PubMed HealthSearch

SEARCH · PubMed Health

Results for “simple sequence repeat”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 37 records · Page 2Linked to original sources

Human von Willebrand factor gene and pseudogene: structural analysis and differentiation by polymerase chain reaction.

Structural analysis of the von Willebrand factor gene located on chromosome 12 is complicated by the presence of a partial unprocessed pseudogene on chromosome 22q11-13. The structures of the von Willebrand factor pseudogene and corresponding segment of the gene were determined, and methods were developed for the rapid differentiation of von Willebrand factor gene and pseudogene sequences. The pseudogene is 21-29 kilobases in length and corresponds to 12 exons (exons 23-34) of the von Willebrand factor gene. Approximately 21 kilobases of the gene and pseudogene were sequenced, including the 5' boundary of the pseudogene. The 3' boundary of the pseudogene lies within an 8-kb region corresponding to intron 34 of the gene. The presence of splice site and nonsense mutations suggests that the pseudogene cannot yield functional transcripts. The pseudogene has diverged approximately 3.1% in nucleotide sequence from the gene. This suggests a recent evolutionary origin approximately 19-29 million years ago, near the time of divergence of humans and apes from monkeys. Several repetitive sequences were identified, including 4 Alu, one Line-1, and several short simple sequence repeats. Several of these simple repeats differ in length between the gene and pseudogene and provide useful markers for distinguishing these loci. Sequence differences between the gene and pseudogene were exploited to design oligonucleotide primers for use in the polymerase chain reaction to selectivity amplify sequences corresponding to exons 23-34 from either the von Willebrand factor gene or the pseudogene. This method is useful for the analysis of gene defects in patients with von Willebrand disease, without interference from homologous sequences in the pseudogene.

Amino Acid Sequence

Assembly and comparative analysis of the mitochondrial genome of Pleione yunnanensis: genome structure and evolutionary insights.

BACKGROUND: Pleione yunnanensis a terrestrial or semi-epiphytic herbaceous plant belonging to the Orchidaceae family, is valued for both its medicinal uses and ornamental appeal. Although its chloroplast genomes have been sequenced, its complete mt genome had not previously been resolved, limiting genetic and evolutionary studies of the species. RESULTS: In this work, we assembled and characterized the first complete mt genome of P. yunnanensis, revealing a structurally complex, multibranched system composed of 14 circular-mapping molecules totaling 468,176 bp with a GC content of 44.32%. The genome encodes 44 annotated genes, including 28 protein-coding genes (PCGs), 15 tRNAs, and one rRNA. The multibranched architecture provides new evidence supporting the dynamic and recombinational nature of plant mt genomes. Repeat analysis uncovered 29 simple sequence repeats (SSRs), 19 tandem repeats, and 118 dispersed repeats, indicating a comparatively lower repeat abundance than that found in closely related orchids with similar mt genome sizes. Codon-usage profiling of PCGs showed a marked bias toward A/T-ending codons. Prediction of RNA editing sites identified 4,708 putative edits across mitochondrial PCGs. Most mitochondrial genes displayed Ka/Ks ratios close to 1.0, suggesting relaxed selective constraints or lineage-specific evolutionary patterns rather than strong positive selection. Moreover, we detected 69 chloroplast-derived homologous fragments, including 15 intact genes, suggesting ongoing plastid-mitochondrial DNA transfer. Phylogenetic reconstruction and collinearity comparisons demonstrated that P. yunnanensis clustered closely with Dendrobium species, including D. amplum and D. hancockii, within the Orchidaceae clade. CONCLUSIONS: This study provides the first complete mt genome of P. yunnanensis, providing a foundational genomic resource for the genus Pleione. The results not only improve our understanding of mt genome structure and evolution in Orchidaceae, but also offer valuable molecular evidence for phylogenetic inference, germplasm identification, and conservation of this endangered medicinal species.

Orchidaceae

Comprehensive plastome variation and RNA editing in Mentha: insights into phylogenetic relationships and candidate DNA barcodes.

