PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “modification”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 361 records · Page 20Linked to original sources

Calcium-induced modification of protein conformation demonstrated by immunohistochemistry: What is the signal?

A recent study by Morgan et al. on the mechanism of the heating antigen retrieval (AR) has raised an interesting issue concerning calcium-induced modification of protein conformation demonstrated by immunohistochemistry (IHC). The current study is based on calcium-induced modification of thrombospondin (TSP) and Ki-67, as demonstrated by IHC using seven monoclonal antibodies (MAbs) to TSP and an MAb MIB1. Experiments were carried out on frozen tissue sections of bladder carcinoma and lymph node. Frozen sections were incubated with solutions of 50 mM CaCl2 and/or 10 mM EDTA at 4C overnight before formalin or acetone fixation for TSP and Ki-67, respectively. Sections were then fixed in 10% neutral buffered formalin or acetone before immunostaining. Seven MAbs to TSP, named Ab1 to 7 representing clone numbers of A4.1, D4.6, C6.7, A6.1, B5.2, A2.5, and HB8432, respectively, and MIB1 were utilized as primary antibodies. ABC was used as the detection system and AEC as the chromogen for immunohistochemical staining. An extracellular immunostaining pattern represented a positive result for TSP, and nuclear staining for MIB1. Frozen sections preincubated in 50 mM CaCl2 overnight at 4C showed significant loss of staining and/or altered staining pattern for six of the seven antibodies to TSP and MIB1 compared to positive controls not exposed to CaCl2. Lack of immunostaining of TSP and MIB1 attributable to exposure to CaCl2 could be partially recovered by incubating the frozen sections in EDTA. Calcium-induced modification of protein structure was demonstrated more than 10 years ago on the basis of immunochemical techniques. In this study, similar calcium-induced modification of protein was detectable by IHC in frozen tissue sections, suggesting that calcium-induced modification of protein structure may occur independently of fixation-induced modification. The fact that calcium binding may affect IHC staining is not surprising in view of the fact that antibody/antigen interactions are protein structure-dependent. However, in this experiment the change occurred before and independent of formalin fixation and does not necessarily imply a role for calcium in AR. There may be a valuable role for the use of chemical modification in visualization of protein structure changes in tissue sections by IHC. (J Histochem Cytochem 47:463-469, 1999)

Calcium↗

Temporal and spatial changes in transcription factor binding and histone modifications at the steroidogenic acute regulatory protein (stAR) locus associated with stAR transcription.

We investigated the binding of transcription factors and histone modifications associated with expression of the steroidogenic acute regulatory protein (StAR) gene in cultured MA-10 Leydig cells and in granulosa cells isolated from mouse periovulatory follicles before and after in vivo human chorionic gonadotropin administration. Quantitative chromatin immunoprecipitation assays were employed to prove association of specific transcription factors (GATA-4, steroidogenic factor 1/adrenal-4 binding protein, CCAAT/enhancer-binding protein beta, cAMP response element binding protein/cAMP response element modulator) and a coactivator (cAMP response element binding protein-binding protein) with the promoter, to define patterns of binding to test hypotheses regarding interactions among these factors, and to correlate changes in histone modification at the StAR locus with transcription. Although each of the transcription factors bound to the StAR proximal promoter, we observed cell-specific binding patterns for individual factors. From these findings we infer that associations among some of the factors can be more complex than can be explained by simple models of stable protein-protein interactions. Histone modifications were also found to exhibit cell-specific, temporal and spatial differences across the StAR locus. In MA-10 cells, these modifications included increased acetylation of histone H3, increased dimethylation of lysine 4 on histone H3 in exonic/intronic sequences (a modification that marks transcriptionally permissive chromatin), and reduced dimethylation of lysine 9 on histone H3 (a modification linked with gene silencing). In mouse granulosa cells, we observed no change in histone H3 or H4 acetylation, but a rapid loss of the dimethyl K9 histone H3 mark. Our findings demonstrate that increased StAR transcription can occur in the context of different patterns of transcription factor binding and histone modification.

