SEARCH · PubMed Health

Results for “Oligodeoxyribonucleotides”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 37 records · Page 2Linked to original sources

PubMed1991

Evidence that a triplex-forming oligodeoxyribonucleotide binds to the c-myc promoter in HeLa cells, thereby reducing c-myc mRNA levels.

A synthetic 27-base-long oligodeoxyribonucleotide, termed PU1, has been shown to bind to duplex DNA to form a triplex at a single site within the human c-myc P1 promoter. PU1 has been administered to HeLa cells in culture to examine the feasibility of influencing transcription of the c-myc gene in vivo. It is shown that uptake of PU1 into the nucleus of HeLa cells is efficient and that the compound remains intact for at least 4 hr. In nuclei extracted from PU1-treated cells, inhibition of DNase I cleavage is detected within the c-myc P1 promoter at the target site for triplex formation. The inhibition is shown to be both site and oligodeoxyribonucleotide specific. After cellular uptake of PU1, it is shown that steady-state mRNA arising from the c-myc P1 initiation site is selectively reduced relative to total mRNA, relative to mRNA from the alternative c-myc P2 initiation site, and relative to mRNA derived from the beta-actin promoter. Significant mRNA repression is not seen upon treating cells with oligodeoxyribonucleotides that fail to bind to the P1 promoter target. Taken together, these data suggest that triplex formation can occur between an exogenous oligodeoxyribonucleotide and duplex DNA in the nucleus of treated cells.

Base Sequence↗

PubMed1998

Reaction of O6-benzylguanine-resistant mutants of human O6-alkylguanine-DNA alkyltransferase with O6-benzylguanine in oligodeoxyribonucleotides.

Inactivation of the human DNA repair protein, O6-alkylguanine-DNA alkyltransferase (AGT), by O6-benzylguanine renders tumor cells susceptible to killing by alkylating agents. AGT mutants resistant to O6-benzylguanine can be made by converting Pro140 to an alanine (P140A) or Gly156 to an alanine (G156A). These mutations had a much smaller effect on the reaction with O6-benzylguanine when it was incorporated into a short single-stranded oligodeoxyribonucleotide. Such oligodeoxyribonucleotides could form the basis for the design of improved AGT inhibitors. AGT and mutants P140A and G156A preferentially reacted with O6-benzylguanine when incubated with a mixture of two 16-mer oligodeoxyribonucleotides, one containing O6-benzylguanine and the other, O6-methylguanine. When the 6 amino acids located in positions 159-164 in AGT were replaced by the equivalent sequence from the Escherichia coli Ada-C protein (mutant AGT/6ada) the preference for benzyl repair was eliminated. Further mutation incorporating the P140A change into AGT/6ada giving mutant P140A/6ada led to a protein that resembled Ada-C in preference for the repair of methyl groups, but P140A/6ada did not differ from P140A in reaction with the free base O6-benzylguanine. Changes in the AGT active site pocket can therefore affect the preference for repair of O6-benzyl or -methyl groups when present in an oligodeoxyribonucleotide without altering the reaction with free O6-benzylguanine.

Amino Acid Sequence↗

PubMed1982

The preparative synthesis of oligodeoxyribonucleotides using RNA ligase.

The synthesis of nmol quantities of defined sequences of oligodeoxyribonucleotides using T4 RNA ligase has been demonstrated. Reacting using from 18 to 200 nmol of substrates in which a single 2'-deoxyribonucleoside 3',5'-bisphosphate was added to an oligodeoxyribonucleotide resulted in yields from 13 to 95%. When two oligodeoxyribonucleotides were similarly joined using RNA ligase, the yields ranged from 10 to 50%. Although the reactions contained high concentrations of enzyme and were incubated from 5 to 21 days, there was little degradation of either substrates or products. We have also characterized an unusual product which arises when 3'-phosphate terminated oligodeoxyribonucleotides are incubated with RNA ligase and high concentrations of ATP. This product has an adenylyl group linked to the 3'-phosphate by an anhydride bond. The mechanistic and synthetic implications of forming this product are discussed.

