PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “Enhancer mapping”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 379 records · Page 21Linked to original sources
PubMed1999

Vascular mitogen-activated protein kinase activity is enhanced via angiotensin system in spontaneously hypertensive rats.

The vascular structural remodeling function may be altered in genetically hypertensive animals, spontaneously hypertensive rats (SHR). To examine this possibility, we measured the activity of mitogen-activated protein (MAP) kinases, enzymes believed to be involved in the pathway for cell proliferation, in rat aorta strips, and examined whether the endothelium removal-induced MAP kinase activation function is altered in SHR and whether vascular angiotensin and endothelin systems are responsible for the alteration of MAP kinase activation in SHR. Male 4-week-old SHR and age-matched Wistar Kyoto rats (WKY) supplied by Charles River Japan were used. Endothelium-denuded aorta strips were incubated at 37 degrees C in medium. MAP kinase activity after incubation was time-dependently increased in strips from SHR and WKY. MAP kinase activation was greater in SHR than in WKY aorta strips. Similarly, MAP kinase activation was enhanced in aorta strips from 4-week-old SHR and stroke prone SHR supplied by the Diseases Model Cooperative Research Association (Kyoto, Japan). In aorta strips from SHR and WKY, the angiotensin receptor antagonist, losartan, and the endothelin receptor antagonist, cyclo (D-alpha-aspartyl-L-prolyl-D-valyl-L-leucyl-D-tryptophyl)(BQ123), caused concentration-dependent inhibition of MAP kinase activation. The losartan-induced but not BQ123-induced inhibition of MAP kinase activation was greater in SHR than in WKY aorta strips. Angiotensin II caused a concentration-dependent increase in MAP kinase activity and the angiotensin II-induced MAP kinase activation was greater in SHR than in WKY aorta strips. These results indicate that endothelium removal-induced MAP kinase activation is enhanced in aorta strips from young SHR, suggesting that vascular structural remodeling function may be enhanced in SHR. It appears that the enhancement of MAP kinase activation results, at least in part, from enhanced function of vascular angiotensin system in SHR.

Angiotensin II↗
PubMed2004

Cytoplasmic dynein mediates adenovirus binding to microtubules.

During infection, adenovirus (Ad) capsids undergo microtubule-dependent retrograde transport as part of a program of vectorial transport of the viral genome to the nucleus. The microtubule-associated molecular motor, cytoplasmic dynein, has been implicated in the retrograde movement of Ad. We hypothesized that cytoplasmic dynein constituted the primary mode of association of Ad with microtubules. To evaluate this hypothesis, an Ad-microtubule binding assay was established in which microtubules were polymerized with taxol, combined with Ad in the presence or absence of microtubule-associated proteins (MAPs), and centrifuged through a glycerol cushion. The addition of purified bovine brain MAPs increased the fraction of Ad in the microtubule pellet from 17.3% +/- 3.5% to 80.7% +/- 3.8% (P < 0.01). In the absence of tubulin polymerization or in the presence of high salt, no Ad was found in the pellet. Ad binding to microtubules was not enhanced by bovine brain MAPs enriched for tau protein or by the addition of bovine serum albumin. Enhanced Ad-microtubule binding was also observed by using a fraction of MAPs purified from lung A549 epithelial cell lysate which contained cytoplasmic dynein. Ad-microtubule interaction was sensitive to the addition of ATP, a hallmark of cytoplasmic dynein-dependent microtubule interactions. Immunodepletion of cytoplasmic dynein from the A549 cell lysate abolished the MAP-enhanced Ad-microtubule binding. The interaction of Ad with both dynein and dynactin complexes was demonstrated by coimmunoprecipitation. Partially uncoated capsids isolated from cells 40 min after infection also exhibited microtubule binding. In summary, the primary mode of Ad attachment to microtubules occurs though cytoplasmic dynein-mediated binding.