INTRODUCTION: Mentha is an economically and medicinally important genus in Lamiaceae, but its taxonomy and species delimitation remain challenging because of frequent hybridization, polyploidy, and marked morphological plasticity. METHODS: In this study, we comparatively analyzed 12 plastomes representing major Mentha species, hybrid taxa, and unresolved accessions, including four newly assembled genomes, to characterize plastome structure, repeat composition, sequence divergence, phylogenetic relationships, and plastid RNA editing. The M. arvensis plastome and RNA-seq datasets originated from independent Swiss and Indian accessions, respectively. RESULTS: The plastomes were highly conserved in overall organization, ranging from 151,824 to 152,154 bp and displaying the typical quadripartite structure. Gene content and order were largely stable across taxa, with only minor variation likely associated with annotation differences at IR/SC boundary regions. Codon usage analysis revealed a clear bias toward A/U-ending synonymous codons, and most shared protein-coding genes showed low Ka/Ks ratios, indicating predominant purifying selection. Repeat analyses showed that simple sequence repeats were mainly composed of A/T-rich mononucleotide motifs, whereas long repeats were concentrated in the 30-40 bp size class. Comparative analyses identified six hypervariable regions, namely ccsA-ndhD, ycf1, ndhD, rpl32-trnL-UAG, rbcL-accD, and petA-psbJ, which represent promising candidate plastid markers for species discrimination. Phylogenetic analysis based on complete plastomes provided strong support for relationships among the sampled taxa and recovered a close affinity among M. aquatica, M. arvensis, and M. canadensis. In addition, RNA-seq analysis of M. arvensis identified 17 candidate plastid RNA editing sites, most of which were C-to-U conversions and nonsynonymous events. DISCUSSION: Together, these results expand plastid genomic resources for Mentha and provide a useful framework for phylogenetic inference, species identification, and future germplasm utilization.

RNA editing

New tandem repeat region in the non-transcribed spacer of human ribosomal RNA gene.

A new repetitive DNA region was identified in the non-transcribed spacer of human rDNA, namely a long (4.6 kb) sequence motif (Xbal element) was present in two copies. The repeating unit composed of two parts. One of them consisted of unique nucleotide sequences, interrupted by some simple sequences. The other, about 3.1 kb long one assembled only from highly repeated simple sequences. The unique sequence region contained two, inverted copies of the human AluI type repetitive DNA family. The authors suggest that the XbaI elements may flank the tandem arrays of human rRNA genes as terminal repeats and they might function both as the origin of rDNA replication and/or site of homologous recombination.

Base Sequence

Organization of immunoglobulin heavy chain constant and joining region genes in the channel catfish.

A channel catfish genomic lambda library was screened with CH and JH probes which were derived from our earlier sequence analyses on different full-length heavy chain cDNA clones. One clone, designated C7, contained a genomic insert of about 18 kb and hybridized with specific probes for each of the four domains of the known C region gene as well as with different oligonucleotides specific for JH gene segments. Southern blot hybridization analysis identified a cluster of JH gene segments which are closely linked to the CH gene. Sequence analysis of the CH-proximal JH element, located about 1.9 kb upstream from the CH1 domain, showed that this element contains 5'-recombination signals typical of JH elements defined in higher vertebrates, i.e. a nonamer, a 24 bp spacer, and a heptamer. The coding region of this JH element was identical to that contained in the variable region sequence of a cDNA clone previously reported. Sequence analysis of the catfish JH-CH intron suggests that several sequences are present which appear similar to important transcriptional regulatory elements found within JH-CH introns of higher vertebrates. These features include sequences similar to higher vertebrate enhancer elements and regulatory octamers. An additional feature reminiscent of some higher vertebrate heavy chain switch regions is a repetitive sequence area composed of tandemly repeated simple sequences. Lastly, several restriction length polymorphisms were identified and mapped within a 1 kb region located immediately upstream from the JH cluster. This finding suggests that polymorphisms within the IgH locus should be useful in the analyses of channel catfish populations. These combined studies provide further evidence that the genomic organization of heavy chain genes in bony fish shares common organizational features with those known from higher vertebrates.

Amino Acid Sequence

A transcriptome-wide approach for rapid pathotype discrimination of Puccinia striiformis f. sp. tritici in north-western India.

