex A-25. After elution with HCl and lyophilization, this material behaved like product 1 on TLC. Readjustment to alkaline pH caused its quantitative conversion back to product a. On electrophoresis product 1 behaved like a neutral compound, and the negatively charged product a migrated just behind formate. On the basis of the various chemical and biochemical characteristics of the lesion and apparent 3H abstraction by NCS from the C-1' position, it appears that the two interconvertible products a and 1 are respectively the acid (carboxylate) and lactone forms of 2-deoxyribonic acid. The structure of the sugar damage product was confirmed by gas chromatography/mass spectrometry. The amount of 2-deoxyribonolactone recovered is about 60% of the cytosine released on a molar basis, showing that it is the major, if not the only, product associated with cytosine release.(ABSTRACT TRUNCATED AT 250 WORDS)

Antibiotics, Antineoplastic↗

PubMed1994

Methylphosphonate mapping of phosphate contacts critical for RNA recognition by the human immunodeficiency virus tat and rev proteins.

The HIV-1 regulatory proteins tat and rev are both RNA binding proteins which recognize sequences in duplex RNA which are close to structural distortions. Here we identify phosphate contacts which are critical for each binding reaction by use of a new method. Model RNA binding sites are constructed carrying substitutions of individual phosphodiesters by uncharged methylphosphonate derivatives isolated separately as Rp and Sp diastereoisomers and tested for protein binding by competition assays. In the binding of tat to the trans-activation response region (TAR), three phosphates, P21 and P22 which are adjacent to the U-rich bulge and P40 on the opposite strand, are essential and in each case both isomers inhibit binding. Similarly, in the interaction between the HIV-1 rev protein and the rev-responsive element (RRE) both methylphosphonate isomers at P103, P104, P124 and P125 interfere with rev binding. At P106, only the Rp methylphosphonate isomer is impaired in rev binding ability and it is proposed that the Rp oxygen is hydrogen-bonded to an uncharged amino acid or to a main chain hydrogen atom. Synthetic chemistry techniques also provide evidence for the conformations of non-Watson-Crick G106:G129 and G105:A131 base-pairs in the RRE 'bubble' structure upon rev binding. Almost all functional groups on the 5 bulged residues in the bubble have been ruled out as sites of contact with rev but, by contrast, the N7-positions of each G residue in the flanking base-pairs are identified as sites of likely hydrogen-bonding to rev. The results show that both tat and rev recognize the major groove of distorted RNA helixes and that both proteins make specific contacts with phosphates which are displaced from the sites of base-pair contact.

Base Composition↗

PubMed1999

Association of double-stranded DNA fragments into multistranded DNA structures.

We have previously observed that double-stranded DNA fragments containing a tract of the tandemly repeated sequence poly(CA). poly(TG) can associate in vitro to form stable complexes of low electrophoretic mobility, which are recognized with high specificity by proteins HMG1 and HMG2. The formation of such complexes has since been observed to depend on interactions of DNA with polypropylene surfaces, with the suggestion that the formation of low mobility complexes might be the result of strand dissociation followed by misaligned reassociation of the repetitive sequences. The data presented here show that at high ionic strength the interactions of DNA with polypropylene are sufficiently strong for DNA to remain bound to the polypropylene surface, which suggests that DNA might also be involved in interactions with hydrophobic molecules in vivo. Under such conditions, low-mobility complexes are found only in the material adsorbed to the polypropylene surface, and all DNA fragments are able to form low-mobility structures, whether or not they contain repetitive sequences. Preventing the separation of strands by ligating hairpin loop oligonucleotides at both ends of the fragments does not prevent the formation of low-mobility complexes. Our results suggest two different pathways for the formation of complexes. In the first, dissociation is followed by misaligned reassociation of repetitive sequences, yielding duplexes with single-stranded end regions that associate to form multimeric complexes. In the second, repetitive as well as nonrepetitive DNA molecules bound to polypropylene adopt a conformation with locally unwound regions, which allows interactions between neighboring duplexes adsorbed on the surface, resulting in the formation of low-mobility complexes.

DNA↗

PubMed2003

A bifunctional platinum(II) complex capable of intercalation and hydrogen-bonding interactions with DNA: binding studies and cytotoxicity.

