PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “Enhancer mapping”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 325 records · Page 18Linked to original sources
PubMed2003

Cross-talk between ERK MAP kinase and Smad signaling pathways enhances TGF-beta-dependent responses in human mesangial cells.

Transforming growth factor beta (TGF-beta) stimulates renal cell fibrogenesis by a poorly understood mechanism. Previously, we suggested a synergy between TGF-beta1 activated extracellular signal-regulated kinase (ERK) and Smad signaling in collagen production by human glomerular mesangial cells. In a heterologous DNA binding transcription assay, biochemical or dominant-negative ERK blockade reduced TGF-beta1 induced Smad3 activity. Total serine phosphorylation of Smad2/3, but not phosphorylation of the C-terminal SS(P)XS(P) motif, was decreased by pretreatment with the MEK/ERK inhibitors, PD98059 (10 microM) or U0126 (25 microM). This effect was not seen in the mouse mammary epithelial NMuMG cell line, indicating that ERK-dependent activation of Smad2/3 occurs only in certain cell types. TGF-beta stimulated phosphorylation of an expressed Smad3A construct, with a mutated C-terminal SS(P)XS(P) motif, was reduced by a MEK/ERK inhibitor. In contrast, MEK/ERK inhibition did not affect phosphorylation of a Smad3 construct mutated at consensus phosphorylation sites in the linker region (Smad3EPSM). Constitutively active MEK (caMEK) induced alpha2(I) collagen promoter activity, an effect blocked by co-transfected Smad3EPSM, but not Smad3A. The effects of caMEK and TGF-beta1 on collagen promoter activity were additive. These results indicate that ERK-dependent R-Smad linker region phosphorylation enhances collagen I synthesis and imply positive cross talk between the ERK and Smad pathways in human mesangial cells.

Animals↗
PubMed1997

ET-1 cooperates with EGF to induce mitogenesis via a PTX-sensitive pathway in airway smooth muscle cells.

We have examined the mitogenic effect of endothelin-1 (ET-1) alone or in combination with epidermal growth factor (EGF) in cultured airway smooth muscle cells (ASM) from guinea pig. ET-1 showed a weak mitogenic activity compared with the effect of EGF. However, when ET-1 and EGF were applied simultaneously, ET-1 synergistically enhanced the mitogenic activity of EGF. Neither inhibition of phospholipase C-beta nor depletion of protein kinase C affected this synergism. On the other hand, pertussis toxin (PTX), a Gi protein inhibitor, abolished the synergistic effect of ET-1 on EGF-induced mitogenesis. ET-1 induced a transient mitogen-activated protein (MAP) kinase activation peaking at 5 min. In contrast, EGF induced a stronger signal that was maintained for up to 20 min. However, concomitant stimulation of ASM with ET-1 and EGF caused an enhanced MAP kinase activation compared with EGF alone. Moreover, PTX abolished the enhanced MAP kinase activation observed in this condition. These results indicate that ET-1 can interact with an EGF-induced mitogenic axis through the Gi protein-dependent pathway, which is distinct from its direct mitogenic pathway.

Animals↗
PubMed1996

Comparative pharmacodynamic studies with the novel serotonin uptake-enhancing tianeptine and -inhibiting fluvoxamine utilizing EEG mapping and psychometry.