8-Bromo Cyclic Adenosine Monophosphate↗

Lifestyle modification counseling of patients with dyslipidemias by pharmacists and other health professionals.

OBJECTIVES: To establish whether patients who are taking lipid-lowering medications receive information on lifestyle modifications from health care providers when originally prescribed and whether they continue to receive follow-up information on lifestyle modifications, and to establish where patients with dyslipidemias are receiving information about lowering their serum cholesterol levels through lifestyle modifications. DESIGN: Cross-sectional survey. SETTING: Two community pharmacies and two hospitals in two medium-sized cities in the midwestern area of the United States. PARTICIPANTS: 234 patients taking medication to lower serum lipids. INTERVENTION: Paper-based survey. MAIN OUTCOME MEASURE: Responses to survey items. RESULTS: Nearly three quarters (73.9%) of participants received information about lowering their serum lipids through lifestyle modifications when they were first diagnosed with elevated serum cholesterol concentrations. Of these, most (83.8%) said that the information came from their physician. Fewer than one half (48.3%) of all participants said that they continued to receive this type of information. Those who received lifestyle modification information at their original diagnosis and who continued to receive this type of information were more likely to be actively trying to lower their serum lipid levels through diet (93.1%) and exercise (71.6%). Participants visited their pharmacy more often than their physician's office each year, yet they recalled pharmacists offering less patient counseling on lifestyle modifications than did physicians and nurses. CONCLUSION: Despite being well positioned to assist patients with elevated serum cholesterol concentrations, pharmacists offer less patient counseling about therapeutic lifestyle modifications compared with physicians and nurses.

Adult↗

A new modification of the Chiron ACS assay for total prostate-specific antigen achieves equimolar response characteristics and improves the detection of prostate cancer.

Nonequimolar-response assays for prostate-specific antigen (PSA) are criticized for overestimating total PSA in some men without prostate cancer (PCA), and underestimating total PSA in some men with PCA. We recently studied three nonequimolar-response PSA assays that had undergone modifications. While two of the studied assays achieved equimolar-response characteristics with improved areas under receiver operating characteristic (ROC) curves (AUC), the modification of the Chiron ACS PSA assay (ACS PSA2, Chiron) failed to achieve this. Recently, the ACS assay underwent another modification (ACS PSA, Bayer), which we investigated. Sera from 305 men (155 without and 150 with PCA, PSA > or = 2 and < or = 30 microg/l, Tandem-E) were measured using both modifications of the ACS assay and equimolar-response reference methods (Tandem-R free and Tandem-E, Hybritech). Molar response relative to the reference method and clinical performance (comparison of AUCs) between the previous and new ACS assay modifications were studied. The new modification of the ACS assay (ACS PSA, Bayer) achieved equimolar-response characteristics but reported lower values (average 10%) than the Tandem-E assay. Compared to the previous modification (ACS PSA2, Chiron), a 3% improvement in AUC (p = 0.01) was found. Using results of the redesigned equimolar-response assay (ACS PSA, Bayer), we calculated that 6 of 155 men without PCA in this sample set could be spared unnecessary biopsy compared with the previous nonequimolar-response assay (ACS PSA2, Chiron) without missing additional PCA (90% sensitivity). These data provide additional evidence for clinical advantages of equimolar-response over nonequimolar-response PSA assay formats.

Case-Control Studies↗

Protective effect of black tea against ethanol-induced oxidative modifications of liver proteins and lipids.

