SEARCH · PubMed Health

Results for “conservation units”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 37 records · Page 2Linked to original sources

PubMed1999

Genetic divergence and the mating system in the endangered and geographically restricted species, lambertia orbifolia gardner (Proteaceae)

Population genetic structure and the mating system were investigated in the endangered plant Lambertia orbifolia. This species is geographically restricted with two disjunct groups of populations. Twelve out of 19 allozyme loci were polymorphic and four were suitable for mating system studies. Levels of genetic variation within populations were comparable to other long-lived woody shrub endemics. Genetic divergence between population groups was very high (D = 0.252) and the FST over all populations was 0.441. Gene flow estimates within population groups were low even though the maximum geographical distance between any pair of populations is 15 km and could be attributed to the localized movement of bird pollinators. Mating system studies on four populations showed consistently low levels of outcrossing, compared with other Proteaceae. Correlations of outcrossed paternity were moderately high and all were significantly greater than zero. Values ranged from rp = 0.33, in the two largest and very dense populations, to the highest value of rp = 0.54 in a smaller low-density population. The current population genetic structure in L. orbifolia is probably the result of local extinction of intervening populations because of Pleistocene climatic change and increased aridity, and extended isolation of the two remnants. It is proposed that the phylogenetically distinct Narrikup population group be recognized as a separate conservation unit and be given high priority for conservation action.

Journal Article↗

PubMed2003

Geographic variation of the Japanese spinous loach, Cobitis takatsuensis, inferred from allozyme analysis.

Genetic variation among river populations of the Japanese spinous loach, Cobitis takatsuensis, on Shikoku Island, was demonstrated by allozyme electrophoresis based on 40 presumed loci representing 20 enzymes and one non-enzymatic protein. Complete allelic replacement was not evident between populations in any one river system, but existed between populations in different river systems. The maximum genetic distance among populations reached 0.13 and the populations were divided genetically into four or five groups by river system on UPGMA and Neighbor-joining trees. In view of the genetic diversity of C. takatsuensis on Shikoku Island, the populations in three small river systems are thought to have originated from populations in one or the other of two large river systems with a bottle-neck effect. C. takatsuensis is currently designated as an endangered species in Japan. This study suggested that the populations of C. takatsuensis in each river system should be regarded as independent conservation units.

Alleles↗

PubMed2000

Glycosylation of homologous immunodominant proteins of Ehrlichia chaffeensis and Ehrlichia canis.

The glycoprotein genes of Ehrlichia chaffeensis (1,644 bp) and Ehrlichia canis (2,064 bp) encode proteins of 548 to 688 amino acids with predicted molecular masses of only 61 and 73 kDa but with electrophoretic mobilities of 120 kDa (P120) and 140 kDa (P140), respectively. The 120-kDa protein gene of E. chaffeensis contains four identical 240-bp tandem repeat units, and the 140-kDa protein gene of E. canis has 14 nearly identical, tandemly arranged 108-bp repeat units. Conserved serine-rich motifs identified in the repeat units of P120 and P140 were also found in the repeat units of the human granulocytotropic ehrlichiosis agent 130-kDa protein and of the fimbria-associated adhesin protein Fap1 of Streptococcus parasanguis. Nearly the entire (99%) E. chaffeensis P120 gene (1,616 bp), the 14-repeat region (78%) of the E. canis P140 gene (1,620 bp), and a 2-repeat region from the E. chaffeensis P120 gene (520 bp) were expressed in Escherichia coli. The recombinant proteins exhibited molecular masses ranging from 1.6 to 2 times larger than those predicted by the amino acid sequences. Antibodies against the recombinant proteins reacted with E. chaffeensis P120 and E. canis P140, respectively. Carbohydrate was detected on the E. chaffeensis and E. canis recombinant proteins, including the two-repeat polypeptide region of E. chaffeensis P120. A carbohydrate compositional analysis identified glucose, galactose, and xylose on the recombinant proteins. The presence of only one site for N-linked (Asn-Xaa-Ser/Thr) glycosylation, a lack of effect of N-glycosidase F, the presence of 70 and 126 Ser/Thr glycosylation sites in the repeat regions of P120 and P140, respectively, and a high molar ratio of carbohydrate to protein suggest that the glycans may be O linked.

Amino Acid Sequence↗

PubMed1994

Restriction enzyme-resistant high molecular weight telomeric DNA fragments in tobacco.