In a double-blind, placebo-controlled study, the encephalotropic and psychotropic effects of tianeptine (TIA)--a new tricyclic antidepressant, enhancing serotonin reuptake--were investigated as compared with the serotonin reuptake inhibiting antidepressant, fluvoxamine (FLU), utilizing EEG mapping, psychometric and psychophysiological measures. 16 healthy volunteers (8 males, 8 females) aged 21-35 (man 27) years received randomized and at weekly intervals single oral doses of placebo, 12.5 and 25 mg TIA and 50 mg FLU. EEG recordings, psychometric and psychophysiological tests and evaluation of pulse, blood pressure and side effects were carried out at 0, 2, 4, 6 and 8 hours; blood sampling, in addition, at hour 1. TIA plasma levels rose fast to peaks at 1-2 hours and declined rapidly as well, while the MC5 metabolite peaked in the 4th hour and declined more slowly. EEG mapping demonstrated that both TIA and FLU induced significant changes in brain function between the 1st and 8th hour, which, however, differed in their time course. 12.5 mg TIA exhibited, as compared with placebo, slight activating properties in the EEG (decrease of delta and theta, increase of alpha and beta, acceleration of the centroid), parallelled by thymopsychic improvement (mood elevation). 25 mg TIA showed EEG activation up to the 4th hour, later EEG sedation, accompanied by an initial thymopsychic improvement and differential changes thereafter (improved mood, decreased vigility), with the noopsyche improving at all times (attention, Pauli test). 50 mg FLU induced initially sedation and thereafter activation, accompanied by thymopsychic deterioration and subsequent improvement, the latter also being observed in the noopsyche (attention, memory). In pupillary and skin conductance measures, generally a slight activation occurred after placebo, which was attenuated by 25 mg TIA. Correlation maps between plasma levels and EEG changes demonstrated: the higher the TIA plasma levels, the more absolute and relative beta power, the less alpha power and the faster the centroid of the total power spectrum, reflecting CNS-activation. Topographically, the correlations were mostly seen over both fronto-temporal regions. In the latter, dominant frequency signalled desactivation in the right and activation in the left hemiphere after both antidepressants which, thereby induced changes in brain function opposite to those observed in depression. Both drugs were well tolerated.

Adult↗
PubMed1992

Recombinant human interleukin-9 induces protein tyrosine phosphorylation and synergizes with steel factor to stimulate proliferation of the human factor-dependent cell line, M07e.

Human interleukin-9 (IL-9) was originally identified and cloned based on its stimulatory effect on proliferation of human myeloid cell line, M07e. IL-9 synergized with Steel factor, the ligand for the c-kit product, to stimulate M07e cell proliferation. To investigate potential mechanisms for this, IL-9 was assessed for effects on protein tyrosine kinase activities in M07e cells by immunoblotting with anti-phosphotyrosine monoclonal antibody; results were compared with those of Steel factor alone and in combination with IL-9, and those of 12-0-tetradecanoyl phorbol-13-acetate (TPA). Recombinant human IL-9 (10 ng/mL) rapidly and transiently induced or enhanced at least four tyrosine phosphorylated protein bands with molecular weights of 105, 97, 85, and 81 Kd. This tyrosine phosphorylation pattern was different from that generated by recombinant murine Steel factor or TPA stimulation and the combination of IL-9 and Steel factor did not change the IL-9-induced pattern. IL-9-induced tyrosine phosphorylated bands were completely blocked by treatment of IL-9 with anti-IL-9 antibody under conditions that also neutralized the synergistic effect of IL-9 with Steel factor on M07e cell proliferation. Genistein, a tyrosine kinase inhibitor, blocked phosphorylation of IL-9 and Steel factor-induced bands. Unlike Steel factor or TPA, IL-9 did not appear to stimulate phosphorylation of 42-Kd mitogen-activated protein (MAP) kinase or Raf-1, or enhance MAP kinase activity. MAP kinase and Raf-1 are serine/threonine kinases that are phosphorylated and activated by many growth factors and by agonists for protein kinase C. While the combination of IL-9 plus SLF did not appear to induce phosphorylation of new bands not already seen with either IL-9 or SLF alone, or enhance the phosphorylation of those bands seen with either cytokine alone, the results suggest that IL-9 activates specific and unique signal transduction pathways.

Calcium-Calmodulin-Dependent Protein Kinases↗
PubMed2002

MAP kinase/estrogen receptor cross-talk enhances estrogen-mediated signaling and tumor growth but does not confer tamoxifen resistance.