Stripe rust of wheat caused by Puccinia striiformis f. sp. tritici (Pst) remains a major constraint to wheat production in India due to the rapid evolution and frequent emergence of virulent pathotypes. Rapid and reliable discrimination of Pst pathotypes is essential for effective resistance deployment and surveillance. In the present study, transcriptome-wide simple sequence repeats (SSRs) and single nucleotide polymorphisms (SNPs) were exploited to develop and validate molecular markers for pathotype-specific detection of Pst pathotypes prevalent in North India (110S119, 238S119, 46S119, 110S84 and 78S84). Microsatellite mining from 6103 core orthologous clusters comprising 51,127 transcripts mined 14,634 SSR loci, from which 93 primer pairs were synthesized. However, only three SSR markers exhibited polymorphism indicating limited discrimination potential of expressed sequence-derived (EST) SSRs for pathotype differentiation. In contrast, SNP discovery through stringent variant calling and filtration yielded 186 pathotype-specific homokaryotic SNPs, of which 56 high-confidence loci were selected for Kompetitive Allele-Specific PCR (KASP) assay development. A total of 48 KASP markers were synthesized and 14 demonstrated clear pathotype- or cluster-specific polymorphism representing substantially higher resolution than SSR markers. The high SNP-to-KASP conversion efficiency (~ 95%) and reproducible fluorescence-based clustering emphasize the robustness of KASP assay. Comparative evaluation revealed that SNP-based KASP markers provide superior discriminatory capacity for closely related Pst pathotypes and represent a promising complementary molecular approach for rapid identification of predominant Indian Pst pathotypes. The validated marker panel developed in this study can complement conventional virulence phenotyping and field pathogenomics approaches for surveillance of currently known pathotypes, while continued refinement may accommodate future changes in pathogen populations.

India

SSR marker development for analysis of the genetic diversity and identification of species and infraspecific ranks in the genus Phyllostachys.

Bamboo plants possess important ecological, economic, and cultural values. However, it is difficult to accurately identify them on the basis of their morphological traits alone. Here, based on the whole-genome data of moso bamboo (Phyllostachys edulis) and its 20 forms, we conducted preliminary identification and comparative analyses of simple sequence repeats (SSRs) to develop molecular markers. In total, 3,835,632 SSR loci were identified from 31,537.81 Mb of genomic sequences, among which dinucleotide SSRs were the most abundant. Most SSRs were located in intergenic regions, whereas relatively fewer were in genic regions. In addition, we found that SSR-containing genes involved in plant hormone signal transduction may be associated with the morphogenesis of moso bamboo, which was speculated to be related to differential gene expression patterns among different forms. Furthermore, 206 SSR primer pairs with polymorphisms were obtained to analyse the genetic diversity of moso bamboo and its forms, which exhibited moderate polymorphism. The proportion of genetic variation among species within the genus Phyllostachys was 58%, while that within species was 42%. Moso bamboo and its 20 forms had relatively close genetic relationships and low genetic differentiation, while 20 species of the genus Phyllostachys were clustered into three groups with distinct levels of genetic diversity. Finally, DNA fingerprints and molecular identity cards were constructed for 20 moso bamboo forms and 20 species of the genus Phyllostachys using core SSR markers. These results provide novel SSR markers for bamboo identification, germplasm conservation, and molecular marker-assisted breeding.

Microsatellite Repeats

Development and validation of whole-genome SSR markers in sugar beet (Beta vulgaris L.).