Restriction endonuclease-resistant high-molecular-weight (HMW) DNA fragments were isolated from nuclear DNA fragments in tobacco. The size of the fragments produced by EcoRI, HindIII, AfaI, and HaeIII ranged from 20 kb to over 166 kb. The kinetics of digestion by Bal31 nuclease showed that most of the HMW fragments are chromosome ends. The consensus sequence for tobacco telomere repeats was determined to be CCCTAAA by genomic sequencing using the HMW fragments and by sequencing after cloning. Besides the telomere sequence, 9 tandem repeats of a 45-bp sequence were identified, in which a 35-bp unit sequence (AGTCAGCATTAGGGTTTTAAACCCTAAACTGAACT) formed a stem structure. The front of the stem is composed of a palindrome of the telomere repeats. This highly conserved unit is surrounded by less conserved internal sequences that are around 10-11 bp in size and contain a TTTT stretch. The internal sequences resemble the 10-11 bp consensus for the scaffold attachment regions found in yeast and drosophila. The characteristic 45-bp sequence was abundant on the ends of chromosomes. The shortest distance between the repeats containing telomeric stem and the telomere was less than 20 kb. This architecture of the tobacco chromosome end region resembles the end region of yeast chromosomes in which autonomous replication sequences are present frequently.

Base Sequence↗

PubMed2005

The panmixia paradigm of eastern Pacific olive ridley turtles revised: consequences for their conservation and evolutionary biology.

Previous studies of the olive ridley Lepidochelys olivacea population structure in the tropical eastern Pacific have indicated the existence of a single panmictic population ranging from Costa Rica to Mexico. This information has been used to design specific management measures to conserve primary nesting beaches in Mexico. However, little is known about olive ridleys in the Baja California Peninsula, their northernmost reproductive limit, where recent observations have shown differences in nesting female behaviour and size of hatchlings relative to other continental rookeries. We used mtDNA control region sequences from 137 turtles from five continental and four peninsular nesting sites to determine whether such differences correspond to a genetic distinction of Baja California olive ridleys or to phenotypic plasticity associated with the extreme environmental nesting conditions of this region. We found that genetic diversity in peninsular turtles was significantly lower than in continental nesting colonies. Analysis of molecular variance revealed a significant population structure (Phi ST = 0.048, P = 0.006) with the inclusion of peninsular samples. Our results: (i) suggest that the observed phenotypic variation may be associated with genetic differentiation and reproductive isolation; (ii) support the recent colonization of the eastern Pacific by Lepidochelys; (iii) reveal genetic signatures of historical expansion and colonization events; and (iv) significantly challenge the notion of a single genetic and conservation unit of olive ridleys in the eastern Pacific. We conclude that conservation measures for olive ridleys in Mexico should be revised to grant peninsular beaches special attention.

Animals↗

PubMed2003

Land-cover assessment of conservation and buffer zones in the BOSAWAS natural resource reserve of Nicaragua.

The BOSAWAS Natural Resource Reserve of Nicaragua was established in 1991, to protect a portion of the remaining tropical rain forest and to promote the sustainable use of the region's resources. Information required to effectively manage the reserve includes the extents and locations of present land-cover types and recent land-cover changes in the management use zones that were delineated by local indigenous communities. These zones include areas designated for conservation, limited resource extraction, agriculture, and watershed protection. Land-cover for 1986 and 1995 was identified for three of the communities from remotely sensed images and then input into a geographic information system database to identify land-cover types within these management use zones. For both dates of the analysis, advanced forest was the dominant land cover, with the conservation zones entirely forested. The amount of both agricultural land and scrub/early secondary forest increased between the two dates, with much of these land-cover classes occurring in the agriculture zones. Conflicts between the land-cover present and designated use were identified in some of the limited-use buffer and watershed protection zones. Changes between 1986 and 1995 were identified by overlaying the two land-cover data sets. Three change processes were identified as occurring: deforestation, reforestation, and reconversion. Changes were concentrated in the agriculture zones but were found to occur in every type of zone, except for conservation. The results of this study will establish baseline information for the future management of the BOSAWAS Reserve, an important component in uniting conservation areas along the Central American isthmus.

Agriculture↗

PubMed2001

Phylogeography, population history and conservation genetics of jaguars (Panthera onca, Mammalia, Felidae).