The estrogen receptor alpha (ERalpha) signaling plays an essential role in breast cancer progression and endocrine therapy. Mitogen-activated protein kinase (MAPK/Erk1/2) has been implicated in ligand-independent activation of ER, resulting in the cross-talk between growth factor and ER mediated signaling. In this study, we examined the effect of the cross-talk on estradiol (E(2))-mediated signaling, tumor growth and its effect on anti-estrogen therapy. Our findings demonstrate that expression of constitutively activated mitogen activated kinase kinase (MEK1), an immediate upstream activator of MAPK in estrogen receptor positive MCF-7 breast cancer cells (MEK/MCF-7), showed an increase in ERalpha-driven transcriptional activation. In MEK/MCF-7 cells maximal transactivation levels were achieved in response to treatment with much lower E(2) concentrations (10(-10) M E(2)) when compared to MCF-7 control cells (10(-8) M E(2)). Furthermore, we have seen an increased association between ERalpha and its nuclear coactivators AIB1 or TIF-2, in MEK/MCF-7 cells relative to those seen in MCF-7 control cells. In addition, in vivo studies show that MEK/MCF-7 cell tumors are approximately threefold larger than those of MCF-7 cell, in the presence of E(2). Immunohistochemical staining demonstrates that progesterone receptor (PR) and pS2, two E(2)-regulated gene products, are significantly increased in MEK/MCF-7 cell tumors compared to those of MCF-7 control tumors, suggesting that activation of ERalpha by MAPK enhances the expression of E(2)-regulated genes and accelerates tumor growth. Remarkably, the antiestrogens tamoxifen and ICI 182,780, were shown both in vitro and in vivo studies to efficiently antagonize the stimulatory effects of E(2) on ER regulated transactivation and tumor growth in MEK/MCF-7 as well as MCF-7 cell lines. Taken together, these data suggest that MAPK/ER cross-talk enhances ERalpha-mediated signaling and accelerates E(2)-dependent tumor growth without diminishing sensitivity to the inhibitory effects of anti-estrogens.

Animals↗
PubMed1999

Vascular mitogen-activated protein kinase activity is enhanced via angiotensin system in spontaneously hypertensive rats.

The vascular structural remodeling function may be altered in genetically hypertensive animals, spontaneously hypertensive rats (SHR). To examine this possibility, we measured the activity of mitogen-activated protein (MAP) kinases, enzymes believed to be involved in the pathway for cell proliferation, in rat aorta strips, and examined whether the endothelium removal-induced MAP kinase activation function is altered in SHR and whether vascular angiotensin and endothelin systems are responsible for the alteration of MAP kinase activation in SHR. Male 4-week-old SHR and age-matched Wistar Kyoto rats (WKY) supplied by Charles River Japan were used. Endothelium-denuded aorta strips were incubated at 37 degrees C in medium. MAP kinase activity after incubation was time-dependently increased in strips from SHR and WKY. MAP kinase activation was greater in SHR than in WKY aorta strips. Similarly, MAP kinase activation was enhanced in aorta strips from 4-week-old SHR and stroke prone SHR supplied by the Diseases Model Cooperative Research Association (Kyoto, Japan). In aorta strips from SHR and WKY, the angiotensin receptor antagonist, losartan, and the endothelin receptor antagonist, cyclo (D-alpha-aspartyl-L-prolyl-D-valyl-L-leucyl-D-tryptophyl)(BQ123), caused concentration-dependent inhibition of MAP kinase activation. The losartan-induced but not BQ123-induced inhibition of MAP kinase activation was greater in SHR than in WKY aorta strips. Angiotensin II caused a concentration-dependent increase in MAP kinase activity and the angiotensin II-induced MAP kinase activation was greater in SHR than in WKY aorta strips. These results indicate that endothelium removal-induced MAP kinase activation is enhanced in aorta strips from young SHR, suggesting that vascular structural remodeling function may be enhanced in SHR. It appears that the enhancement of MAP kinase activation results, at least in part, from enhanced function of vascular angiotensin system in SHR.

