SEARCH · PubMed Health

Results for “Regulon”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 37 records · Page 2Linked to original sources

PubMed1985

Genetic interactions of broad host-range plasmid RK2: evidence for a complex replication regulon.

The kil and kor genes of RK2 are novel genetic determinants further that the kil and kor network constitutes a replication regulon, and that perhaps the function of this regulon is to ensure expression of trfA at appropriate levels. The complexity of this regulon may reflect an ability of the system to adapt to the intracellular environments of a variety of hosts. Indeed, there is tantalizing evidence that regions encoding kil or kor genes are important to host range (1,2,6,28; Schmidhauser and Helinski, pers. comm.). We are therefore hopeful that the study of these genes and the eventual determination of the molecular basis of their actions will lead to a complete understanding of the replication control and broad host range capability of IncP plasmids.

Bacterial Proteins↗

PubMed1991

Cross-talk between the virulence and phosphate regulons of Agrobacterium tumefaciens caused by an unusual interaction of the transcriptional activator with a regulatory DNA element.

Transcription of a virulence gene on the hairy-root-inducing plasmid A4, which is induced by plant factors in Agrobacterium tumefaciens, was also activated by phosphate limitation in both A. tumefaciens and Escherichia coli. The starting site of RNA synthesized under the two inducing conditions was the same, and an identical promoter was responsible for both inducible expressions. The response of the virulence gene to phosphate limitation did not require the positive regulator VirG for the virulence regulon, but depended entirely on the presence of PhoB protein, the positive regulator for the phosphate regulon. The DNA signal upstream of the virulence gene, which is targeted by the VirG protein, was recognized by the E. coli PhoB protein in vitro. These results indicate that cross-talk between the two regulons occurred during the recognition of a DNA signal by the regulatory protein.

Bacterial Proteins↗

PubMed1988

Regulation of the phosphate regulon of Escherichia coli. Activation of pstS transcription by PhoB protein in vitro.

Expression of the genes in the phosphate regulon, including the pstS (phoS) and phoB genes, is positively regulated by PhoB protein when phosphate is limited. We purified PhoB protein from overproducing cells and studied its interaction with the pstS gene. It binds specifically to the DNA fragment containing the promoter region of pstS. The transcription initiation site of the gene in vivo was identified by S1 nuclease mapping and primer-extension experiments. In-vitro transcription of pstS was activated by the PhoB protein, and the initiation site of transcription agreed with the in-vivo initiation site. Activation of in-vitro transcription by PhoB protein required both the normal sigma factor (sigma 70) and core RNA polymerase. PhoB protein binding sites on the promoter regions of pstS and phoB were determined by footprinting experiments with DNase I and a methylating agent. In both cases the protein binds to the pho box, the concensus sequence shared by regulatory regions of genes in the phosphate regulon. Our findings indicate that PhoB protein recognizes and binds to the pho box and activates transcription of the genes in the phosphate regulon.

Bacterial Outer Membrane Proteins↗

PubMed1992

Isorepressor of the gal regulon in Escherichia coli.

Inducible overexpression of the Escherichia coli gal operon in the absence of the Gal repressor is known as ultrainduction. The requirement of induction can be eliminated by mutation of a new locus, galS, resulting in constitutive and ultrainduced levels of gal expression. Characterization of the galS gene and its product has revealed an isorepressor of the gal regulon. The Gal isorepressor is a protein of 346 amino acid residues whose amino acid sequence and cellular function, as described here, are very similar to that of Gal repressor, encoded by the galR gene. Transcription from different promoters of the gal regulon, galP1, galP2 and mglP, was examined by primer extension and reverse transcription of mRNA isolated from strains containing mutations in galR and/or galS. In strains containing a galS mutation, overexpression of gal message occurred only in the presence of inducer, while mgl message was constitutively derepressed. The galS mutation also constitutively derepressed an mglA::lacZ fusion, demonstrating that GalS is the mgl repressor. A potential operator site in the mgl promoter was identified at a position analogous to OE in gal. Thus, the gal and mgl operons constitute a regulon. Crosstalk, temporal action, induction spectrum or heteromer formation between repressor and isorepressor may help co-ordinate high affinity galactose transport and galactose utilization.

Amino Acid Sequence↗

PubMed1990

Positive control of a global antioxidant defense regulon activated by superoxide-generating agents in Escherichia coli.