Sugar beet (Beta vulgaris L.) is an important sugar and cash crop worldwide. To systematically characterize SSR (Simple Sequence Repeat) loci across sugar beet chromosomes and enable the precise identification of germplasm resources, this study conducted a genome-wide scan for SSR loci, analyzed their distribution patterns, and determined their genotypes using resequencing data from 123 sugar beet varieties. The results revealed an abundance of SSR loci in the sugar beet genome, with a total of 135, 379 identified, from which 135, 344 pairs of SSR primers were designed (135, 344 primer pairs successfully designed; 35 loci failed to meet design criteria). Specifically, 31, 748 primer pairs were designed based on SSRs located in unassigned scaffolds, and 103, 596 primer pairs from SSRs assigned to the nine chromosomes. Through bioinformatic analysis, we identified 28, 768 SSR primers located in multi-copy genes with PIC (Polymorphism Information Content) ≥ 0.5, and 2, 326 SSR markers located in single-copy genes residing in various genic regions (among which 543 had PIC ≥ 0.5, with the highest reaching 0.776). PCR (Polymerase Chain Reaction) validation confirmed 20 robust and polymorphic markers producing clear and reproducible bands. Among them, 10 SSR primers located in multi-copy genes exhibited three or more polymorphic types, and 10 markers located in single-copy genes displayed 2-3 polymorphic types. The most polymorphic marker, YCD-4-2, detected 11 polymorphic types across 48 varieties. Furthermore, to explore markers with potential functional significance, we annotated the genes harboring SSR markers located in single-copy genes. The results showed that 1, 264 SSRs located in single-copy genes were localized to 967 genes, which are significantly enriched in pathways related to carbohydrate metabolism, stress responses, and plant-pathogen interactions. The 20 validated markers and the 2, 326 SSRs located in single-copy genes provided in this study can be directly applied to fingerprinting of sugar beet varieties, seed purity testing, and marker-assisted selection, thus representing a practical resource for molecular breeding.

genome-wide

Plastid genome evolution and phylogenomics with broad taxon sampling: insights into intrafamilial classification of Hamamelidaceae.

Hamamelidaceae, within the order Saxifragales, comprises 27 genera and approximately 120 species. The family has a pantropical and temperate distribution across the Americas, Asia, Africa, and Australia. Previous molecular investigations, constrained by limited taxon sampling and inadequate genetic markers, supported a five-subfamily classification system. However, these studies predominantly focused on Asian taxa, resulting in poor resolution of the evolutionary relationships among American, African, and Australian genera. To address these sampling gaps, we employed near-complete generic sampling (26 of 27 genera) to investigate plastome architecture, structural variation, and phylogenetic relationships. We newly sequenced and assembled 15 plastid genomes representing geographically and taxonomically underrepresented genera and analyzed them alongside 59 publicly available plastomes retrieved from GenBank. Plastid genomes exhibited conserved quadripartite architecture with sizes ranging from 158, 076 bp to 160, 814 bp, minimal structural variation, consistent GC content (37.7-38.2%), and identical gene order. Inverted repeat (IR) regions had limited size variation (26, 211-26, 429 bp). Simple sequence repeat (SSR) distribution (2, 219 loci) showed no clear correlation with the genus-level phylogenetic relationships. We identified ten hypervariable regions, including coding sequences (accD, ycf1, clpP, ndhF, and rpl22) and intergenic spacers (rpl33-rps18, the trnG-UCC intron, trnH-GUG-psbA, accD-psaI, and petA-psbJ), as promising candidate regions for future applications in species delimitation and phylogenetic studies. Phylogenetic analyses revealed largely congruent topologies across datasets and methods, providing improved resolution and strong support for most subfamilial and tribal relationships compared with previous studies. This study highlights the utility of plastid genome data for resolving deep-level phylogenetic relationships within Hamamelidaceae. The genome architecture reflects the high conservation of plastid genomes, while the identified mutation hotspots represent potential resources for future taxonomic and phylogenetic studies. Our results support the existing subfamily classification while improving geographical coverage and generic representation, providing a robust framework for future taxonomic and evolutionary studies of this globally distributed and taxonomically complex family.

Hamamelidaceae

Plastome evolution and phylogenomic relationships in Ajuga (Lamiaceae, Ajugoideae).