OBJECTIVE: Black tea has been recently ascertained as a source of water-soluble antioxidants that may enhance cellular antioxidant abilities. The present study was designed to investigate the efficacy of the preventive effect of black tea on oxidative modifications of liver lipids and proteins of 2-month-old rats intoxicated chronically (28 days) with ethanol. METHOD: Lipid peroxidation was estimated by measurement of lipid hydroperoxides, malondialdehyde, and 4-hydroxynonenal by high-performance liquid chromatography (HPLC) and by spectrophotometric determination of conjugated dienes. The markers of protein oxidative modification products-bistyrosine and tryptophan-were quantified by spectrofluorimetry, whereas levels of amino, sulfhydryl, and carbonyl groups were estimated spectrophotometrically. RESULTS: Ethanol intoxication caused changes in liver antioxidant abilities that led to the generation of oxidative stress and, consequently, to the significant increase in products of lipid and protein oxidative modification. Enhanced lipid peroxidation was confirmed by assessment of the concentration of lipid peroxidation products measured at all examined levels. Protein modifications were evidenced by increase in levels of bistyrosine and carbonyl groups and by decrease in concentration of tryptophan and levels of sulfhydryl and amino groups. The metabolic consequences of oxidative modifications of lipids and proteins were reduced by cathepsin B activity and translocation of this lysosomal protease into cytosol as well as markers of liver damage-alanine aminotransferase (ALT) and aspartate aminotransferase (AST)-into the blood serum. Administration of black tea to ethanol-intoxicated rats partially protected antioxidant parameters and, remarkably, prevented the significant increase in concentrations of all measured lipid peroxidation products. Moreover, the levels of markers of the protein-modification process were similar to those of the control group. Protection of biological membranes by black tea prevents changes in the permeability of these membranes and translocation of the examined enzymes. CONCLUSIONS: Our findings indicate that black tea protects proteins and lipids against oxidative modification induced by chronic ethanol intoxication, which preserves changes in redox and proteolytic homeostasis.

Alanine Transaminase↗

Techniques for studying protein heterogeneity and post-translational modifications.

Proteins often undergo several post-translational modification steps in parallel to protein folding. These modifications can be transient or of a more permanent nature. Most modifications are, however, susceptible to alteration during the lifespan of proteins. Post-translational modifications thus generate variability in proteins that are far beyond that provided by the genetic code. Co- and post-translational modifications can convert the 20 specific codon-encoded amino acids into more than 100 variant amino acids with new properties. These, and a number of other modifications, can considerably increase the information content and functional repertoire of proteins, thus making their analysis of paramount importance for diagnostic and basic research purposes. Various methods used in proteomics, such as 2D gel electrophoresis, 2D liquid chromatography, mass spectrometry, affinity-based analytical methods, interaction analyses, ligand blotting techniques, protein crystallography and structure-function predictions, are all applicable for the analysis of these numerous secondary modifications. In this review, examples of some of these techniques in studying the heterogeneity of proteins are highlighted. In the future, these methods will become increasingly useful in biomarker searches and in clinical diagnostics.

Humans↗

High frequency of highly active antiretroviral therapy modifications in patients with acute or early human immunodeficiency virus infection.

STUDY OBJECTIVES: To examine the frequency of highly active antiretroviral therapy (HAART) modifications, the reasons for these modifications, and toxicities of these drugs in patients receiving their first HAART regimen after a diagnosis of acute (< 2 mo from infection) or early (2-12 mo) human immunodeficiency virus (HIV) infection. PATIENTS: Fifty-one patients who were enrolled in the Acute Infection and Early Disease Research Program at a Baltimore, Maryland, site between January 1, 1998, and April 30, 2002, and who chose to start HAART. MEASUREMENTS AND MAIN RESULTS: Time from initiation of therapy to first modification-defined as change in any HAART drug without an interruption in therapy or as simultaneous discontinuation of all drugs within the regimen-and time from initiation of therapy to reinitiation of therapy were recorded, as well as reasons for modification and reinitiation. With a median follow-up of 1,549 days, 21 (41%) of 51 patients received HAART continuously, but only 10 (20%) continued to receive their original regimen without any modification. Among the 41 patients (80%) who received modified therapy, the main reasons for the first modification were toxicity (16 patients), nonadherence (8), and new data on treatment efficacy or safety (8). Of 30 patients who stopped HAART, 18 restarted HAART at a later time. CONCLUSION: The high frequency of treatment modification among patients treated after acute or early HIV infection underscores the importance of determining the usefulness of antiretroviral therapy early in HIV infection, and the need for more tolerable regimens if HAART is to be started at this stage.

Acute Disease↗

Validation of a quantitative method for defining CAD/CAM socket modifications.