The interactions of [Pt(CNN)(4-dpt)]PF(6), (1; 4-dpt=2,4-diamino-6-(4-pyridyl)-1,3,5-triazine, HCNN=6-phenyl-2,2'-bipyridine) with double-stranded DNA, poly(dA-dT)(2), and poly(dG-dC)(2) were examined by spectroscopic, electrophoretic, and hydrodynamic methods. The spectroscopic data were analyzed with McGhee, van't Hoff, and Gibbs-Helmholtz equations. In a comparative study, [Pt(CNN)(py)]PF(6) (2; py=pyridine) was prepared and the nature of its binding towards DNA was investigated [preliminary results: ChemBioChem 2003, 4, 62-68]. For reactions with calf thymus DNA at 20 degrees C, the intrinsic binding constants for 1 and 2 are (4.6+/-0.2)x10(5) and (2.3+/-0.3)x10(4) mol(-1) dm(3), respectively. Results of DNA-binding reactions revealed that 1 and 2 preferentially bind to the AT sequence of duplex DNA. Intercalation is the preferred binding mode for 2, whereas both intercalation and minor-groove binding are observed for 1. Complex 1 is cytotoxic against a number of carcinoma cell lines, including KB-3-1, CNE-3, and HepG2, and remains potent against multidrug- or cisplatin-resistant KB-V-1 and CNE1 cell lines, for which the resistance ratios are 1.6 and 1.5, respectively. Importantly, 1 is almost an order of magnitude less toxic to the normal cell line CCD-19Lu (IC(50)=176+/-1.7 microM) and it selectively induced apoptosis leading to cancer cell death with less than 5 % detectable necrosis.

Animals↗

PubMed1997

Telomere-telomere interactions and candidate telomere binding protein(s) in mammalian sperm cells.

We have used fluorescent in situ hybridization to localize telomeres within the nuclei of sperm from six mammals (human, rat, mouse, stallion, boar, and bull). In minimally swollen sperm of mouse and rat, most of the telomeres are clustered within a limited area in the posterior part of nuclei. In sperm of other species, telomeres associate into tetrameres and dimers. On swelling of sperm cells with heparin/dithiotriethol, telomere associations disperse, and hybridization signals become smaller in size and their numbers approach or correspond to the number of chromosome ends in a haploid genome. Quantitation of telomere loci indicates that dimeric associations are prominent features of mammalian sperm nuclear architecture. Higher order telomere-telomere interactions and organization develop during meiotic stages of human spermatogenesis. At this stage, telomeres also become associated with the nuclear membrane. In an attempt to elucidate the molecular mechanisms underlying telomere interactions in sperm, we have identified a novel protein activity that binds to the double-stranded telomeric repeat (TTAGGG)n. Sperm telomere binding protein(s) (STBP) was extracted from human and bull sperm by 0.5 M NaCl. STBP does not bind single-stranded telomeric DNA and is highly specific for single base substitutions in a duplex DNA sequence. Depending on the conditions of binding, we observed the formation of several nucleoprotein complexes. We have shown that there is a transition between complexes, which indicates that the slower migrating complex is a multimer of the higher mobility one. We propose that STBP participates in association between the telomere domains which were microscopically observed in mammalian spermatozoa.

Animals↗

PubMed1983

Structure subtraction as an approach to investigation of the mechanism of restriction enzyme action.

Endonuclease BamHI cleaves the phosphodiester bonds between the guanine residues within the duplex DNA sequence G decreases GATCC. The substrate characteristics of oligonucleotides, containing some defects in the sequence recognized by endonuclease (nick, absence of some internucleotide phosphate or nucleotide, partially single-stranded form of the recognition site) were investigated. The results suggest that the specificity of synthetic oligonucleotide cleavage is strongly dependent on the ribosophosphate backbone intactness inside the recognition site. BamHI was found not to hydrolyse the phosphodiester bonds outside the double helix. Also BamHI forms a productive complex with the non-symmetrical substrate, having half the recognition sites, of a single strand.

Bacillus↗

PubMed1993

Relative stability of AT and GC pairs in parallel DNA duplex formed by a natural sequence.

The low-cooperative melting of parallel DNA formed by a natural 40 bp long sequence from Drosophila: 5'-d(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)-3' 5'-d(ACTAACTAGCTAACAAACGTACGTGTGCAAAAACACTCGC)-3' that possesses a normal nucleotide content was studied by using the special method of measuring the fluorescence of its complex with acriflavine as well as by conventional thermal denaturation. Acriflavine allows discrimination of the melting of AT and GC pairs because its fluorescence is quenched by neighbouring G bases. We have observed that about 40% of AT pairs melt at 14 degrees C while the remainder melt at 42 degrees C. The GC pairs remain stable up to approximately 40 degrees C and melt at 54 degrees C. The higher stability of GC pairs suggests the formation of cis Watson-Crick pairs in parallel DNA.

Animals↗

PubMed1988

Local mobility of nucleic acids as determined from crystallographic data. III. A daunomycin-DNA complex.

The local mobility of the complex between the anti-tumor drug daunomycin and a DNA hexanucleotide duplex of sequence d(CpGpTpApCpG)2 has been determined by anisotropic refinement of single crystal X-ray diffraction data of 1.2 A resolution (1 A = 0.1 nm). The directions and amplitudes of the local motion indicate that changes in mobility of DNA due to daunomycin binding are primarily limited to the residues forming the intercalation site and do not propagate to the neighboring residues. The intercalated daunomycin ring system (aglycone) is rigidly fixed in the base stack, apparently serving as an anchor for the amino sugar segment of the drug which is one of the most mobile regions of the entire complex. The high flexibility of this amino sugar may be important for inhibition of replication and transcription not only by sterically blocking the minor groove, but also by allowing nonproductive interactions to be formed with various polymerases or other DNA-binding proteins. The crystallographic model is improved sufficiently by the rigid group anisotropic refinement to allow additional bound water molecules to be located.