The jaguar (Panthera onca), the largest felid in the American Continent, is currently threatened by habitat loss, fragmentation and human persecution. We have investigated the genetic diversity, population structure and demographic history of jaguars across their geographical range by analysing 715 base pairs of the mitochondrial DNA (mtDNA) control region and 29 microsatellite loci in approximately 40 individuals sampled from Mexico to southern Brazil. Jaguars display low to moderate levels of mtDNA diversity and medium to high levels of microsatellite size variation, and show evidence of a recent demographic expansion. We estimate that extant jaguar mtDNA lineages arose 280 000-510 000 years ago (95% CI 137 000-830 000 years ago), a younger date than suggested by available fossil data. No strong geographical structure was observed, in contrast to previously proposed subspecific partitions. However, major geographical barriers such as the Amazon river and the Darien straits between northern South America and Central America appear to have restricted historical gene flow in this species, producing measurable genetic differentiation. Jaguars could be divided into four incompletely isolated phylogeographic groups, and further sampling may reveal a finer pattern of subdivision or isolation by distance on a regional level. Operational conservation units for this species can be defined on a biome or ecosystem scale, but should take into account the historical barriers to dispersal identified here. Conservation strategies for jaguars should aim to maintain high levels of gene flow over broad geographical areas, possibly through active management of disconnected populations on a regional scale.

Animals↗

PubMed2003

Phylogeography of the rock partridge (Alectoris graeca).

We used mitochondrial DNA control-region and microsatellite data to infer the evolutionary history and past demographic changes in 332 rock partridges (Alectoris graeca) sampled from throughout the species' distribution range, with the exception of the central Balkans region. Maternal and biparental DNA markers indicated concordantly that rock partridge populations are structured geographically (mtDNA phiST = 0.86, microsatellite FST = 0.35; RST = 0.31; P < 0.001). Phylogenetic analyses of 22 mtDNA haplotypes identified two major phylogroups (supported by bootstrap values = 93%), splitting partridges from Sicily vs. all the other sampled populations at an average Tamura-Nei genetic distance of 0.035, which corresponds to 65% of the average distance between closely related species of Alectoris. Coalescent estimates of divergence times suggested that rock partridges in Sicily were isolated for more than 200000 years. This deep subdivision was confirmed by multivariate, Bayesian clustering and population assignment analyses of microsatellite genotypes, which supported also a subdivision of partridges from the Alps vs. populations in the Apennines, Albania and Greece. Partridges in the Apennines and Albania-Greece were probably connected by gene flow since recently through a late Pleistocene Adriatic landbridge. Deglaciated Alps were probably colonized by distinct and, perhaps, not yet sampled source populations. Bottleneck and mismatch analyses indicate that rock partridges have lost variability through past population declines, and did not expand recently. Deglaciated areas could have been recolonized without any strong demographic expansion. Genetic data partially supported subspecies subdivisions, and allowed delimiting distinct conservation units. Rock partridges in Sicily, formally recognized as A. g. whitakeri, met the criteria for a distinct evolutionary significant unit.

Animals↗

PubMed2003

Genetic structure in a montane ranid frog: restricted gene flow and nuclear-mitochondrial discordance.

There is substantial debate over the criteria that should be used to group populations of a species into distinct units for conservation (e.g. evolutionarily significant units, management units, distinct population segments). However, in practice molecular genetic differentiation is often the only or main criterion used to identify such units. Most genetic studies attempting to define conservation units in animals use a single molecular marker, most often mitochondrial, and use samples from a limited number of populations throughout the species' range. Although there are many benefits to using mtDNA, certain features can cause it to show patterns of differentiation among populations that do not reflect the history of differentiation at the nuclear genome where loci controlling traits of adaptive significance presumably occur. Here we illustrate an example of such mitochondrial-nuclear discordance in a ranid frog, and show how using mtDNA or nuclear loci alone could have led to very different conservation recommendations. We also found very high genetic differentiation among populations on a local scale, and discuss the conservation implications of our results.

Alleles↗

PubMed2002

Small non-flying mammals from conserved and altered areas of Atlantic forest and Cerrado: comments on their potential use for monitoring environment.

Two Atlantic Forests and two Cerrado areas in Brazil were sampled for non-flying small mammal fauna. In each biome one area with altered and another with almost unaltered vegetation (national parks), were chosen to investigate these fauna. Species richness of Atlantic Forest and Cerrado was comparable in the conserved as well as in the altered areas. Data suggested that species could be divided into different ecological categories according to distribution, use of altered and/or relatively unaltered vegetation and habitat specificity. Within these ecological categories some species are appropriate indicators for monitoring environmental quality and degradation. Useful guidelines for wildlife management planning, including selecting areas for conservation units and their better boundary delimitation can ensue.

Animals↗

PubMed2006

What is a gene? From molecules to metaphysics.

Mendelian genes have become molecular genes, with increasing puzzlement about locating them, due to increasing complexity in genomic webworks. Genome science finds modular and conserved units of inheritance, identified as homologous genes. Such genes are cybernetic, transmitting information over generations; this too requires multi-leveled analysis, from DNA transcription to development and reproduction of the whole organism. Genes are conserved; genes are also dynamic and creative in evolutionary speciation-most remarkably producing humans capable of wondering about what genes are.