Escherichia coli responds to superoxide-generating agents by inducing approximately 40 proteins. We have identified a genetic locus, soxR (superoxide response), that positively regulates 9 of these proteins during superoxide stress. Induction under soxR control is at the transcriptional level, as shown with lac fusions to five paraquat-inducible promoters. Members of the soxR regulon include at least three proteins with demonstrable antioxidant roles: Mn-containing superoxide dismutase (which destroys superoxide radicals), endonuclease IV (which repairs radical-induced damages in DNA), and glucose-6-phosphate dehydrogenase (which produces NADPH). Induction of the soxR regulon also leads to diminished levels of the major outer membrane protein OmpF and alteration of the small-subunit ribosomal protein S6. These latter changes confer resistance to a variety of antibiotics. The soxR regulon may thus operate as an inducible defense against xenobiotics in general.

Anti-Bacterial Agents↗

PubMed1988

Regulation of components of the Pseudomonas aeruginosa phosphate-starvation-inducible regulon in Escherichia coli.

Plasmids pPBP and pRS-XP containing the cloned genes for the Pseudomonas aeruginosa phosphate-starvation-inducible periplasmic phosphate-binding protein and outer membrane porin P (oprP), respectively, were introduced into various Escherichia coli Pho-regulon regulatory mutants. Using Western immunoblots and specific antisera, the production of both gene products was observed to be under the control of regulatory elements of the E. coli Pho regulon. Sequencing of the region upstream of the translational start site of the oprP gene revealed a 'Pho box' with strong homology to the E. coli consensus 'Pho box', the putative binding site of the PhoB activator. Since P. aeruginosa and E. coli belong to different families and have quite different GC contents, these data suggest strong evolutionary conservation of regulatory elements of the Pho regulon.

Bacterial Outer Membrane Proteins↗

PubMed1991

Mechanism of regulation of the formate-hydrogenlyase pathway by oxygen, nitrate, and pH: definition of the formate regulon.

The products of a minimum of 15 genes are required for the synthesis of an active formate-hydrogenlyase (FHL) system in Escherichia coli. All are co-ordinately regulated in response to variations in the oxygen and nitrate concentration and the pH of the culture medium. Formate is obligately required for transcriptional activation of these genes. Analysis of the transcription of one of these genes, hycB linked to the lacZ reporter gene, revealed that oxygen and nitrate repression of transcription could be relieved completely, or partially in the case of nitrate, either by the addition of formate to the medium or by increasing the copy number of the gene encoding the transcriptional activator (fhlA) of this regulon. These studies uncovered a further level of regulation in which the transcription of hycB was reduced in cells grown on glucose. This effect was most clearly seen in aerobically grown cells when formate was added externally. Addition of cAMP overcame this glucose repression, which could be shown to be mediated by the cAMP receptor protein. These results would be consistent with the transport of formate being regulated by catabolite repression. Moreover, the repression of transcription through high pH also could be partially overcome by addition of increasing concentrations of formate to the medium, again being consistent with regulation at the level of formate import and export. Taken together, all these observations indicate that it is the intracellular level of formate that determines the transcription of the genes of the formate regulon by FhlA. This represents a novel positive feedback mechanism in which the activator of a regulon induces its own synthesis in response to increases in the concentration of the catabolic substrate, and this in turn is governed by the relative affinities of FhlA and the three formate dehydrogenase isoenzymes for formate.

Anaerobiosis↗

PubMed1986

Osmoregulation of the maltose regulon in Escherichia coli.

The maltose regulon consists of four operons that direct the synthesis of proteins required for the transport and metabolism of maltose and maltodextrins. Expression of the mal genes is induced by maltose and maltodextrins and is dependent on a specific positive regulator, the MalT protein, as well as on the cyclic AMP-catabolite gene activator protein complex. In the absence of an exogenous inducer, expression of the mal regulon was greatly reduced when the osmolarity of the growth medium was high; maltose-induced expression was not affected, and malTc-dependent expression was only weakly affected. Mutants lacking MalK, a cytoplasmic membrane protein required for maltose transport, expressed the remaining mal genes at a high level, presumably because an internal inducer of the mal system accumulated; this expression was also strongly repressed at high osmolarity. The repression of mal regulon expression at high osmolarity was not caused by reduced expression of the malT, envZ, or crp gene or by changes in cellular cyclic AMP levels. In strains carrying mutations in genes encoding amylomaltase (malQ), maltodextrin phosphorylase (malP), amylase (malS), or glycogen (glg), malK mutations still led to elevated expression at low osmolarity. The repression at high osmolarity no longer occurred in malQ mutants, however, provided that glycogen was present.

Amylases↗

PubMed1990

Genes of the Escherichia coli pur regulon are negatively controlled by a repressor-operator interaction.