Adenosine Triphosphate↗
PubMed2006

On the selection of optimal flip angles for T1 mapping of breast tumors with dynamic contrast-enhanced magnetic resonance imaging.

We present a method for selecting optimal flip angles for both precontrast and postcontrast T1 mapping of breast tumors using dynamic contrast-enhanced magnetic resonance imaging; and with the aim of improving accuracy in the estimation of contrast medium concentration. The proposed method can appropriately account for the different ranges of precontrst and postcontrast T1 values by the use of weighting functions, which also allow the flexibility to enhance the accuracy of certain T1 values, corresponding to the tissues of interest. Results of Monte Carlo simulations show that the proposed method could yield significantly lower errors in the estimation of contrast concentration, as compared with an existing approach.

Algorithms↗
PubMedDate not supplied

Enhancing performance measurement: NCQA's road map for a health information framework. National Committee for Quality Assurance.

Measuring the quality of health care delivery is one of the most critical challenges facing US health care. Performance measurement can be used to track the quality of care that health plans and medical groups deliver, but effective performance measurement requires timely access to detailed and accurate data. In 1996, the National Committee for Quality Assurance (NCQA) commissioned a report to learn what actions would improve health plans' capacity to electronically report performance data for the Health Plan Employer Data and Information Set (HEDIS). Tracking clinical performance will require not just clinical data stored in information systems, but an integrated health information framework. Seven features are essential to this framework: (1) it specifies data elements; (2) it establishes linkage capability among data elements and records; (3) it standardizes the element definitions; (4) it is automated to the greatest possible extent; (5) it specifies procedures for continually assessing data quality; (6) it maintains strict controls for protecting security and confidentiality of the data; and (7) it specifies protocols for sharing data across institutions under appropriate and well-defined circumstances. Health plans should anticipate the use of computerized patient records and prepare their data management for an information framework by (1) expanding and improving the capture and use of currently available data; (2) creating an environment that rewards the automation of data; (3) improving the quality of currently automated data; (4) implementing national standards; (5) improving clinical data management practices; (6) establishing a clear commitment to protecting the confidentiality of enrollee information; and (7) careful capital planning. Health care purchasers can provide the impetus for implementing the information framework if they demand detailed, accurate data on the quality of care.

Forms and Records Control↗
PubMed1996

An intron 1 regulatory region from the murine adenosine deaminase gene can activate heterologous promoters for ubiquitous expression in transgenic mice.

Ubiquitously expressed genes contain regulatory features which allow expression in virtually all cell types. In an effort to understand the molecular basis for this regulatory feature, the chromatin structure of the murine adenosine deaminase gene was examined by DNase I digestion in nuclei of several tissues. The promoter contained a strong hypersensitive site in all tissues examined, including those with very high and very low levels of ADA expression. Transgenic mouse studies revealed that a 3.3 kb EcoRI (3.3EE) fragment from intron I was required to generate a strong promoter DNase I hypersensitive site, and to produce ubiquitous expression. The 3.3EE fragment also contained a thymic enhancer activity which mapped to sequences conserved with the human ADA gene T-lymphocyte enhancer. Mutational analysis indicated that ubiquitous expression was not dependent on the presence of a functional thymic enhancer. Both the thymic enhancer and the ubiquitous activator within the 3.3EE fragment functioned with heterologous promoters in transgenic mice.

Adenosine Deaminase↗
PubMed1998

The role of purinergic and adrenergic transmitters of the sympathetic system in the control of arterial blood pressure variability.