BACKGROUND: Ajuga is currently known to include approximately 69 species, with a combined distribution extending throughout Eurasia, Africa, and Australia. Its popularity and significance are largely based on an extensive history of medicinal and horticultural use. It is divided into two sections based on morphological characters, and this sectional classification is also reflected in pronounced geographic patterns. Although previous studies have largely focused on Ajuga sect. Ajuga in East Asia, A. sect. Chamaepithys, which ranges from the Mediterranean to Central Asia, remains insufficiently sampled, thereby limiting a comprehensive understanding of infrageneric sectional relationships within the genus. Here, we generated complete plastid genomes for 12 species representing both sections of the genus and used these data to characterize plastome structure and infer evolutionary relationships. RESULTS: In this study, 21 Ajuga plastomes were analyzed, including 12 newly sequenced plastomes and 9 previously published plastomes representing 19 species. Comparative analyses showed that all plastomes exhibited a highly conserved quadripartite structure, with genome sizes ranging from 149,963 to 150,740 bp and GC contents varying from 38.2% to 38.3%. Each plastome contained 133 genes, including 88 protein-coding genes, 37 transfer RNA genes, and 8 ribosomal RNA genes. The boundaries between the inverted repeat (IR) and single-copy (SC) regions were also highly conserved across species. In addition, 796 simple sequence repeats (SSRs), 874 long repeat sequences (LRSs), and 12 highly variable regions (ccsA-ndhD, ndhF-rpl32, petA-psbJ, rpl32-trnL-UAG, rps2-rpoC2, trnH-GUG-psbA, trnK-UUU-rps16, trnP-UGG-psaJ, trnT-UGU-trnL-UAA, ycf15-trnL-CAA, ndhF, and ycf1) were identified among the 21 plastomes. Phylogenetic analyses based on four datasets and conducted using Maximum Likelihood and Bayesian Inference recovered two major clades corresponding to the traditionally recognized sectional classification, with one distributed from the Mediterranean to Central Asia and the other in East Asia. CONCLUSION: This study represents the most comprehensive plastome-based sampling of Ajuga to date, including representative species from the Mediterranean, Central Asia, and East Asia. Our results have significantly enhanced our understanding of its infrageneric relationships. The plastome resources generated in this study provide a valuable foundation for future research on species delimitation, phylogeny, and the evolutionary history of Ajuga.

Phylogeny

Dinucleotide repeat polymorphism at the apolipoprotein AII locus--phenotyping from peripheral blood and hair.

The genomes of eukaryotes including humans contain very short simple sequence repeats such as (dA-dC)n and (dG-dT)n. Recently, these repeats have been reported to exhibit marked length polymorphism due to wide variation in their reiteration numbers. We report here dinucleotide repeat polymorphism at the apolipoprotein AII locus in Japanese subjects. The informativeness in Japanese was as high as in Caucasians (PIC value and heterozygosity of 0.67 and 0.72, respectively), but their allele frequencies were different with statistical significance. We also discuss the advantages of using dinucleotide repeat polymorphisms in forensic science, demonstrating determination of phenotype from not only a single hair root but also a short hair shaft.

Apolipoprotein A-II

Evolutionary dynamics of the chloroplast genome in Abutilon (Malvoideae, Malvaceae).

The genus Abutilon Mill. (Malvaceae) comprises approximately 178 species distributed across tropical and subtropical regions, many of which hold significant ornamental, economic, and medicinal value; yet its taxonomic classification remains challenging. In this study, six species were sequenced from herbarium specimens, and the chloroplast (cp.) genomes of ten additional species were assembled de novo from publicly available raw data. Three previously reported cp. genomes were also incorporated to characterise cp. genome structure, identify polymorphic loci, and perform phylogenetic analyses. The cp. genomes ranged from 159,458 to 160,454 bp and exhibited the typical quadripartite structure, with each genome containing 112 unique genes (78 protein-coding, 30 tRNA, and 4 rRNA) that showed conserved content and organisation. These genomes exhibited high similarity in GC content, inverted repeat boundaries, relative synonymous codon usage, amino acid frequencies, and substitution patterns. However, notable variation was observed in the total number of simple sequence repeats, ranging from 70 to 97 per genome. Selection analyses indicated predominant purifying selection, with evidence of episodic positive selection detected in rpoC2, rbcL, and ycf1. Two codons in rbcL were clade-specific and provided phylogenetic signal distinguishing Australian and Old World pantropical species. Nucleotide diversity analysis identified six highly polymorphic intergenic spacers (trnH-psbA, rps19-rpl2, psbT-pbf1, psaC-ndhD, trnR-atpA, and ndhJ-ndhK) that may be suitable for taxonomic studies. The phylogeny from maximum likelihood (ML) and Bayesian inference (BI) resolved two major clades: one comprising an exclusively Australian lineage occurring predominantly in arid and semi-arid environments, and the other a pantropical lineage spanning multiple continents. Abutilon grandifolium was recovered as sister to the remaining sampled Abutilon taxa in both ML and BI analyses, although no biogeographic origin inference can be drawn from this placement pending broader taxon sampling and integration of nuclear genomic data. These findings provide insights into the evolutionary dynamics of the cp. genome in Abutilon and offer a foundational genomic framework for refining Abutilon taxonomy.

