SEARCH · PubMed Health

Results for “Simple repeated sequences”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 379 records · Page 21Linked to original sources

PubMed2001

[Modulation of the cat gene expression in E. coli cells by simple (AC)20 repeats].

Probable relationship between modulation of gene expression by simple repeating sequences and competition capacity of the host was studied. (AC)20 repeat can both stimulate and inhibit the expression of chloramphenicol acetyl transferase gene expression in E. coli cells depending on this gene's position. Modulation of the gene expression by simple (AC)20 repeat and competitive capacity of bacteria containing this plasmid are closely related.

Chloramphenicol O-Acetyltransferase↗

PubMed1982

The structure of the human zeta-globin gene and a closely linked, nearly identical pseudogene.

DNA sequencing studies indicate that only one of two closely linked human embryonic alpha-like globin genes, zeta (zeta), encodes a functional polypeptide. The other is a pseudogene (psi zeta) that differs by only 3 bp in the protein coding sequence, one of which converts the codon for amino acid 6 into a chain termination codon. Both zeta-globin genes differ from all other alpha-like genes thus far reported in that they contain large introns consisting, in part, of simple repeat sequences. Intron 1 of each gene contains a variation of the repeat sequence ACAGTGGGGAGGGG, while intron 2 contains the repeat sequence CGGGG. Comparison of the human zeta- and alpha-globin gene sequences reveals that the embryonic and adult alpha-like genes began to diverge from each other relatively early in vertebrate evolution (400 million years ago). In contrast, the beta-like embryonic globin gene, epsilon (epsilon), is the product of a much more recent evolutionary event (200 million years ago). Thus, even though the temporal and quantitative expression of zeta- and epsilon-globin genes must be coordinately controlled during development, their evolutionary histories are clearly distinct.

Amino Acid Sequence↗

PubMed2006

Defining the sunflower (Helianthus annuus L.) linkage group ends with the Arabidopsis-type telomere sequence repeat-derived markers.

The target region amplification polymorphism (TRAP) marker technique was employed to define sunflower (Helianthus annuus L.) linkage group ends. In combination with eight arbitrary primers, nine fixed primers containing the Arabidopsis-type telomere repeat sequences worked successfully in generating polymorphic markers in the mapping population of 92 F(7) recombinant inbred lines (RIL) derived from the cross RHA 280 x RHA 801. This population was used in the construction of the densest sunflower linkage map of 577 simple sequence repeat (SSR) markers. With 18 sets of PCR reactions, 226 polymorphic TRAP markers were amplified from the two parental lines and 92 RIL. The computer program, Mapmaker, placed 183 markers into the established 17 linkage groups of the SSR map. Although most of the added markers spread across the genome, 32 markers were mapped to the outermost positions of the linkage groups, defining 21 of the 34 linkage group ends of the sunflower linkage map. The telomeric origin of a few of these markers was confirmed by sequence analyses. These telomere-associated markers will provide an accurate assessment of the completeness of a linkage group and a better estimate of the actual genetic lengths. The potential application of the telomere mapping to sunflower improvement is discussed.

Arabidopsis↗

PubMed1990

Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites.

Fifty sequences from the mouse genome database containing simple sequence repeats or microsatellites have been analysed for size variation using the polymerase chain reaction and gel electrophoresis. 88% of the sequences, most of which contain the dinucleotide repeat, CA/GT, showed size variations between different inbred strains of mice and the wild mouse, Mus spretus. 62% of sequences had 3 or more alleles. GA/CT and AT/TA-containing sequences were also variable. About half of these size variants were detectable by agarose gel electrophoresis. This simple approach is extremely useful in linkage and genome mapping studies and will facilitate construction of high resolution maps of both the mouse and human genomes.

Animals↗

PubMed2006

(CA)n microsatellite polymorphism of ERBB-1 in breast cancer.