Variability of mean arterial pressure (MAP) was examined in chronically instrumented, conscious, freely moving rats with pharmacologically altered efferent sympathetic influences on the cardiovascular system. MAP was recorded for 30 min beat-to-beat, using a computer under both control and experimental conditions: after administration of adrenoceptor antagonists (prazosin or phentolamine) or under P2X receptor inactivation produced either by desensitization with alpha, beta-methylene ATP or by PPADS blockade. Inhibition of adrenergic sympathetic effects on the cardiovascular system produced long-lasting and stable decrease in MAP. Prazosin did not modify MAP variability whereas phentolamine enhanced it. Under P2X receptor desensitization MAP decreased, the hypotensive effect being accompanied by a significant increase in MAP variability. A similar increase in MAP variability was observed after PPADS administration, while MAP level was not changed. Administration of PPADS in combination with phentolamine increased MAP variability more significantly than each of the drugs given separately. Changes in MAP variability under the various experimental conditions were not consistently correlated with changes in heart rate variability. We propose that ATP, being a mediator of sympathetic vasoconstriction, participates in baroreceptor-induced stabilization of MAP level.

Adenosine Triphosphate↗
PubMed2004

Data preprocessing by wavelets and genetic algorithms for enhanced multivariate analysis of LC peptide mapping.

Peptide mapping by means of liquid chromatography is a powerful technique used for the characterisation and analysis of the primary structure of proteins. Subtle changes in the covalent structure of the protein can be detected by means of the chromatographic profile (fingerprint). Chromatographic methods, however, display variations in the chromatographic profile even at identical instrumental settings and sample conditions. These variations may be due to changes of the chromatographic conditions, e.g. slight shifts in column temperature, and degradation or alterations of the stationary phase or small changes in the trifluoroacetic acid (TFA) concentration. Such variations may result in varying retention times and peak shapes of the analytes and differences in the chromatographic baseline, thereby having a detrimental impact on the results obtained on multivariate analysis of peptide maps. In order to reduce the non-sample-related variations and to be able to more fully extract the information in peptide mapping, approaches for achieving this objective are outlined in the present study. These methods are denoising and data compression of the chromatograms by wavelets, baseline corrections by linear interpolation, and peak shift alignments towards a target chromatogram by means of a genetic algorithm. Visual inspections of preprocessed chromatograms and principal component analysis (PCA) score plots demonstrate the efficiency of the methodology used. Furthermore, deliberately added changes, e.g. insertions of small Gaussian peaks (outliers), are more easily detected by the proposed methods than from the original chromatograms by multivariate analysis.

Algorithms↗
PubMed1997

Angiotensin type 2 receptor dephosphorylates Bcl-2 by activating mitogen-activated protein kinase phosphatase-1 and induces apoptosis.

We examined the cellular and signaling mechanism of angiotensin II (Ang II) type 2 (AT2) receptor-induced apoptosis in PC12W (rat pheochromocytoma cell line) cells that express abundant AT2 receptor but not Ang II type 1 receptor. In these cells, nerve growth factor (NGF) inhibited the internucleosomal DNA fragmentation induced by serum depletion, whereas Ang II antagonized this NGF cell survival action and induced apoptosis. We studied the mechanism of NGF and AT2 receptor interaction on apoptosis by examining their effects on the survival factor Bcl-2. AT2 receptor activation did affect intracellular Bcl-2 protein levels. Bcl-2 phosphorylation was stimulated by NGF, whereas AT2 receptor activation blocked this NGF effect. Pretreatment with antisense oligonucleotide of mitogen-activated protein (MAP) kinase phosphatase-1 enhanced the effects of NGF on MAP kinase activation and Bcl-2 phosphorylation but attenuated the inhibitory effects of AT2 receptor on MAP kinase, Bcl-2 phosphorylation, and apoptosis. Taken together, these results suggest that MAP kinase plays a critical role in inhibiting apoptosis by phosphorylating Bcl-2. The AT2 receptor inhibits MAP kinase activation, resulting in the inactivation of Bcl-2 and the induction of apoptosis.

Animals↗
PubMed1998

Functional map of a placenta-specific enhancer of the human leukemia inhibitory factor receptor gene.