A quantitative method was developed for defining manual socket modifications, averaging these modifications over a series of amputees, and using the average modifications as a template in commercial CAD/CAM systems. The CADVIEW programme (i.e. software for viewing and analysing CAD sockets) was rewritten to provide comparison functions for aligning sockets to a common axis, visualising the differences between sockets, generating modification outlines, assigning apex point values, and averaging the modification outlines. A CAD template generated in this manner should be the best general representation of a prosthetist's modification style. To test this hypothesis, 13 people with trans-tibial amputations were fitted with both a manual and a CAD/CAM socket. Questionnaires were completed by the subjects and by the prosthetist to obtain information on prosthetic comfort, function, and overall satisfaction. Ground reaction force and stride parameter data were also collected for each prosthesis during gait laboratory testing. No significant differences were found between the manually designed socket and the CAD/CAM designed socket for all data except the vertical peak forces on the amputated side. These results support the clinical application of this quantitative technique for making the transition from manual to CAD/CAM prosthetic modification procedures.

Adult↗

Adherence to occupational therapist recommendations for home modifications for falls prevention.

OBJECTIVE: This study examined adherence to home modification recommendations made by an occupational therapist and attempted to identify predictors of adherence. METHOD: An experienced occupational therapist visited the homes of 178 people (mean age = 764 years) to evaluate for and recommend appropriate home modifications for falls prevention. One year later, a research assistant visited these persons' homes to assess adherence. RESULTS: At least one home modification was recommended in 150 of the 178 homes visited. The most common recommendations were to remove mats and throw rugs (48%), to change footwear (24%), and to use a nonslip bathmat (21%). In the 121 homes revisited after 12 months, 419 home modifications had been recommended, and 216 (52%) were met with partial or complete adherence. The only significant predictors of adherence were a belief that home modifications can prevent falls and having help at home from relatives. CONCLUSION: A major barrier to adherence to home modification recommendations is that many older people do not believe that home modifications can reduce their risk of falling.

Accidental Falls↗

Post-translational modifications and their biological functions: proteomic analysis and systematic approaches.

Recently produced information on post-translational modifications makes it possible to interpret their biological regulation with new insights. Various protein modifications finely tune the cellular functions of each protein. Understanding the relationship between post-translational modifications and functional changes ("post-translatomics") is another enormous project, not unlike the human genome project. Proteomics, combined with separation technology and mass spectrometry, makes it possible to dissect and characterize the individual parts of post-translational modifications and provide a systemic analysis. Systemic analysis of post-translational modifications in various signaling pathways has been applied to illustrate the kinetics of modifications. Availability will advance new technologies that improve sensitivity and peptide coverage. The progress of "post-translatomics", novel analytical technologies that are rapidly emerging, offer a great potential for determining the details of the modification sites.

Animals↗

Therapy modifications in response to poorly controlled hypertension, dyslipidemia, and diabetes mellitus.

BACKGROUND: Poorly controlled cardiovascular risk factors are common. Evaluating whether physicians respond appropriately to poor risk factor control in patients may better reflect quality of care than measuring proportions of patients whose conditions are controlled. OBJECTIVES: To evaluate therapy modifications in response to poor control of hypertension, dyslipidemia, or diabetes in a large clinical population. DESIGN: Retrospective cohort study within an 18-month period in 2002 to 2003. SETTING: Kaiser Permanente of Northern California. PATIENTS: 253,238 adult members with poor control of 1 or more of these conditions. MEASUREMENTS: The authors assessed the proportion of patients with poor control who experienced a change in pharmacotherapy within 6 months, and they defined "appropriate care" as a therapy modification or return to control without therapy modification within 6 months. RESULTS: A total of 64% of patients experienced modifications in therapy for poorly controlled systolic blood pressure, 71% for poorly controlled diastolic blood pressure, 56% for poorly controlled low-density lipoprotein cholesterol level, and 66% for poorly controlled hemoglobin A1c level. Most frequent modifications were increases in number of drug classes (from 70% to 84%) and increased dosage (from 15% to 40%). An additional 7% to 11% of those with poorly controlled blood pressure, but only 3% to 4% of those with elevated low-density lipoprotein cholesterol level or hemoglobin A1c level, returned to control without therapy modification. Patients with more than 1 of the 3 conditions, higher baseline values, and target organ damage were more likely to receive "appropriate care." LIMITATIONS: Patient preferences and suboptimal adherence to therapy were not measured and may explain some failures to act. CONCLUSIONS: As an additional measure of the quality of care, measuring therapy modifications in response to poor control in a large population is feasible. Many patients with poorly controlled hypertension, dyslipidemia, or diabetes had their therapy modified and, thus, seemed to receive clinically "appropriate care" with this new quality measure.