Angiotensin II↗
PubMed2004

Cytoplasmic dynein mediates adenovirus binding to microtubules.

During infection, adenovirus (Ad) capsids undergo microtubule-dependent retrograde transport as part of a program of vectorial transport of the viral genome to the nucleus. The microtubule-associated molecular motor, cytoplasmic dynein, has been implicated in the retrograde movement of Ad. We hypothesized that cytoplasmic dynein constituted the primary mode of association of Ad with microtubules. To evaluate this hypothesis, an Ad-microtubule binding assay was established in which microtubules were polymerized with taxol, combined with Ad in the presence or absence of microtubule-associated proteins (MAPs), and centrifuged through a glycerol cushion. The addition of purified bovine brain MAPs increased the fraction of Ad in the microtubule pellet from 17.3% +/- 3.5% to 80.7% +/- 3.8% (P < 0.01). In the absence of tubulin polymerization or in the presence of high salt, no Ad was found in the pellet. Ad binding to microtubules was not enhanced by bovine brain MAPs enriched for tau protein or by the addition of bovine serum albumin. Enhanced Ad-microtubule binding was also observed by using a fraction of MAPs purified from lung A549 epithelial cell lysate which contained cytoplasmic dynein. Ad-microtubule interaction was sensitive to the addition of ATP, a hallmark of cytoplasmic dynein-dependent microtubule interactions. Immunodepletion of cytoplasmic dynein from the A549 cell lysate abolished the MAP-enhanced Ad-microtubule binding. The interaction of Ad with both dynein and dynactin complexes was demonstrated by coimmunoprecipitation. Partially uncoated capsids isolated from cells 40 min after infection also exhibited microtubule binding. In summary, the primary mode of Ad attachment to microtubules occurs though cytoplasmic dynein-mediated binding.

Adenosine Triphosphate↗
PubMedDate not supplied

Enhancing performance measurement: NCQA's road map for a health information framework. National Committee for Quality Assurance.

Measuring the quality of health care delivery is one of the most critical challenges facing US health care. Performance measurement can be used to track the quality of care that health plans and medical groups deliver, but effective performance measurement requires timely access to detailed and accurate data. In 1996, the National Committee for Quality Assurance (NCQA) commissioned a report to learn what actions would improve health plans' capacity to electronically report performance data for the Health Plan Employer Data and Information Set (HEDIS). Tracking clinical performance will require not just clinical data stored in information systems, but an integrated health information framework. Seven features are essential to this framework: (1) it specifies data elements; (2) it establishes linkage capability among data elements and records; (3) it standardizes the element definitions; (4) it is automated to the greatest possible extent; (5) it specifies procedures for continually assessing data quality; (6) it maintains strict controls for protecting security and confidentiality of the data; and (7) it specifies protocols for sharing data across institutions under appropriate and well-defined circumstances. Health plans should anticipate the use of computerized patient records and prepare their data management for an information framework by (1) expanding and improving the capture and use of currently available data; (2) creating an environment that rewards the automation of data; (3) improving the quality of currently automated data; (4) implementing national standards; (5) improving clinical data management practices; (6) establishing a clear commitment to protecting the confidentiality of enrollee information; and (7) careful capital planning. Health care purchasers can provide the impetus for implementing the information framework if they demand detailed, accurate data on the quality of care.

Forms and Records Control↗
PubMed1996

An intron 1 regulatory region from the murine adenosine deaminase gene can activate heterologous promoters for ubiquitous expression in transgenic mice.