We recently reported a placenta-specific enhancer in the human leukemia inhibitory factor receptor (LIFR) gene and now show detailed characterization of the 226-base pair enhancer (-4625/-4400 nucleotides). Four of twenty-two mutants in linker analysis showed reduced promoter activities to 45, 30, 10, and 10%, respectively. Specific binding of region A (-4617/-4602) with nuclear extract was competed by a known Oct-1 oligo and supershifted by Oct-1 antibody. Specific binding of region B (-4549/-4535) was competed by a GATA oligo, but could not be supershifted by four GATA antibodies. Nevertheless, mutagenesis showed that critical bases in region B were identical to the GATA core motif, indicating that region B may bind to a novel GATA family transcription factor. The other two adjacent regions designated as region C (-4464/-4445) showed no known consensus binding sites, and their specific placental JEG-3 nuclear extract binding was not evident in nonplacental nuclear extracts and was not competed by a trophoblast specific element (TSE), indicating that region C is a novel placenta-specific element (PSE, CATTTCCTGAACTAGTTTTT). Footprinting localized the binding boundary of PSE-binding protein (PSEB), and three Gs were found to be important for specific PSE binding. UV cross-linking showed that PSEB had a molecular mass of approximately 160 kDa, substituting the PSE with two previously reported placenta elements TSE or chorionic somatomammotropin enhancer factor 1 (CSEF-1) motifs resulted in markedly different promoter activities, indicating that PSEB is indeed different from TSE binding protein or CSEF-1. These results are the first demonstration that a novel PSE is the major element for placenta-specific enhancer activity in human LIFR gene.

Binding Sites↗
PubMed2001

Enhanced efficiency of quantitative trait loci mapping analysis based on multivariate complexes of quantitative traits.

An approach to increase the efficiency of mapping quantitative trait loci (QTL) was proposed earlier by the authors on the basis of bivariate analysis of correlated traits. The power of QTL detection using the log-likelihood ratio (LOD scores) grows proportionally to the broad sense heritability. We found that this relationship holds also for correlated traits, so that an increased bivariate heritability implicates a higher LOD score, higher detection power, and better mapping resolution. However, the increased number of parameters to be estimated complicates the application of this approach when a large number of traits are considered simultaneously. Here we present a multivariate generalization of our previous two-trait QTL analysis. The proposed multivariate analogue of QTL contribution to the broad-sense heritability based on interval-specific calculation of eigenvalues and eigenvectors of the residual covariance matrix allows prediction of the expected QTL detection power and mapping resolution for any subset of the initial multivariate trait complex. Permutation technique allows chromosome-wise testing of significance for the whole trait complex and the significance of the contribution of individual traits owing to: (a) their correlation with other traits, (b) dependence on the chromosome in question, and (c) both a and b. An example of application of the proposed method on a real data set of 11 traits from an experiment performed on an F(2)/F(3) mapping population of tetraploid wheat (Triticum durum x T. dicoccoides) is provided.

Chromosome Mapping↗
PubMed2004

MAP estimation for hyperspectral image resolution enhancement using an auxiliary sensor.

This paper presents a novel maximum a posteriori estimator for enhancing the spatial resolution of an image using co-registered high spatial-resolution imagery from an auxiliary sensor. Here, we focus on the use of high-resolution panchomatic data to enhance hyperspectral imagery. However, the estimation framework developed allows for any number of spectral bands in the primary and auxiliary image. The proposed technique is suitable for applications where some correlation, either localized or global, exists between the auxiliary image and the image being enhanced. To exploit localized correlations, a spatially varying statistical model, based on vector quantization, is used. Another important aspect of the proposed algorithm is that it allows for the use of an accurate observation model relating the "true" scene with the low-resolutions observations. Experimental results with hyperspectral data derived from the airborne visible-infrared imaging spectrometer are presented to demonstrate the efficacy of the proposed estimator.

Algorithms↗
PubMed1980

Inhibition of amygdaloid kindling by chronic pretreatment with cocaine or methamphetamine.