Adult↗

[Reactive derivatives of oligonucleotide phosphorothioate analogues. IV.Site-directed modification of nucleic acids in intramolecular alkylation of phosphorothioate groups].

Alkylation of the 22-mer DNA target pTGCCTGGAGCTGCTTGATGCCC (I) by oligodeoxynucleotide phosphorothioate derivatives (PTAO) GpsCpsApsTpsCpsApsApsGpsCpsApsGpsCpN(CH3)CH2(RCl) (II-PS) and (RCl)CH2N(CH3)pGpsCpsApsTpsCpsApsApsGpsCpsApsGpsC (III-PS) bearing a residue of an aromatic analogue of nitrogen lost (RCl = C6H4N(CH3)(CH2CH2Cl) at the 3'- or 5'-end was studied. It was shown that the internucleotide phosphorothioate bonds do not affect the regiospecificity of the target modification. The maximum degree of the target modification (at t-->infinity) at 20 degrees C was about 25% for both (II-PS) and (III-PS). The use of GCATCAAGCAGCpN(CH3)CH2(RCl) (II-PO), containing internucleotide phosphodiester bonds, under the same conditions gave about 65% of the modified DNA. Kinetics of the PTAO-induced complementarily addressed nucleic acid (NA) modification was analyzed. The rate constants of the reaction of the intermediate reactive ethylenimmonium ion with phosphorothioate groups of the reagents were evaluated both in solution and in duplex. The intramolecular alkylation of phosphorothioate groups considerably affected the DNA target modification by decreasing the effectiveness of the modification in a wide range of temperatures and changing the temperature dependence of the modification from a bell-like to an S-like profile. It was concluded that, in the course of the modification, the PTAO phosphorothioate groups are intramolecularly alkylated both in solution and in the complementary NA target-oligonucleotide duplex.

Alkylating Agents↗

[Modification of atrio-ventricular conduction in treatment of supraventricular reentry tachycardia. (preliminary results)].

Intracardiac defibrillation to produce complete heart block is a modern and effective method for treatment of refractory supraventricular arrhythmias. The main drawback of this technique is the necessity of implantation of permanent pacemaker. There is however a growing interest in modification of atrio-ventricular (A-V) conduction to prevent arrhythmias without producing complete heart block. A new energy source used for this purpose is the radiofrequency (RF) current. Preliminary clinical results of modification of antegrade conduction in 5 patients with recurrent supraventricular arrhythmias are presented. HAT 100 (Dr Osypka GmbH, Germany) a high frequency generator was used for modification. Electrophysiological studies showed slow/fast type of junctional reentry tachycardia in 4 patients and paroxysmal atrial flutter with rapid ventricular response in 1. Since RF current produces much smaller and more discrete lesion, the precise localization of the active electrode was of primary importance. We manipulated the catheter, used for modification, in AV region until a relatively large atrial potential with only barely visible His bundle deflection was obtained. During reentry tachycardia the place of the earliest retrograde atrial depolarization was searched for. Current and voltage were monitored during the modification procedure. It was possible to titrate the HF energy to achieve the desired effect changing the power and the time of current application. The modification was repeated several times since PQ and AH interval increased > 50%. No prolongation of HV was noted. The modification was effective in all patients and allowed to avoid the induction of reentry despite the persistence of 1:1 AV conduction.(ABSTRACT TRUNCATED AT 250 WORDS)

Adult↗

Rabbit muscle phosphofructokinase. Modification of molecular and regulatory kinetic properties with the affinity label 5'-p-(fluorosulfonyl)benzoyl adenosine.