Adaptation, Biological↗

PubMedDate not supplied

Pathways of the evolution of hormonal signal realization systems.

The problem of the structural-functional organization, and of the origin and evolution of the chemosignal systems which realize the effect of hormones and hormone-like substances in the higher eukaryotes-lower eukaryotes-prokaryotes series, is reviewed on the basis of an analysis of published information and our own data. The notion that the systems of the conduction and transduction of chemical signals are related to universal and evolutionarily ancient structures is formulated. The roots of these systems take their origin in the single-celled eukaryotes, while individual of their functional units take their origin even in the prokaryotes. The hypothesis is advanced that the progressive evolution of chemosignal systems has traveled common pathways, and has consisted in the linking up and the functional combination of originally general and conservative units in the direction of the ever-increasing specialization of these systems and augmentation of their efficiency.

Animals↗

PubMed2005

Genetic diversity and differentiation of central European freshwater pearl mussel (Margaritifera margaritifera L.) populations: implications for conservation and management.

Despite the fact that mollusc species play an important role in many aquatic ecosystems, little is known about their biodiversity and conservation genetics. Freshwater pearl mussel (Margaritifera margaritifera L.) populations are seriously declining all over Europe and a variety of conservation programs are being established to support the remaining endangered central European populations. In order to provide guidelines for conservation strategies and management programs, we investigated the genetic structure of 24 freshwater pearl mussel populations originating from five major central European drainages including Elbe, Danube, Rhine, Maas and Weser, representing the last and most important populations in this area. We present a nondestructive sampling method of haemolymph for DNA analyses, which is applicable for endangered bivalves. The analyses of nine microsatellite loci with different levels of polymorphism revealed a high degree of fragmented population structure and very different levels of genetic diversity within populations. These patterns can be explained by historical and demographic effects and have been enforced by anthropogenic activities. Even within drainages, distinct conservation units were detected, as revealed from high F(ST) values, private alleles and genetic distance measures. Populations sampled close to contact zones between main drainage systems showed lowest levels of correct assignment to present-day drainage systems. Populations with high priority for conservation should not only be selected by means of census population size and geographical distance to other populations. Instead, detailed genetic analyses are mandatory for revealing differentiation and diversity parameters, which should be combined with ecological criteria for sustainable conservation and recovery programs.

Animals↗

PubMed1982

Conservation of protein coding potential in the long terminal repeats of exogenous and endogenous mouse mammary tumor viruses.

In vitro protein synthesis and DNA sequence analysis indicate that mouse mammary tumor virus differs from other well-characterized retroviruses in that the long terminal repeat region of the provirus has the capacity to encode proteins. Different exogenously transmitted mouse mammary tumor virus strains and endogenous proviral units conserved this open reading frame feature in the long terminal repeat despite a variation in nucleotide sequence. The proteins encoded by the different long terminal repeats were clearly related, but showed minor variations in size and tryptic peptide maps. In each case, the largest in vitro product had a molecular weight of about 36,000 to 37,000, suggesting that the open reading frame sequences must extend for approximately 1,000 nucleotides beginning at the extreme 5' end of the long terminal repeat. The fact that the reading frame was conserved among these viruses argues in favor of an in vivo function for the open reading frame protein.

DNA, Recombinant↗

PubMed2001

Postglacial colonization of Northern Europe by distinct phylogeographic lineages of the bullhead, Cottus gobio.

Three major phylogeographic lineages of the cottid fish Cottus gobio (bullhead) were identified in northern Europe from mitochondrial DNA sequences and allozyme data. The largely separate freshwater distributions of the lineages demonstrate distinct postglacial colonization histories. West of the Baltic Sea, Swedish lakes were invaded from the southwest (Germany). Another, eastern lineage has colonized the inland waters northeast and east of the Baltic, from refugia in northwest Russia; this lineage comprises a distinct subgroup found only from Estonia. The third lineage, found south and southeast of the Baltic, probably descended from rivers draining to the Black Sea from the north (e.g. Dnepr). In coastal waters of the Baltic Sea, and in near-coast inland waters, the lineages are now found intermixed in various combinations. The alternating fresh- and saltwater phases of the Baltic basin have variously enabled and disabled the use of coastal waters as colonization routes. Hypotheses on the chronology of dispersal and lineage mixing can be based on the distribution of the marker genes and the paleohydrographical record. The diversity of the Fennoscandian bullhead thus comprises anciently diverged (probably mid-Pleistocene) refugial lineages that in their freshwater range constitute distinct evolutionarily significant units. The thorough mixing of the various genomic origins in and around the Baltic, however, refutes the controversial view of distinct species status for the western and eastern ('Cottus koshewnikowi') bullheads. The postglacial contact of the lineages has created new diversity that cannot be interpreted in a conventional hierarchical framework of taxonomic or conservation units.