Ubiquitously expressed genes contain regulatory features which allow expression in virtually all cell types. In an effort to understand the molecular basis for this regulatory feature, the chromatin structure of the murine adenosine deaminase gene was examined by DNase I digestion in nuclei of several tissues. The promoter contained a strong hypersensitive site in all tissues examined, including those with very high and very low levels of ADA expression. Transgenic mouse studies revealed that a 3.3 kb EcoRI (3.3EE) fragment from intron I was required to generate a strong promoter DNase I hypersensitive site, and to produce ubiquitous expression. The 3.3EE fragment also contained a thymic enhancer activity which mapped to sequences conserved with the human ADA gene T-lymphocyte enhancer. Mutational analysis indicated that ubiquitous expression was not dependent on the presence of a functional thymic enhancer. Both the thymic enhancer and the ubiquitous activator within the 3.3EE fragment functioned with heterologous promoters in transgenic mice.

Adenosine Deaminase↗
PubMed1998

The role of purinergic and adrenergic transmitters of the sympathetic system in the control of arterial blood pressure variability.

Variability of mean arterial pressure (MAP) was examined in chronically instrumented, conscious, freely moving rats with pharmacologically altered efferent sympathetic influences on the cardiovascular system. MAP was recorded for 30 min beat-to-beat, using a computer under both control and experimental conditions: after administration of adrenoceptor antagonists (prazosin or phentolamine) or under P2X receptor inactivation produced either by desensitization with alpha, beta-methylene ATP or by PPADS blockade. Inhibition of adrenergic sympathetic effects on the cardiovascular system produced long-lasting and stable decrease in MAP. Prazosin did not modify MAP variability whereas phentolamine enhanced it. Under P2X receptor desensitization MAP decreased, the hypotensive effect being accompanied by a significant increase in MAP variability. A similar increase in MAP variability was observed after PPADS administration, while MAP level was not changed. Administration of PPADS in combination with phentolamine increased MAP variability more significantly than each of the drugs given separately. Changes in MAP variability under the various experimental conditions were not consistently correlated with changes in heart rate variability. We propose that ATP, being a mediator of sympathetic vasoconstriction, participates in baroreceptor-induced stabilization of MAP level.

Adenosine Triphosphate↗
PubMed2004

Data preprocessing by wavelets and genetic algorithms for enhanced multivariate analysis of LC peptide mapping.

Peptide mapping by means of liquid chromatography is a powerful technique used for the characterisation and analysis of the primary structure of proteins. Subtle changes in the covalent structure of the protein can be detected by means of the chromatographic profile (fingerprint). Chromatographic methods, however, display variations in the chromatographic profile even at identical instrumental settings and sample conditions. These variations may be due to changes of the chromatographic conditions, e.g. slight shifts in column temperature, and degradation or alterations of the stationary phase or small changes in the trifluoroacetic acid (TFA) concentration. Such variations may result in varying retention times and peak shapes of the analytes and differences in the chromatographic baseline, thereby having a detrimental impact on the results obtained on multivariate analysis of peptide maps. In order to reduce the non-sample-related variations and to be able to more fully extract the information in peptide mapping, approaches for achieving this objective are outlined in the present study. These methods are denoising and data compression of the chromatograms by wavelets, baseline corrections by linear interpolation, and peak shift alignments towards a target chromatogram by means of a genetic algorithm. Visual inspections of preprocessed chromatograms and principal component analysis (PCA) score plots demonstrate the efficiency of the methodology used. Furthermore, deliberately added changes, e.g. insertions of small Gaussian peaks (outliers), are more easily detected by the proposed methods than from the original chromatograms by multivariate analysis.

Algorithms↗
PubMed1997

Angiotensin type 2 receptor dephosphorylates Bcl-2 by activating mitogen-activated protein kinase phosphatase-1 and induces apoptosis.