The affinity label 5'-p-(fluorosulfonyl)benzoyl adenosine modifies rabbit muscle phosphofructokinase to the extent of one group/subunit. Modification appears to occur at a binding site specific for AMP, cyclic AMP, and ADP, i.e. those adenine nucleotides which are activators under conditions where regulatory kinetic behavior is obtained. The consequences of the modification are consistent with the model proposed previously for correlation between the pK of specific ionizable groups, regulatory kinetic behavior, ligand binding, and the reversible cold inactivation of the enzyme (Frieden, C., Gilbert. H. R., and Bock, P. E. (1976) J. Biol. Chem. 251, 5644-5647). Thus, the modification shifts the apparent pK of the essential ionizable groups from 6.9 to 6.4 at 25 degrees C, with the result that regulatory kinetic behavior at pH 6.9 and 25 degrees C is lost. Furthermore, the apparent affinity of a site (other than the active site) for ATP, as measured by ATP-dependent quenching of intrinsic protein fluorescence at pH 6.9 and 25 degrees C, is decreased by the modification. Regulatory kinetic behavior for both substrates is obtained with the modified enzyme at a lower pH, consistent with the downward shift in the pK of the ionizable groups, but sensitivity to cAMP activation is abolished by the modification. The loss of regulatory kinetic behavior upon modification of sulfhydryl groups does not appear to be the same as that due to modification by the affinity label.

Adenosine↗

The long term effectiveness of combined therapy by behavior modification and very low calorie diet: 2 years follow-up.

Seventy refractory obese subjects were assigned to one of three treatments; (a) very low calorie diet (VLCD) alone; (b) behavior modification alone; and (c) combined therapy by VLCD and behavior modification. Fifteen obese patients were treated by VLCD for 1-2 months on the outpatient clinic; 16 obese patients were treated by a combined therapy and 39 subjects were treated by behavior modification alone. Formula diet used in this program was Optifast 70 (420 kcal/day). The behavior modification had been performed for 4 months with eight group meetings, using the revised textbook based on the Learn Program (University of Pennsylvania). Effects on weight reduction and its maintenance during 2 years follow-up were compared in each treatment group. There were no significant differences between average weight loss of patients treated by VLCD (7.5 +/- 2.1 kg/month) and that attained by the combined therapy (8.3 +/- 2.3 kg/month). At 2 years after the termination of the VLCD treatment, 67 percent of patients had regained more than half of their reduced weight, with an average weight regain of 4.3 +/- 3.5 kg. In contrast, 12 of 16 (75 percent) and 33 of 39 (85 percent) patients had maintained their reduced weight for 2 years after the combined therapy or the behavior modification program. Continuing weight loss of 1.0 +/- 0.7 kg by the combined therapy and 1.3 +/- 2.2 kg by the behavior modification were observed at 2 years of follow-up. Weight reducing effect of combined therapy by behavior modification and VLCD was almost identical with that obtained by VLCD alone in a short term observation of one month.(ABSTRACT TRUNCATED AT 250 WORDS)

Behavior Therapy↗

Modification of the discharge of lateral geniculate neurons during visual learning.

Visually conditioned heart rate change in the pigeon has been developed as a vertebrate model system for cellular analysis of associative learning. Previous studies have characterized the behavior, largely delineated the neural circuitry mediating the conditioning, and estimated the central processing time for the conditioned response. Most recently, this system has been used to investigate neuronal activity during conditioning along the visual pathways that transmit the conditioned stimulus (CS) information. It was first shown that neither maintained nor CS-evoked discharge of retinal ganglion cells changes during conditioning. Subsequently, we found that the thalamic and telencephalic components of the ascending tectofugal pathway show associative modification. We report here studies of the thalamofugal pathway, the avian homolog of the mammalian geniculocortical system. Single-cell activity was recorded in the thalamic relay of this pathway, the dorsal lateral geniculate equivalent (LGNe). This provided an opportunity to evaluate the generality of the training-induced modification found along the tectofugal pathway, and to determine if such modification occurs as peripherally as retinorecipient neurons. The results show that almost all LGNe neurons (97%) respond phasically to the onset of whole-field illumination. Most (94%) also respond to the unconditioned stimulus (US), footshock, some with increased and others with decreased discharge. Of cells receiving convergent input, those responding with decreased discharge to the US showed associative change (52%). Neurons that did not respond to both the CS and US, or that responded to the US with increased discharge, did not show associative modification. These findings suggest that the visual pathways transmitting CS information are not merely input lines, but undergo training-induced modification; such modification can occur as peripherally as the retinorecipient neurons of these pathways; and CS-US convergence is necessary but not sufficient for associative modification, since modifiability is apparently contingent on specific US response properties.