Base Sequence↗

PubMed1987

alpha-DNA. VI: Comparative study of alpha- and beta-anomeric oligodeoxyribonucleotides in hybridization to mRNA and in cell free translation inhibition.

alpha and beta-anomeric d(G2T12G2) oligodeoxyribonucleotides were compared for their hybridization to rA12: the observed melting temperatures are 27 degrees C for beta-oligodeoxyribonucleotide/RNA hybrid and 53 degrees C for alpha-oligodeoxyribonucleotide/RNA. alpha-oligonucleotides with the four bases, complementary to natural mRNAs, were synthesized for the first time, labeled at their 5'-end with [32P] and used as probes in Northern blot experiments. In spite of these higher affinities for their target RNA's, they were unable to block translation of natural or synthetic mRNA's in rabbit reticulocyte lysate. We have studied the RNase H activity on model rA12:alpha- or beta-d(G2T12G2) hybrids or on mRNA:alpha- or beta-oligonucleotides hybrids. Specific hybridization protects RNA strech when using alpha-oligonucleotides but not beta-oligonucleotides. Thus, our results show the inability of RNase H to degrade RNA in alpha-oligodeoxyribonucleotides:RNA duplexes.

Endoribonucleases↗

PubMed1996

Hydration of single-stranded phosphodiester and phosphorothioate oligodeoxyribonucleotides.

Infrared spectroscopy was used to identify hydration-sensitive structural differences between single- stranded phosphorothioate (PS) and phosphodiester (PO) oligodeoxyribonucleotides. Spectra were recorded in the mid-infrared region, 500-1800 cm-1, at relative humidities between 0 and 98%; the PS and PO spectra are substantially different. The hydration effects on spectral bands in these single-stranded oligodeoxyribonucleotides is markedly different from such behavior in double- and triple-stranded oligodeoxyribonucleotides. A strong absorption occurs at 656 cm-1 in the phosphorothioate sample which is completely absent from the PO spectra. Gravimetric measurements were carried out on one PS and one PO sample to monitor and confirm hydration. The calculated BET adsorption constants [Brunauer, S., Emmett, RH. and Teller, E. (1938) J. Am. Chem. Soc., 60, 309-319] are 1.2 and 1.4 water molecules per nucleotide in the first hydration layer of PS and PO respectively. While the gravimetric data indicate that the single-stranded oligodeoxyribonucleotides hydrate very similarly to duplex DNA, the mid-infrared conformational marker bands are strikingly different from those observed for duplex DNA. In particular, the Vas of the phosphate group (PO2) at 1222 cm-1 in the single-stranded PO spectra is independent of relative humidity.

Base Sequence↗

PubMed1998

Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand.

Aflatoxin B1↗

PubMed2001

Immobilization of oligodeoxyribonucleotides with multiple anchors to microchips.

Facile modification of oligodeoxyribonucleotides is required for efficient immobilization to a pre-activated glass surface. This report presents an oligodeoxyribonucleotide which contains a hairpin stem-loop structure with multiple phosphorothioate moieties in the loop. These moieties are used to anchor the oligo to glass slides that are pre-activated with bromoacetamidopropylsilane. The efficiency of the attachment reaction was improved by increasing the number of phosphorothioates in the loop, as shown in the remarkable enhancement of template hybridization and single base extension through catalysis by DNA polymerase. The loop and stem presumably serve as lateral spacers between neighboring oligodeoxyribonucleotides and as a linker arm between the glass surface and the single-stranded sequence of interest. The oligodeoxyribonucleotides of this hairpin stem-loop architecture with multiple phosphorothioate moieties have broad application in DNA chip-based gene analysis.

Base Sequence↗

PubMed2001

Inactivation of human O(6)-alkylguanine-DNA alkyltransferase by modified oligodeoxyribonucleotides containing O(6)-benzylguanine.

Inactivation of the DNA repair protein O(6)-alkylguanine-DNA alkyltransferase (AGT) enhances tumor cell killing by therapeutic alkylating agents. O(6)-Benzylguanine (b(6)G) can inactivate AGT and is currently in clinical trials to enhance therapy. Short oligodeoxyribonucleotides containing b(6)G are much more effective inactivators, but their use for therapeutic purposes is likely to be compromised by metabolic instability. We have therefore examined the ability to inactivate AGT of an 11-mer oligodeoxyribonucleotide containing b(6)G (11-mpBG) when modified with terminal methylphosphonate linkages to protect it from nucleases. This modification did not reduce the ability to serve as a substrate/inactivator for AGT, and 11-mpBG had an ED(50) value of 1.3 nM, more than 300-fold lower than that for b(6)G. A similar oligodeoxyribonucleotide containing O(6)-methylguanine (m(6)G) was also found to be a good substrate (ED(50) value of 10 nM), but the benzylated form was repaired more rapidly and preferentially. When added to HT29 cell cultures, 5 microM 11-mpBG was able to cause a prolonged inactivation of cellular AGT for at least 72 h and to greatly sensitize the cells to killing by 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU). The 11-mpMG was ineffective at up to 20 microM, suggesting that the benzyl group allows better uptake into the cell. However, even with 11-mpBG, the 1000-fold decrease in potency toward AGT in HT29 cells compared to that toward the protein in vitro suggests that uptake may be a limiting factor. These results suggest that oligodeoxyribonucleotides such as 11-mpBG may prove to be useful drugs for potentiation of alkylating agent chemotherapy if uptake can be improved.