Fusions of lacZ were constructed to genes in each of the loci involved in de novo synthesis of IMP. The expression of each pur-lacZ fusion was determined in isogenic purR and purR+ strains. These measurements indicated 5- to 17-fold coregulation of genes purF, purHD, purC, purMN, purL, and purEK and thus confirm the existence of a pur regulon. Gene purB, which encodes an enzyme involved in synthesis of IMP and in the AMP branch of the pathway, was not regulated by purR. Each locus of the pur regulon contains a 16-base-pair conserved operator sequence that overlaps with the promoter. The purR product, purine repressor, was shown to bind specifically to each operator. Thus, binding of repressor to each operator of pur regulon genes negatively coregulates expression.

Base Sequence↗

PubMed1992

Architecture of the vir regulons of group A streptococci parallels opacity factor phenotype and M protein class.

Group A streptococci have traditionally been categorized into two broad groups based on the presence or absence of serum opacity factor (OF). Recent studies show that these two groups vary in a number of properties in addition to the OF phenotype, including sequence variations in the constant region of the antiphagocytic M protein genes, the presence or absence of immunoglobulin G Fc receptor proteins, and the presence or absence of multiple M protein-like genes situated in a tandem array. The M protein genes (emm) in OF- streptococcal strains are known to be part of a regulon of virulence-related genes controlled by the trans-acting positive regulatory gene, virR, situated just upstream of emm. In OF+ strains, however, the region adjacent to virR is occupied by an M protein-related, type IIa immunoglobulin G Fc receptor gene (fcrA), and the relative position of emm has not been determined. To further define the vir regulon in OF+ streptococci, we used the polymerase chain reaction to show that fcrA49 is situated immediately upstream of emm49 in the OF+ type 49 strain CS101. This result shows for the first time the separate identity and genetic linkage of these two genes in the vir regulon of an OF+ group A streptococcal strain and confirms our previous hypothesis that emm49 exists as the central gene in a trio of emm-like genes. Additionally, using DNA hybridizations, we found considerable sequence divergence between OF- and OF+ group A streptococci in virR and in the noncoding sequences between virR and the emm or fcrA expression site. We found, however, a high degree of sequence conservation in this region within each of the two groups of strains.

Amino Acid Sequence↗

PubMed1991

Purification and characterization of the Escherichia coli OxyR protein, the positive regulator for a hydrogen peroxide-inducible regulon.

The Escherichia coli oxyR gene is required for the induction of a regulon that is inducible by hydrogen peroxide and confers resistance to oxidative stresses. We constructed a plasmid system that greatly overproduced OxyR protein and purified the protein. OxyR protein specifically bound to the upstream regulatory regions of the oxyR and katG genes as demonstrated by the gel-retardation assay and the DNase I footprinting experiment, and activated the transcription initiation of the katG gene in vitro. Using a plasmid carrying an oxyR'-'lacZ fusion gene, we studied the regulation of oxyR expression in vivo. The expression of oxyR was not induced by the treatment with a low concentration of hydrogen peroxide which induces the genes in the oxyR regulon. The expression of the oxyR'-'lacZ gene was higher in an oxyR-deletion strain than in the oxyR+ strain, and was repressed by overexpressing the OxyR protein. These results suggest that OxyR protein functions as a repressor for oxyR, in addition to its known function as a transcriptional activator for the genes in the oxyR regulon.

Bacterial Proteins↗

PubMed1988

Induction of the manganese-containing superoxide dismutase in Escherichia coli is independent of the oxidative stress (oxyR-controlled) regulon.

The synthesis of manganese-superoxide dismutase in response to hydrogen peroxide and to paraquat was examined in strains of Escherichia coli with different mutations in the oxyR gene. Hydrogen peroxide treatment did not induce manganese-superoxide dismutase, but did induce the oxyR regulon. Paraquat induced this enzyme in a strain compromised in its ability to induce the defense response against oxidative stress (oxyR deletion) as well as in a strain that is constitutive and overexpresses the oxyR regulon. Catalase (HPI), but not manganese-superoxide dismutase, was over-expressed under anaerobic conditions in a strain harboring a constitutive oxyR mutation. The data clearly demonstrate that the induction of manganese-superoxide dismutase is independent of the oxyR-controlled regulon.

Anaerobiosis↗

PubMed2026

The SigD regulon of Mycobacterium abscessus determines cell envelope composition and antibiotic susceptibility.