Amygdaloid kindling was induced by daily electrical stimulation in the left amygdala in five groups of cats: a chronic cocaine pretreatment group; a chronic methamphetamine (MAP) pretreatment group; two treatment groups, one using pimozide and the other haloperidol during the period when kindling was being induced; and a drug-free control group. The number of left amygdaloid stimulations required for generalized convulsions was significantly greater in the two chronic pretreatment groups and significantly less in the two treatment groups, compared to the control group. All animals in the chronic cocaine and MAP pretreatment groups showed hemiconvulsions instead of symmetrical generalized convulsions and lateralized interictal discharges in the stimulated hemisphere. In rekindling to the right amygdala, seizure development was significantly suppressed compared to the control group. In the two chronic pretreatment groups, chronic administration of cocaine or MAP was followed by enhancement of behavioral responses to cocaine, MAP, and apomorphine. The association of such "sensitization" with impairment of the kindling process suggests that dopamine receptor sensitivity is an important factor in this form of epileptogenesis.

Amygdala↗
PubMed1999

Diagnostic usefulness of endorectal magnetic resonance imaging with dynamic contrast-enhancement in patients with localized prostate cancer: mapping studies with biopsy specimens.

BACKGROUND: New diagnostic criteria for dynamic magnetic resonance (MR) imaging in prostate cancer are presented. The diagnostic usefulness of endorectal MR imaging with dynamic contrast-enhancement in localized prostate cancer and the validity of these criteria were evaluated. METHODS: Eighteen untreated patients who were suspected of localized prostate cancer were included in the study. They received endorectal dynamic MR imaging before systematic sextant needle biopsy. First. a mapping study with the findings of MR images and histopathology of biopsy specimens was performed in eight patients out of 18 to compare the difference in T2-weighted images with the endorectal coil and the body coil in the same individuals. Second, another mapping study was performed in all 18 patients by analyzing the findings of endorectal dynamic MR images. For the diagnosis of prostate cancer in MR imaging, we offered diagnostic criteria from our experience in addition to those in plain T2-weighted images from the literature. RESULTS: The overall diagnostic rates of endorectal dynamic MR imaging were 88.9% in accuracy, 100% in sensitivity, and 81.8% in specificity. In the comparison of the endorectal and body coils in T2-weighted images in eight patients, there was no difference in the diagnostic rates except for one more histopathologic false positive portion in endorectal MR imaging. In the second mapping study in 18 patients, the diagnostic rates were 92.6% in accuracy, 88.9% in sensitivity and 93.3% in specificity. Endorectal dynamic imaging raised the diagnostic sensitivity from 77.8 to 88.9%. CONCLUSION: The data demonstrated the validity of this diagnostic criteria and the diagnostic usefulness of endorectal dynamic MR imaging in localized prostate cancer.

Aged↗
PubMed2005

Node-link mapping in individual counseling: treatment impact on clients with ADHD-related behaviors.

Three types of individual drug abuse counseling were investigated in a private methadone clinic in order to replicate and extend previous work on node-link mapping techniques (two dimensional graphic approaches for visualizing problems and solutions). Standard counseling, enhanced counseling with free-form maps (f-maps), and enhanced counseling with both f-maps and guide-maps (g-maps) were compared at six and 12 months of treatment. Also assessed were differential effects of these counseling conditions on clients with low and high levels of behaviors related to attention deficit hyperactivity disorder (ADHD; low-problem versus high-problem clients). Dependent variables included the number of scheduled sessions attended per month, counselor ratings of session characteristics (e.g., powerful, valuable), client psychological status ratings (i.e., self-esteem, depression, and anxiety) and treatment retention (i.e., the number of months clients remained in treatment). Findings replicate and extend prior work indicating the positive impact of using node-link maps in individual drug abuse counseling. Particular benefits were found for clients with high levels of ADHD-related problems.