Chemical Phenomena↗

PubMed2004

A comparison of siRNA efficacy predictors.

Short interfering RNA (siRNA) efficacy prediction algorithms aim to increase the probability of selecting target sites that are applicable for gene silencing by RNA interference. Many algorithms have been published recently, and they base their predictions on such different features as duplex stability, sequence characteristics, mRNA secondary structure, and target site uniqueness. We compare the performance of the algorithms on a collection of publicly available siRNAs. First, we show that our regularized genetic programming algorithm GPboost appears to have a higher and more stable performance than other algorithms on the collected datasets. Second, several algorithms gave close to random classification on unseen data, and only GPboost and three other algorithms have a reasonably high and stable performance on all parts of the dataset. Third, the results indicate that the siRNAs' sequence is sufficient input to siRNA efficacy algorithms, and that other features that have been suggested to be important may be indirectly captured by the sequence.

Algorithms↗

PubMed2026

Caloric restriction modulates genome-wide somatic mutation in mice.

Somatic mutations accumulate throughout life in every cell, and this process constitutes one of the hallmarks of aging-genomic instability. Caloric restriction (CR) has been shown to extend lifespan across diverse species. Using high-fidelity duplex DNA sequencing of bulk liver, bulk kidney, hepatocytes, and cerebellar neurons, we found that CR in mice reduces genome-wide somatic mutation burdens across multiple tissues and cell types. CR reduced both substitution and insertion/deletion burdens, with the magnitude of these effects varying across sample types. CR also decreased the activity of the enigmatic single-base substitution (SBS) mutational process SBS5 that gives rise to most mutations in mammals. Surprisingly, the mutation burden reduction from CR was greatest in transcriptionally inactive regions. This work illuminates links between diet, aging, and genomic integrity and establishes genomic integrity as a modifiable axis of aging.

DNA↗

PubMed1995

Human alanyl-tRNA synthetase: conservation in evolution of catalytic core and microhelix recognition.

The class II Escherichia coli and human alanyl-tRNA synthetases cross-acylate their respective tRNAs and require, for aminoacylation, an acceptor helix G3:U70 base pair that is conserved in evolution. We report here the primary structure and expression in the yeast Pichia of an active human alanyl-tRNA synthetase. The N-terminal 498 amino acids of the 968-residue polypeptide have substantial (41%) identity with the E. coli protein. A closely related region encompasses the class-defining domain of the E. coli enzyme and includes the part needed for recognition of the acceptor helix. As a result, previously reported mutagenesis, modeling, domain organization, and biochemical characterization on the E. coli protein appear valid as a template for the human protein. In particular, we show that both the E. coli enzyme and the human enzyme purified from Pichia aminoacylate 9-base pair RNA duplexes whose sequences are based on the acceptor stems of either E. coli or human alanine tRNAs. In contrast, the sequences of the two enzymes completely diverge in an internal portion of the C-terminal half that is essential for tetramer formation by the E. coli enzyme, but that is dispensable for microhelix aminoacylation. This divergence correlates with the expressed human enzyme behaving as a monomer. Thus, the region of close sequence similarity may be a consequence of strong selective pressure to conserve the acceptor helix G3:U70 base pair as an RNA signal for alanine.

Alanine-tRNA Ligase↗

PubMed1995

Structure of a dicationic monoimidazole lexitropsin bound to DNA.

An X-ray crystal structure has been solved of the complex of a dicationic lexitropsin with a B-DNA duplex of sequence CGCGAATTCGCG. The lexitropsin is identical to netropsin except for replacement of the first methylpyrrole ring by methylimidazole, converting a =CH- to =N-. Crystals are isomorphous with those of the DNA dodecamer in the absence of drug. Although the =N- for =CH- substitution was intended to make that locus on the drug molecule compatible with a G.C base pair, electrostatic attraction for the two cationic ends of the drug predominates, and this lexitropsin binds to the same central AATT site as does the parent netropsin. But unlike netropsin, this lexitropsin exhibits end-for-end disorder in the crystal. Both orientations were refined separately to completion. Final residual errors at 2.25 A resolution for the 2358 reflections above 2 sigma in F are R = 0.165 for one orientation (LexA) with 37 water molecules and 0.164 for the inverted drug orientation (LexB) with 40 water molecules. This molecular disorder is probably attributable to a weakening of binding to the AATT site occasioned by the imidazole-for-pyrrole substitution.

Antibiotics, Antineoplastic↗