Antineoplastic Agents, Alkylating↗

PubMedDate not supplied

Repair of short oligodeoxyribonucleotides containing a stable adduct and an apurinic site by extracts of MCF-10A1 cells.

BACKGROUND: DNA with two sites of damage in close proximity might not be repaired as efficiently as DNA with a single damage site. MATERIALS AND METHODS: To study this hypothesis, we utilized short oligodeoxyribonucleotides with a stable adduct 7 or 16 nucleotides (nt) downstream from an apurinic (AP) site. Repair by extracts of human breast epithelial MCF-10A1 cells was assayed by quantifying the incorporation of [alpha-32P]dTTP. RESULTS: The level of repair of an oligodeoxyribonucleotide with an AP site 7 nt from a stable adduct was comparable to that of the oligodeoxyribonucleotide with only an AP site. A decrease in overall repair of oligodeoxyribonucleotides containing an AP site and a stable adduct was observed if these lesions were 16 nt apart compared to the presence of only an AP site. CONCLUSION: The ability of human breast MCF-10A1 cells to repair DNA adducts and AP sites is affected by other near-by lesions.

Apurinic Acid↗

PubMed1980

A novel class of condensing reagents in phosphodiester oligodeoxyribonucleotides synthesis. Application of the constituents of free terminal carboxy oxytocine gene.

Benzotriazol-1-yl-oxy-tris (dimethylamino) phosphonium salts have been used as novel condensing agents to promote internucleotide bond formation in phosphotriester oligodeoxyribonucleotide synthesis. The effectiveness of these stable compounds has been shown by the synthesis of the six oligodeoxyribonucleotide building blocks of the carboxy terminal oxytocine gene. Some modifications incorporated in the phosphotriester method include a rapid procedure to prepare the fully protected dideoxyribonucleotide blocks and size exclusion chromatography of the deprotected oligodeoxyribonucleotides. The triester oligodeoxyribonucleotides were studied by chemical ionization mass spectrometry.

Base Sequence↗

PubMed2001

Inhibition of the human chemokine receptor CXCR4 by antisense phosphorothioate oligodeoxyribonucleotides.

The CXC chemokine receptor CXCR4/fusion, a major coreceptor for the T-cell line T-tropic (X4) HIV-1 virus, plays a critical role in T-tropic virus fusion and entry into permissive cells. In the present study, we describe the effects of an antisense phosphorothioate oligodeoxyribonucleotide (anti-S-ODN) on the inhibition of CXCR4 gene expression in X4 HIV-1 infected HeLa-CD4 cells, to find more efficacious therapeutic possibilities for human immunodeficiency virus type 1 (HIV-1) infection. The naked antisense phosphorothioate oligodeoxyribonucleotide (anti-S-ODN-1), containing the AUG initiation codon at the center of the oligodeoxyribonucleotide, showed a slightly higher inhibitory effect on HIV-1 gag p24 production among all sequences tested. We also examined the concomitant use of a basic peptide transfection reagent, nucleosomal histone proteins (RNP), for the delivery of the anti-S-ODN-1. The anti-S-ODN-1 encapsulated with RNP had higher inhibitory effects on p24 products than the naked anti-S-ODN-1. When the anti-S-ODN-1 encapsulated with RNP was incubated with HeLa-CD4 cells, the surface levels of this chemokine receptor showed high suppression, indicating sequence-specific inhibition. The activities of unmodified oligodeoxyribonucleotide are effectively enhanced by using a basic peptide, RNP.

CD4 Antigens↗

PubMed1987

A general method for the purification of synthetic oligodeoxyribonucleotides containing strong secondary structure by reversed-phase high-performance liquid chromatography on PRP-1 resin.

Synthetic 5'-dimethoxytritylated oligodeoxyribonucleotides, which contained strong secondary structure, were satisfactorily denatured and purified by reversed-phase HPLC on PRP-1 columns when strongly alkaline conditions (0.05 M NaOH) were employed. This procedure was suitable for the purification of hairpin structures, e.g., d(CG)nT4(CG)n (n = 4, 5, 6), and oligo(dG) sequences, e.g., d(G)24, as well as oligodeoxyribonucleotide probes which contained degenerate base sites. Oligodeoxyribonucleotides as long as 50 bases in length were purified. Recovery of injected oligonucleotides was typically 90% or better. The high capacity of the PRP-1 resin also allowed purification to be performed on a preparative scale (2-8 mg per injection). Enzymatic degradation and HPLC analysis indicated that no modification of the heterocyclic bases occurred under the alkaline conditions described.