Genome, Chloroplast

The Complete Chloroplast Genome and the Phylogenetic Analysis of Panicum bisulcatum (Thumb.) (Poaceae).

The chloroplast (cp) genome of Panicum bisulcatum (Thumb.), a significant agricultural weed, was sequenced and characterized to elucidate its genomic architecture, evolutionary dynamics, and phylogenetic relationships. The complete cp genome was assembled as a circular DNA molecule of 138,489 bp, exhibiting a typical quadripartite structure comprising a large single-copy (LSC, 82,260 bp), a small single-copy (SSC, 12,569 bp), and a pair of inverted repeats (IR, 21,830 bp each) regions. It encodes 135 genes, including 89 protein-coding genes, 49 tRNAs, and 8 rRNAs. Functional annotation revealed that most genes are involved in photosynthesis and genetic system. A total of 51 simple sequence repeats (SSRs) and 62 long repeats (LRs) were identified, providing potential molecular markers. Comparative analysis of IR boundaries highlighted both conserved features and species-specific expansion/contraction events among Panicum species. Phylogenomic analysis robustly placed P. bisulcatum within the genus Panicum, showing a closest relationship with P. incomtum and confirming the monophyly of the genus. Furthermore, single nucleotide polymorphism (SNP) analysis with its closest relative, P. incomtum, revealed 4659 SNPs, with a dominance of synonymous substitutions, indicating the action of purifying selection. This study provides the first comprehensive cp genomic resource for P. bisulcatum, which will facilitate future studies in species identification, phylogenetic reconstruction, population genetics, and the development of sustainable management strategies for this weed.

Phylogeny

Organization, structure, and function of 95 kb of DNA spanning the murine T-cell receptor C alpha/C delta region.

We have analyzed the organization, structure, and function of the murine T-cell receptor C alpha/C delta region. This region spans 94.6 kb of DNA and contains the C alpha and C delta genes, as well as the V delta 5, J delta 2, and 50 different J alpha gene segments. Within this sequence we have identified 15 new J alpha gene segments, 40 new 5' RNA splice signals, and 40 new DNA rearrangement signals for the J alpha gene segments. The murine C alpha/C delta sequence contains an exceptionally high level of coding sequence with over 5.7% of the total sequence found in the exons. This is much more than that found in the beta-globin locus and the HPRT locus. Using the sequence data obtained from the C alpha/C delta region, we have designed simple assays to test for J alpha gene segment transcription and to determine the level of polymorphism for simple repeat sequences among different inbred strains of mice using the polymerase chain reaction. Furthermore, comparisons of this 95 kb of sequence with the available sequence from homologous regions of other species have led to the identification of a highly conserved sequence that is present throughout vertebrates and in the mouse binds lymphocyte-specific nuclear proteins. Comparisons of a 10-kb region, which includes the C alpha gene in human and mouse, average 66% sequence similarity. These studies support the contention that large-scale DNA sequencing projects of homologous regions of mouse and human will provide powerful new tools for studying the biology and evolution of loci such as the T-cell receptor and for identifying and posing new questions about the functions of conserved sequences.

Amino Acid Sequence

Transcription of a satellite DNA on two Y chromosome loops of Drosophila melanogaster.