A major determinant of the exceptional intrinsic resistance of M. abscessus is the lipid-rich cell envelope, yet the regulatory systems that remodel envelope-associated pathways remain poorly defined. Here, we determine the σD regulon in M. abscessus and establish its role in cell envelope homeostasis and intrinsic resistance to hydrophobic antibiotics. RNA-Seq analysis of a MabΔsigD mutant identified 447 differentially expressed genes, while ChIP-Seq mapped 72 σD binding sites and defined a conserved promoter motif (GTAACA/G-N16-CGAT). Using a combination of σD binding, motif orientation and expression data, we identified a core set of directly regulated genes, distinct from what was previously observed in M. tuberculosis, many of which encode proteins involved in envelope-associated functions. These include loci involved in trehalose polyphleate (TPP) biosynthesis, the antigen 85 complex and peptidoglycan remodeling enzymes. Deletion of sigD resulted in a significant reduction in TPPs in the cell envelope and an increase in ethidium bromide accumulation. Consistent with these changes, loss of σD selectively sensitized M. abscessus to hydrophobic antibiotics, including rifampicin and tigecycline. Deletion of mmpL10, which is required for transport of TPP precursors, recapitulated the drug sensitivity of MabΔsigD, implicating envelope composition as a key effector of the phenotype. Expression of the σD regulon further increased during starvation and in response to SDS, isoniazid, and ethambutol, mediated by degradation of RsdA, consistent with a role in stress-responsive envelope adaptation. Together, these findings demonstrate σD is active during logarithmic growth in rich media where it regulates the expression of envelope-associated genes that influence envelope permeability and basal level susceptibility to hydrophobic antibiotics; its activity further increases in response to cell envelope stress, presumably promoting envelope remodeling to counteract damage.

Regulon↗

PubMed1990

From cell membrane to nucleotides: the phosphate regulon in Escherichia coli.

Most of the essential cellular components, like nucleic acids, lipids and sugars, are phosphorylated. The phosphate equilibrium in Escherichia coli is regulated by the phosphate (Pi) input from the surrounding medium. Some 90 proteins are synthesized at an increased rate during Pi starvation and the global control of the cellular metabolism requires cross-talk with other regulatory mechanisms. Since the Pi concentration is normally low in E. coli's natural habitat, these cells have devised a mechanism for synthesis of about 15 proteins to accomplish two specific functions: transport of Pi and its intracellular regulation. The synthesis of these proteins is controlled by two genes (the phoB-phoR operon), involving both negative and positive functions. PhoR protein is a histidine protein kinase, induced in Pi starvation and is a transmembrane protein. It phosphorylates the regulator protein PhoB which is also Pi starvation-induced. The PhoB phosphorylated form binds specifically to a DNA sequence of 18 nucleotides (the pho Box), which is part of the promoters of the Pho genes. The genes controlled by phoB constitute the Pho regulon. The repression of phoA (the gene encoding alkaline phosphatase) by high Pi concentrations in the medium requires the presence of an intact Pst operon (pstS, pstC, pstA, pstB and phoU) and phoR. The products of pstA and pstC are membrane bound, whereas the product of pstS is periplasmic and PstB and PhoU proteins are cytoplasmic. The function of the PhoU protein may be regulated by cofactor nucleotides and may be involved in signaling the activation of the regulon via PhoR.

Cell Membrane↗

PubMedDate not supplied

Control of the lux regulon of Vibrio fischeri.

Regulation of expression of bioluminescence from the Vibrio fischeri lux regulon in Escherichia coli is a consequence of a unique form of positive feedback superimposed on a poorly defined cis-acting repression mechanism. The lux regulon consists of two divergently transcribed operons. The leftward operon contains only a single gene, luxR, which encodes a transcriptional activator protein. The rightward operon contains luxI, which together with luxR and the 218 base pairs separating the two operons comprises the primary regulatory circuit, and the five structural genes, luxC, luxD, luxA, luxB and luxE, which are required for the bioluminescence activity. Transcription of luxR from PL is stimulated by binding of the E. coli crp gene product to the sequence TGTGACAAAAATCCAA upstream of the presumed promoter. Binding of pure E. coli CAP protein in a cAMP-dependent reaction to the V. fischeri lux regulatory region has been demonstrated by in vitro footprinting. The luxI gene product is an enzyme which catalyses a condensation reaction of cytoplasmic substrates to yield the autoinducer, N-(3-oxo-hexanoyl) homoserine lactone. Accumulation of autoinducer, which is freely diffusible, results in formation of a complex with LuxR. The complex binds to the sequence ACCTGTAGGATCGTACAGGT upstream of PR to stimulate transcription of the rightward operon. Increased transcription from PR should yield increased levels of LuxI and higher levels of autoinducer which would further activate LuxR. The LuxR binding site is also a LexA binding site, as demonstrated by in vitro footprinting. Basal transcription from both PL and PR is repressed by sequences within the luxR coding region.(ABSTRACT TRUNCATED AT 250 WORDS)

Base Sequence↗

PubMed1991

Molecular cloning, structure, promoters and regulatory elements for transcription of the Bacillus licheniformis encoded regulon for xylose utilization.