Base Sequence↗

PubMed1988

Techniques for using antisense oligodeoxyribonucleotides to study gene expression.

Molecular biology is providing powerful tools for cloning and sequencing genes. The more difficult task is that of ascribing functions to the specific DNA sequences that appear to code for proteins, the "open reading frames," or of regulating the expression of known genes in biological systems in order to determine their contributions to cellular functions. The classical genetic approach of making mutants is difficult in eukaryotic systems, with the exception of yeasts and viruses, and has proved of limited utility. A promising approach to this problem has been to introduce into either the in vitro assay or tissue culture system oligodeoxyribonucleotides with nucleotide sequences complementary to the protein coding or "sense" sequence, usually referred to as "antisense" oligonucleotides. The term MATAGEN (MAsking TApe for Gene ExpressioN) has also been used for these compounds, which appear to inhibit gene expression predominantly by hybridization arrest of translation. Interest in the use of antisense molecules for the study of gene expression and regulation has increased dramatically in the past few years. The demonstrated utility of the antisense oligomer in both in vitro and tissue culture assays, the increased availability of nucleotide sequence data as well as improvements in nucleic acid sequencing techniques, and the automation of synthetic procedures for their preparation have made studies using these molecules more practical. This review focuses on short oligodeoxyribonucleotides, which offer important stability and synthetic advantages over the use of antisense RNA transcripts, and is intended as an introduction to practical approaches in the use of antisense oligodeoxyribonucleotides in biological systems. For synthetic techniques, the reader is referred to the individual references cited.

Animals↗

PubMed2001

Synthesis and properties of triple helix-forming oligodeoxyribonucleotides containing 7-chloro-7-deaza-2'-deoxyguanosine.

Multiple incorporations of 7-chloro-7-deaza-2'-deoxyguanosine in place of 2'-deoxyguanosine have been performed into a triple helix-forming oligodeoxyribonucleotide involving a run of six contiguous guanines designed to bind in a parallel orientation relative to the purine strand of the DNA target. The ability of these modified oligodeoxyribonucleotides to form triple helices in a buffer containing monovalent cations was studied by UV--melting curves analysis, gel shift assay and restriction enzyme protection assay. In the presence of Na(+), the incorporation of two, three or five modified nucleosides in the third strand has improved the efficacy of formation of the triplex as compared to that formed with the unmodified oligonucleotide. The stabilities of the three modified triplexes were similar. The coupling of 6-chloro-2-methoxy-9-(omega-hexylamino)-acridine to the 5'-end of the oligonucleotides containing modified nucleosides led to an increase in triplex stability similar to that observed when the acridine was added to the 5'-end of the unmodified oligonucleotide. In the presence of K(+), only the oligodeoxyribonucleotides containing modified G retained the ability to form triple helices with the same efficiency. The incorporation of the modified nucleoside has two effects: (i) it decreases TFO self-association, and (ii) it slightly increases triplex stability. The enhanced ability of the modified oligonucleotides containing 7-chloro-7-deaza-2'-deoxyguanosine over the parent oligomer to form triple helices was confirmed by inhibition of restriction enzyme cleavage using a circular plasmid containing the target sequence.

DNA, Viral↗

PubMed1991

Nucleotide positions responsible for the processivity of the reaction of exonuclease I with oligodeoxyribonucleotides.

The processive hydrolysis of single-stranded oligodeoxyribonucleotides by exonuclease I from Escherichia coli has been investigated. Oligodeoxyribonucleotides and their analogues, which contain either an abasic site or a methylphosphonate internucleotide linkage, were partially hydrolyzed by exonuclease I. The relative dissociation constant for the enzyme and each oligomeric product was calculated from the concentration of that oligomer found in solution and hence released by the enzyme before complete hydrolysis. The results have led to a characterization of the two oligodeoxyribonucleotide domains that bind to exonuclease I. The first domain, which begins at the reactive 3'-terminal phosphodiester and extends to the 7th nucleoside base, requires both phosphodiester monoanions and base residues for its interaction with the enzyme. The second domain includes phosphodiester monoanions in positions 9-13 from the 3'-terminus but does not require nucleoside bases. Methylphosphonate substitutions indicate that only two or three of these phosphodiesters, in variable positions, must remain anionic in order to obtain full enzyme binding. The residues between the two binding domains do not play a significant role in the enzyme-oligomer interaction.