Animals↗

PubMedDate not supplied

Mitochondrial DNA differentiation in the critically endangered Berg River redfin (Pseudobarbus burgi).

The Berg River redfin (Pseudobarbus burgi) is a critically endangered endemic cyprinid from South Africa. We investigated mitochondrial DNA control region variation among specimens representative of five populations drawn from two adjacent river systems. Phylogenetic analyses, a minimum spanning network, and an analysis of molecular variance underscore the pronounced genetic separation of redfins originating from the geographically closely allied Verlorevlei and Berg Rivers, two populations that may have remained isolated since the Pleistocene. Despite a lack of geographic structuring within the Berg River, historic female gene flow among the upper and middle/lower parts of the river appears to be limited and the contemporary populations are probably isolated due to deterioration of the mainstream of the river. Our results suggest that the Berg and Verlorevlei populations should be managed as distinct conservation units. We encourage the use of sanctuaries, particularly by private landowners within both river systems, as this approach may contribute effectively to preserving genetic diversity within the species.

Animals↗

PubMed1984

Analysis of DNA sequences which regulate the transcription of a herpes simplex virus immediate early gene.

The locations and functions of DNA sequences involved in transcription of the gene encoding herpes simplex virus type 1 immediate early (IE) mRNAs 4 and 5 were analyzed by use of a transient-expression assay. The region upstream of the genes encoding IE mRNAs 4 and 5 was fused to the thymidine kinase gene coding sequences, and production of enzyme or RNA was measured after transfection of plasmids into BHK cells. The effect of deletions in the upstream region was determined in the absence or presence of a virus structural component which stimulates herpes simplex virus IE transcription. Two distinct units were identified. One of these was a promoter which required not more than 69 base pairs of DNA specific for the genes encoding IE mRNAs 4 and 5 upstream from the mRNA 5' terminus. The other was a far-upstream region which mediated the response to the virion component and had an upstream boundary between nucleotides -347 and -335. An origin of DNA replication was interposed between these two units. The element TAATGAGATAC , which represents a consensus sequence present in the upstream regions of all herpes simplex type 1 IE genes, appeared to be essential for stimulation by the virion component. The activity of this element was modulated by the sequences which flank it, especially by regions having extremely high contents of guanine plus cytosine and which contain a conserved unit CCCGCCC or its complement GGGCGGG .

Animals↗

PubMed2007

Linked vs unlinked markers: multilocus microsatellite haplotype-sharing as a tool to estimate gene flow and introgression.

We have explored the use of multilocus microsatellite haplotypes to study introgression from cultivated (Malus domestica) into wild apple (Malus sylvestris), and to study gene flow among remnant populations of M. sylvestris. A haplotype consisted of alleles at microsatellite loci along one chromosome. As destruction of haplotypes through recombination occurs much faster than loss of alleles due to genetic drift, the lifespan of a multilocus haplotype is much shorter than that of the underlying alleles. When different populations share the same haplotype, this may indicate recent gene flow between populations. Similarly, haplotypes shared between two species would be a strong signal for introgression. As the expected lifespan of a haplotype depends on the strength of the linkage, the length [in centiMorgans (cM)] of the haplotype shared contains information on the number of generations passed. This application of shared haplotypes is distinct from using haplotype-sharing to detect association between markers and a certain trait. We inferred haplotypes for four to eight microsatellite loci on Linkage Group 10 of apple from genotype data using the program phase, and then identified those haplotypes shared between populations and species. Compared with a Bayesian analysis of unlinked microsatellite loci using the program structure, haplotype-sharing detected a partially different set of putative hybrids. Cultivated haplotypes present in M. sylvestris were short (< 1.5 cM), indicating that introgression had taken place many generations ago, except for two Belgian plants that contained a haplotype of 47.1 cM, indicating recent introgression. In the estimation of gene flow, F(ST) based on unlinked loci indicated small (0.032-0.058) but statistically significant differentiation between some populations only. However, various M. sylvestris haplotypes were shared in nearly all pairwise comparisons of populations, and their length indicated recent gene flow. Hence, all Dutch populations should be considered as one conservation unit. The added value of using sharing of multilocus microsatellite haplotypes as a source of population genetic information is discussed.

Belgium↗