In this article we describe the cloning of the xyl regulon encoding xylose utilization from Bacillus licheniformis by complementation of a xyl mutant of B. subtilis. The xylose isomerase encoding gene, xylA, was sequenced and identified by its extensive homology to other xylose isomerases. The expression of xylA is regulated on the level of transcription by a repressor protein encoded by xylR. Its gene has the opposite orientation of xylA and the start codons are 181 bp apart. A deletion of xylR renders xylA expression constitutive. The xylR sequence was determined and is discussed with respect to its homology to other xylR structures. Primer extension analyses of the xylA and xylR transcripts under repressing and including conditions define their promoters and confirm the regulation of xylA transcription. Furthermore, some induction of the xylR transcript by xylose is also observed. The regulatory sequence of both genes consists of a bipolar promoter system and contains three palindromic sequence elements. Their potential functions with respect to xylA and xylR regulation are discussed. The primary structures of the genes, promoters and regulatory sequences are compared to the xyl regulons encoded by B. subtilis, B. megaterium, Staphylococcus xylosus and E. coli. Homology is greatest between the B. subtilis and B. megaterium encoded xyl genes while the B. licheniformis borne genes are clearly more distant. The next greater differences are found to the S. xylosus and the greatest to the E. coli encoded genes. These results are discussed with respect to the taxonomic relations of these bacteria.

Aldose-Ketose Isomerases↗

PubMed1989

Regulation of the phosphate regulon of Escherichia coli: characterization of the promoter of the pstS gene.

The pstS gene belongs to the phosphate regulon whose expression is induced by phosphate starvation and regulated positively by the PhoB protein. The phosphate (pho) box is a consensus sequence shared by the regulatory regions of the genes in the pho regulon. We constructed two series of deletion mutations in a plasmid in vitro, with upstream and downstream deletions in the promoter region of pstS, which contains two pho boxes in tandem, and studied their promoter activity by connecting them with a promoterless gene for chloramphenicol acetyltransferase. Deletions extending into the upstream pho box but retaining the downstream pho box greatly reduced promoter activity, but the remaining activity was still regulated by phosphate levels in the medium and by the PhoB protein, indicating that each pho box is functional. No activity was observed in deletion mutants which lacked the remaining pho box or the -10 region. Therefore, the pstS promoter was defined to include the two pho boxes and the -10 region. The PhoB protein binding region in the pstS regulatory region was studied with the deletion plasmids by a gel-mobility retardation assay. The results suggest the protein binds to each pho box on the pstS promoter. A phoB deletion mutant was constructed, and we demonstrated that expression of pstS was strictly dependent on the function of the PhoB protein.

Base Sequence↗

PubMed1985

Regulation of the phosphate regulon of Escherichia coli K-12: regulation and role of the regulatory gene phoR.

The phoR gene product functions as a negative regulator with excess of phosphate and as a positive regulator with limited phosphate for the phosphate-starvation-inducible pho regulon of Escherichia coli. We constructed recombinant plasmids that contain a phoR'-'lacZ fusion gene to study the regulation of phoR expression. The genetic and physiological regulation of phoR expression was found to be very similar to that of phoB, a positive regulatory gene for the pho regulon, and phoA, the structural gene for alkaline phosphatase, both of which are inducible by phosphate limitation. The synthesis of the PhoR protein became non-inducible when the phoB promoter upstream of phoR, was removed from the hybrid plasmid, or when a transcriptional terminator was inserted in the phoB structural gene, irrespective of phosphate concentration in the medium. The results suggest that phoB and phoR constitute a single operon whose promoter is located proximal to phoB. The same low level of the PhoR protein in the cell can function as a positive regulator with limited phosphate and as a negative regulator with excess phosphate for the phoB-phoR operon. These results suggest that the maximal level of the operon is induced as consequences of both the increase in the quantity of the PhoR protein and of functional change of the protein as a positive regulator, which are induced by phosphate limitation.

DNA Transposable Elements↗