We examined the cellular and signaling mechanism of angiotensin II (Ang II) type 2 (AT2) receptor-induced apoptosis in PC12W (rat pheochromocytoma cell line) cells that express abundant AT2 receptor but not Ang II type 1 receptor. In these cells, nerve growth factor (NGF) inhibited the internucleosomal DNA fragmentation induced by serum depletion, whereas Ang II antagonized this NGF cell survival action and induced apoptosis. We studied the mechanism of NGF and AT2 receptor interaction on apoptosis by examining their effects on the survival factor Bcl-2. AT2 receptor activation did affect intracellular Bcl-2 protein levels. Bcl-2 phosphorylation was stimulated by NGF, whereas AT2 receptor activation blocked this NGF effect. Pretreatment with antisense oligonucleotide of mitogen-activated protein (MAP) kinase phosphatase-1 enhanced the effects of NGF on MAP kinase activation and Bcl-2 phosphorylation but attenuated the inhibitory effects of AT2 receptor on MAP kinase, Bcl-2 phosphorylation, and apoptosis. Taken together, these results suggest that MAP kinase plays a critical role in inhibiting apoptosis by phosphorylating Bcl-2. The AT2 receptor inhibits MAP kinase activation, resulting in the inactivation of Bcl-2 and the induction of apoptosis.

Animals↗
PubMed1998

Functional map of a placenta-specific enhancer of the human leukemia inhibitory factor receptor gene.

We recently reported a placenta-specific enhancer in the human leukemia inhibitory factor receptor (LIFR) gene and now show detailed characterization of the 226-base pair enhancer (-4625/-4400 nucleotides). Four of twenty-two mutants in linker analysis showed reduced promoter activities to 45, 30, 10, and 10%, respectively. Specific binding of region A (-4617/-4602) with nuclear extract was competed by a known Oct-1 oligo and supershifted by Oct-1 antibody. Specific binding of region B (-4549/-4535) was competed by a GATA oligo, but could not be supershifted by four GATA antibodies. Nevertheless, mutagenesis showed that critical bases in region B were identical to the GATA core motif, indicating that region B may bind to a novel GATA family transcription factor. The other two adjacent regions designated as region C (-4464/-4445) showed no known consensus binding sites, and their specific placental JEG-3 nuclear extract binding was not evident in nonplacental nuclear extracts and was not competed by a trophoblast specific element (TSE), indicating that region C is a novel placenta-specific element (PSE, CATTTCCTGAACTAGTTTTT). Footprinting localized the binding boundary of PSE-binding protein (PSEB), and three Gs were found to be important for specific PSE binding. UV cross-linking showed that PSEB had a molecular mass of approximately 160 kDa, substituting the PSE with two previously reported placenta elements TSE or chorionic somatomammotropin enhancer factor 1 (CSEF-1) motifs resulted in markedly different promoter activities, indicating that PSEB is indeed different from TSE binding protein or CSEF-1. These results are the first demonstration that a novel PSE is the major element for placenta-specific enhancer activity in human LIFR gene.

Binding Sites↗
PubMed2001

Enhanced efficiency of quantitative trait loci mapping analysis based on multivariate complexes of quantitative traits.

An approach to increase the efficiency of mapping quantitative trait loci (QTL) was proposed earlier by the authors on the basis of bivariate analysis of correlated traits. The power of QTL detection using the log-likelihood ratio (LOD scores) grows proportionally to the broad sense heritability. We found that this relationship holds also for correlated traits, so that an increased bivariate heritability implicates a higher LOD score, higher detection power, and better mapping resolution. However, the increased number of parameters to be estimated complicates the application of this approach when a large number of traits are considered simultaneously. Here we present a multivariate generalization of our previous two-trait QTL analysis. The proposed multivariate analogue of QTL contribution to the broad-sense heritability based on interval-specific calculation of eigenvalues and eigenvectors of the residual covariance matrix allows prediction of the expected QTL detection power and mapping resolution for any subset of the initial multivariate trait complex. Permutation technique allows chromosome-wise testing of significance for the whole trait complex and the significance of the contribution of individual traits owing to: (a) their correlation with other traits, (b) dependence on the chromosome in question, and (c) both a and b. An example of application of the proposed method on a real data set of 11 traits from an experiment performed on an F(2)/F(3) mapping population of tetraploid wheat (Triticum durum x T. dicoccoides) is provided.