Base Sequence↗

PubMed1999

Site-specific synthesis of aflatoxin B(1) adducts within an oligodeoxyribonucleotide containing the human p53 codon 249 sequence.

This work describes the preparation of the cationic trans-8, 9-dihydro-8-(N7-guanyl)-9-hydroxyaflatoxin B(1) ((AFB)G) adducts at the positions corresponding to G(746) or G(747), within the oligodeoxyribonucleotide d(GGAGGCCT) containing the codon 249 sequence (underlined) of the p53 gene, using DNA triplexes to target adduction at the desired site. This approach enabled the successful preparation and purification of sufficient quantities of d(GGAG(AFB)GCCT) for NMR structural studies, using only standard phosphoramidites. The presence of multiple guanines in this oligodeoxynucleotide precluded the direct reaction of d(GGAGGCCT). d(AGGCCTCC) with aflatoxin epoxide as a method for producing large quantities of site-specific adducts for physical studies. Of the multiple potential alkylation sites at guanine N7 in d(GGAGGCCT). d(AGGCCTCC), it was found that sites G(2) and G(5) exhibited approximately equal reactivity with aflatoxin B(1)-exo-8,9-epoxide; the reactivity at site G(4) was reduced by approximately a factor of 2 as compared to that at G(2) or G(5). To successfully prepare the site-specific adducts, the p53 oligodeoxyribonucleotide was annealed with either the blocking strand d(CTCCATTTTCCT) or d(CCTCCATTTTCCTC) to form the corresponding partial triplexes which targeted AFB(1) adduction either to G(4) or to G(5). Piperidine cleavage, followed by heating, confirmed that in each instance, the product corresponded to the lone guanine not protected from adduction by the partial DNA triplex. The adducted oligodeoxyribonucleotides were examined with regard to purity by capillary electrophoresis. The primary advantage of this modified triple helix methodology is that it requires only standard phosphoramidites; thus, it is applicable to large-scale preparations that are necessary for NMR structural studies or other physical measurements.

Aflatoxin B1↗

PubMed1984

Optimization of polyacrylamide gel electrophoresis conditions used for sequencing mixed oligodeoxyribonucleotides.

We investigated two components of the polyacrylamide gel electrophoresis system used for sequencing DNA to improve the system for sequencing synthesized oligodeoxyribonucleotides containing positions of degeneracy. First, we varied the ratio of methylene-bis-acrylamide (MBA) to acrylamide from that commonly used in DNA sequencing gels (1% MBA:19% acrylamide). A moderate increase in the MBA:acrylamide ratio proves optimal when sequencing is used to confirm that a synthesized fragment contains equivalent stoichiometries of the different nucleotides at a given position of degeneracy. Such information is particularly important if the degenerate oligodeoxyribonucleotide preparation is to be employed as a hybridization probe. A further increase in the MBA:acrylamide ratio (3% MBA:19% acrylamide) produces a gel in which the sequence of an oligodeoxyribonucleotide mixture containing several positions of degeneracy can be read most easily. Increasing the MBA acrylamide ratio suppresses the effect of base composition on electrophoretic mobility of a fragment. Second, we investigated the use of a Tris-citrate buffer system in place of the standard Tris-borate system. We found the Tris-citrate system to be significantly more effective in preventing discontinuities in the banding pattern of the smaller fragments. Finally, we show that high MBA gels are also effective in resolving mixtures of oligoribonucleotides such as those produced by T1 ribonuclease digestion of small RNAs.

Base Sequence↗

PubMed1988

Comparative hybrid arrest by tandem antisense oligodeoxyribonucleotides or oligodeoxyribonucleoside methylphosphonates in a cell-free system.

Antisense oligonucleotides containing either anionic diester or neutral methylphosphonate internucleoside linkages were prepared by automated synthesis, and were compared for their ability to arrest translation of human dihydrofolate reductase (DHFR) mRNA in a nuclease treated rabbit reticulocyte lysate. In the case of oligodeoxyribonucleotides, tandem targeting of three 14-mers resulted in synergistic and complete selective inhibition of DHFR synthesis at a total oligomer concentration of 25 microM. Hybrid arrest by three or six tandem oligodeoxyribonucleoside methylphosphonates was dramatically less effective. This difference does not result from preferential recognition of hybrids involving oligodeoxyribonucleotides by endogenous RNaseH activity. A ribonuclease protection assay demonstrated that antisense oligodeoxyribonucleoside methylphosphonates bind selectively to target RNA sequences, but with 275 fold lower affinity than the corresponding oligodeoxyribonucleotides. This low binding affinity results in poor arrest of translation, and may be related to the stereochemistry of the methylphosphonate linkage.

Animals↗