Primary spermatocyte nuclei of Drosophila melanogaster exhibit three giant lampbrush-like loops formed by the kl-5, kl-3 and ks-1 Y chromosome fertility factors. Detailed mapping of satellite DNA sequences along the Y chromosome has recently shown that AA-GAC satellite repeats are a significant component of the kl-5 and ks-1 loop-forming regions. To determine whether these simple repeated sequences are transcribed on the loop structures we performed a series of DNA-RNA in situ hybridization experiments to fixed loop preparations using as a probe cloned AAGAC repeats. These experiments showed that the probe hybridizes with homologous transcripts specifically associated with the kl-5 and ks-1 loops. These transcripts are detected at all stages of development of these two loops, do not appear to migrate to the cytoplasm and are degraded when loops disintegrate during the first meiotic prophase. Moreover, an examination of the testes revealed that the transcription of the AAGAC sequences is restricted to the loops of primary spermatocytes; the other cell types of D. melanogaster spermatogenesis do not exhibit nuclear or cytoplasmic labeling. These experiments were confirmed by RNA blotting analysis which showed that transcription of the AAGAC sequences occurs in wild-type testes but not in X/O testes. The patterns of hybridization to the RNA blots indicated that the transcripts are highly heterogeneous in size, from large (migration at limiting mobility) to less than 1 kb. We discuss the possible function of the AAGAC satellite transcripts, in the light of the available information on the Y chromosome loops of D. melanogaster.

Animals

Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites.

Fifty sequences from the mouse genome database containing simple sequence repeats or microsatellites have been analysed for size variation using the polymerase chain reaction and gel electrophoresis. 88% of the sequences, most of which contain the dinucleotide repeat, CA/GT, showed size variations between different inbred strains of mice and the wild mouse, Mus spretus. 62% of sequences had 3 or more alleles. GA/CT and AT/TA-containing sequences were also variable. About half of these size variants were detectable by agarose gel electrophoresis. This simple approach is extremely useful in linkage and genome mapping studies and will facilitate construction of high resolution maps of both the mouse and human genomes.

Animals

PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains.

Eighty sequences from the mouse genome database containing microsatellites (simple sequence repeats) have been analyzed for size variation among ten different inbred strains of mice; 62/80 (77.5%) showed polymorphism of at least three alleles. We have been able to detect all the polymorphisms by agarose gel electrophoresis, often running the gels for up to 3 h. Between individual pairs of mouse strains to be used in chromosomal mapping studies in our laboratory, 35-60% polymorphism occurred. There are potentially enough microsatellites within the mouse and human genome to have a marker at every 1-cM distance. This simple approach will, therefore, continue to be useful in genome mapping studies, leading eventually to high-resolution maps of both the mouse and human genomes; this should allow for physical mapping and cloning of specific genes.

Animals

Intramolecular DNA triplexes, bent DNA and DNA unwinding elements in the initiation region of an amplified dihydrofolate reductase replicon.

The nucleotide sequence of 6.2 kb (1 kb = 10(3) base-pairs) of DNA that encompasses the earliest replicating portion of the amplified dihydrofolate reductase domains of CHOC 400 cells has been determined. Origin region DNA contains two AluI family repeats, a novel repetitive element (termed ORR-1), a TGGGT-rich region, and several homopurine/homopyrimidine and alternating purine/pyrimidine tracts, including an unusual cluster of simple repeating sequences composed of (G-C)5, (A-C)18, (A-G)21, (G)9, (CAGA)4, GAGGGAGAGAGGCAGAGAGGG, (A-G)27. Recombinant plasmids containing origin region sequences were examined for DNA structural conformations previously implicated in origin activation. Mung bean nuclease sensitivity assays for DNA unwinding elements show the preferred order of nuclease cleavage at neutral pH in supercoiled origin plasmids to be: (A-T)23 much greater than the (A-G) cluster much greater than (A)38 much greater than vector = (AATT)n. At acid pH, the hierarchy of cleavage preferences changes to: the (A-G) cluster much greater than (A-T)23 much greater than (AATT)n greater than vector = (A)38. A region of stably bent DNA was identified and shown not to be reactive in the mung bean nuclease unwinding assay at either acid or neutral pH. Intermolecular hybridization studies show that, in the presence of torsional stress at pH 5.2, the (A-G) cluster forms triple-stranded DNA. These results show that the origin region of an amplified chromosomal replicon contains a novel repetitive element and multiple sequence elements that facilitate DNA bending, DNA unwinding and the formation of intramolecular triple-stranded DNA.

Animals