Chromosome Mapping↗
PubMed2004

MAP estimation for hyperspectral image resolution enhancement using an auxiliary sensor.

This paper presents a novel maximum a posteriori estimator for enhancing the spatial resolution of an image using co-registered high spatial-resolution imagery from an auxiliary sensor. Here, we focus on the use of high-resolution panchomatic data to enhance hyperspectral imagery. However, the estimation framework developed allows for any number of spectral bands in the primary and auxiliary image. The proposed technique is suitable for applications where some correlation, either localized or global, exists between the auxiliary image and the image being enhanced. To exploit localized correlations, a spatially varying statistical model, based on vector quantization, is used. Another important aspect of the proposed algorithm is that it allows for the use of an accurate observation model relating the "true" scene with the low-resolutions observations. Experimental results with hyperspectral data derived from the airborne visible-infrared imaging spectrometer are presented to demonstrate the efficacy of the proposed estimator.

Algorithms↗
PubMed1980

Inhibition of amygdaloid kindling by chronic pretreatment with cocaine or methamphetamine.

Amygdaloid kindling was induced by daily electrical stimulation in the left amygdala in five groups of cats: a chronic cocaine pretreatment group; a chronic methamphetamine (MAP) pretreatment group; two treatment groups, one using pimozide and the other haloperidol during the period when kindling was being induced; and a drug-free control group. The number of left amygdaloid stimulations required for generalized convulsions was significantly greater in the two chronic pretreatment groups and significantly less in the two treatment groups, compared to the control group. All animals in the chronic cocaine and MAP pretreatment groups showed hemiconvulsions instead of symmetrical generalized convulsions and lateralized interictal discharges in the stimulated hemisphere. In rekindling to the right amygdala, seizure development was significantly suppressed compared to the control group. In the two chronic pretreatment groups, chronic administration of cocaine or MAP was followed by enhancement of behavioral responses to cocaine, MAP, and apomorphine. The association of such "sensitization" with impairment of the kindling process suggests that dopamine receptor sensitivity is an important factor in this form of epileptogenesis.

Amygdala↗
PubMed1999

Diagnostic usefulness of endorectal magnetic resonance imaging with dynamic contrast-enhancement in patients with localized prostate cancer: mapping studies with biopsy specimens.

BACKGROUND: New diagnostic criteria for dynamic magnetic resonance (MR) imaging in prostate cancer are presented. The diagnostic usefulness of endorectal MR imaging with dynamic contrast-enhancement in localized prostate cancer and the validity of these criteria were evaluated. METHODS: Eighteen untreated patients who were suspected of localized prostate cancer were included in the study. They received endorectal dynamic MR imaging before systematic sextant needle biopsy. First. a mapping study with the findings of MR images and histopathology of biopsy specimens was performed in eight patients out of 18 to compare the difference in T2-weighted images with the endorectal coil and the body coil in the same individuals. Second, another mapping study was performed in all 18 patients by analyzing the findings of endorectal dynamic MR images. For the diagnosis of prostate cancer in MR imaging, we offered diagnostic criteria from our experience in addition to those in plain T2-weighted images from the literature. RESULTS: The overall diagnostic rates of endorectal dynamic MR imaging were 88.9% in accuracy, 100% in sensitivity, and 81.8% in specificity. In the comparison of the endorectal and body coils in T2-weighted images in eight patients, there was no difference in the diagnostic rates except for one more histopathologic false positive portion in endorectal MR imaging. In the second mapping study in 18 patients, the diagnostic rates were 92.6% in accuracy, 88.9% in sensitivity and 93.3% in specificity. Endorectal dynamic imaging raised the diagnostic sensitivity from 77.8 to 88.9%. CONCLUSION: The data demonstrated the validity of this diagnostic criteria and the diagnostic usefulness of endorectal dynamic MR imaging in localized prostate cancer.

Aged↗