Adult↗
PubMed1997

A MRI spatial mapping technique for microvascular permeability and tissue blood volume based on macromolecular contrast agent distribution.

A rapid and automated method for two-dimensional spatial depiction (mapping) of quantitative physiological tissue characteristics derived from contrast enhanced MR imaging was developed and tested in disease models of cancer, inflammation, and myocardial reperfusion injury. Specifically, an established two-compartment kinetic model of unidirectional mass transport was implemented on a pixel-by-pixel basis to generate maps of tissue permeability surface area product (PS) and fractional blood volume (BV) based on dynamic MRI intensity data after administration of albumin-(Gd-DTPA)30, a prototype macromolecular contrast medium (MMCM) designed for blood pool enhancement. Maps of PS and BV in disease models of adenocarcinoma, intramuscular abscess inflammation, and myocardial reperfusion injury clearly depicted zones of increased permeability (up to approximately 500 microl/cc/h--compared to <25 microl/cc/h in normal tissues). As revealed on PS maps, the rank ordering of studied permeability abnormalities was reperfusion injury > inflammation > tumors. A rapid, automated mapping technique derived from dynamic contrast-enhanced MRI data can be used to facilitate the identification and characterization of pathophysiologic abnormalities, specifically relative increases in blood volume and/or microvascular permeability.

Abscess↗
PubMed2003

T1 mapping in patients with acute myocardial infarction.

Pixel-by-pixel calculation of T1 values (T1 mapping) has been used in different tissues to focus on T1 changes in a quantitative fashion. The aim of this study was to establish T1 mapping of human myocardium on a 1.5 Tesla system and to examine its diagnostic potential in patients with acute myocardial infarction (AMI). 8 patients with reperfused AMI (day 3 +/- 1) underwent multi-breath-hold MRI in a 1.5 Tesla system. Sets of five images with varying T1 weighting were acquired prior to and after the administration of contrast agent to generate images from calculated T1 values (T1 mapping). Prior to the contrast agent administration, all patients showed T1 prolongation in the area of infarction, which was identified in separate measurements using the delayed enhancement approach. Compared to noninfarcted areas, T1 values in the infarcted areas were increased by 18 +/- 7% (SE, p < 0.05). The spatial extent of the area of T1 prolongation was larger than that of the hyper-enhanced areas in conventional contrast-enhanced images. T1 maps obtained after the application of Gadolinium-DTPA revealed a T1 reduction of 27 +/- 4% in infarcted tissue compared to noninfarcted areas (p < 0.05). The areas showing T1 reduction were in agreement with the hyper-enhanced regions in conventional T1-weighted images. T1 mapping visualizes changes in the longitudinal relaxation time induced by AMI. T1 mapping can detect myocardial necrosis without the use of contrast media. Information that can be extracted from a combination of pre- and postcontrast T1 maps exceeds that from conventional contrast studies.

Adult↗
PubMed1996

Potassium chloride pulse enhances mitogen-activated protein kinase activity in rat hippocampal slices.

Mitogen-activated protein (MAP) kinases have been implicated in multiple responses to extracellular stimuli. In this study we show that MAP kinase activity is enhanced after a KCl pulse. This activation correlates with an increased tyrosine phosphorylation of a 42-kDa protein as determined by antiphosphotyrosine immunoblot. The same band is found in an anti-MAP kinase immunoblot. Activity is enhanced within 1 min, reaches a maximum at 2 min, and returns to basal level after 10 min. A second peak of activity is observed between 12 and 30 min. The activation is completely blocked by 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX), showing the involvement of the AMPA type of glutamate receptor. Partial inhibition of MAP kinase activation by 2-amino-5-phosphonovalerate (APV) also shows the involvement of the NMDA receptor. Because the KCl pulse used induces long-term potentiation (LTP) in rat hippocampal slice, we conclude that MAP kinase may be involved in neuronal transduction events leading to LTP.

2-Amino-5-phosphonovalerate↗