Analysis of Variance↗

Chemical modification of critical catalytic residues of lysine, arginine, and tryptophan in human glucose phosphate isomerase.

Human glucose phosphate isomerase was subjected to a series of chemical modifications aimed at identifying residues essential for catalytic activity. A specific lysine was found to stoichiometrically react with pyridoxal 5'-phosphate forming a reversible Schiff base which could be reduced with NaBH4. The covalently modified enzyme was specifically cleaved with hydroxylamine at three labile Asn-Gly sequences yielding a series of peptides which were separated by sodium dodecyl sulfate-polyacrylamide electrophoresis. The modified lysine was located in the COOH-terminal peptide. A critical arginine residue/subunit was found to be stoichiometrically modified with either 2,3-butadione or cyclohexadione. At high concentrations of butadione, an irreversible nonspecific modification of essentially all arginines occurred. An essential tryptophan residue was found to be stoichiometrically modified with N-bromosuccinimide in a similar fashion. Each of the chemical modifications of these three residues followed pseudo-first order and rate saturation kinetics and the modifications were prevented by the presence of substrates or competitive inhibitors. Circular dichroic spectral studies and analytical gel filtration indicated that these modifications have no effect on the quarternary structure and little effect on the secondary and tertiary structures of the enzyme. However, the extensive modification of arginine with butadione caused a dissociation of the enzyme into monomers and significant changes in tertiary structure. These studies provide new insights into functional aspects of isomerization and also provide an effective method for evaluating structural consequences of chemical or genetic modification of the enzyme.

Affinity Labels↗

Role of the motor cortex in the control of visually triggered gait modifications.

One important aspect of locomotor control is the ability of an animal to make anticipatory gait modifications to avoid obstacles, by stepping either around them or over them. This paper reviews some of the evidence that suggests that the motor cortex is one of the principal structures involved in the control of such anticipatory gait modifications in cats, in particular when they are triggered by a visual signal. Evidence for this statement is provided both from experiments in which the motor cortex has been lesioned or inactivated and from studies in which the activity of motor cortical neurones has been recorded during locomotor tasks in which visual information is required to ensure the correct positioning of the paw or an appropriate modification of the limb trajectory. Inactivation of small regions of the motor cortex with the GABA agonist muscimol results in changes in the limb trajectory so that cats hit an obstacle instead of stepping over it as they do normally. A similar disruption of the hindlimb trajectory is seen following lesions of the spinal cord at T13 that interrupt the corticospinal tract. The results from cell recording studies are complementary in that they show that the activity of many identified pyramidal tract neurones increases when the cat is required to modify the forelimb or hindlimb trajectory to step over obstacles. We suggest that the major function of this increased discharge frequency is to regulate the amplitude, duration, and temporal pattern of muscle activity during the gait modification to ensure an appropriate modification of limb trajectory. We further suggest that different groups of pyramidal tract neurones are involved in regulating the activity of groups of synergistic muscles active at different times in the gait modification. For example, some groups of pyramidal tract neurones would be involved in ensuring the appropriate and sequential activation of the muscle groups involved in the initial flexion of the elbow, while others would be active prior to the repositioning of the paw on the support surface. We discuss the possibility that the motor cortical activity seen during locomotion is the sum result of a feedforward signal, which provides visuospatial information about the environment, and feedback activity, which signals, in part, the state of the interneuronal pattern generating networks in the spinal cord. The way in which the resulting descending command may interact with the basic locomotor rhythm to produce the gait modifications is discussed.

Animals↗