The aim of this study was to determine polymorphism of repeated sequences (CA)(n) in the ERBB-1 gene. The study group included 197 breast cancer patients and 180 healthy women. DNA was isolated from fresh-frozen tumour tissue and from peripheral blood. ERBB-1 (CA)(n) microsatellite polymorphism was examined by polymerase chain reaction (PCR). A polymorphic simple sequence repeat region of 9-23 CA repeats was detected in both groups. Homozygotes comprised 22% and 34% of breast cancer patients and controls, respectively (P=0.009). An allelic imbalance (AI), mostly in the shorter allele, was found in 27% of breast cancer patients. AI occurrence was associated with the lack of oestrogen receptors in tumour cells (P=0.05); otherwise, there were no correlations between histoclinical features and (CA)(n) microsatellite polymorphism of ERBB-1. It was concluded that an allelic imbalance is a common feature in breast cancer patients and may coincide with the lack of oestrogen receptors in tumour cells. The clinical relevance of ERBB-1 microsatellite polymorphism in breast cancer remains to be established.

Allelic Imbalance↗

PubMed1991

Origin and spread of beta-globin gene mutations in India, Africa, and Mediterranea: analysis of the 5' flanking and intragenic sequences of beta S and beta C genes.

Nucleotide polymorphisms of both the 5' flanking and intragenic regions of the human beta-globin gene were investigated by directly sequencing genomic DNA after amplification by the polymerase chain reaction in 47 subjects homozygous for the beta S or the beta C mutation. The sickle-cell mutation was found in the context of five different haplotypes defined by eight nucleotide substitutions and various structures of a region of the simple repeated sequence (AT) chi Ty. All subjects from the same geographic origin bear an identical chromosomal structure, defining the Senegal-, Bantu-, Benin-, Cameroon-, and Indian-type chromosomes. These results strengthen our previous conclusions about the multiple occurrence of the sickle-cell mutation. The Benin-type chromosome was also found among Algerian and Sicilian sickle-cell patients, whereas the Indian-type chromosome was observed in two geographically distant tribes, illustrating the spread of these sickle-cell genes. We also found that the intragenic sequence polymorphisms (frameworks) are not always in linkage disequilibrium with the BamH I polymorphism downstream from the beta-globin gene, as had been previously observed. Finally, we present a tentative phylogenetic tree of the different alleles at this locus. Some polymorphisms of this sequence might be contemporary with our last common ancestor, the great apes, that is, about 4-6 millions years old.

Africa↗

PubMed2001

Polymorphism of PCR-based markers targeting exons, introns, promoter regions, and SSRs in maize and introns and repeat sequences in oat.

Sequence databases could be efficiently exploited for development of DNA markers if it were known which gene regions reveal the most polymorphism when amplified by PCR. We developed PCR primer pairs that target specific regions of previously sequenced genes from Avena and Zea species. Primers were targeted to amplify 40 introns, 24 exons, and 23 promoter regions within 54 maize genes. We surveyed 48 maize inbred lines (previously assayed for simple-sequence repeat (SSR) polymorphism) for amplification-product polymorphism. We also developed primers to target 14 SSRs and 12 introns within 18 Avena genes, and surveyed 22 hexaploid oat cultivars and 2 diploid Avena species for amplification-product polymorphism. In maize, 67% of promoter markers, 58% of intron markers, and 13% of exon markers exhibited amplification-product polymorphisms. Among polymorphic primer pairs in maize, genotype diversity was highest for SSR markers (0.60) followed by intron markers (0.46), exon markers (0.42), and promoter markers (0.28). Among all Avena genotypes, 64% of SSR markers and 58% of intron markers revealed polymorphisms, but among the cultivars only, 21% of SSR markers and 50% of intron markers were polymorphic. Polymorphic-sequence-tagged sites for plant-breeding applications can be created easily by targeting noncoding gene regions.

Avena↗

PubMed1992

PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains.

Eighty sequences from the mouse genome database containing microsatellites (simple sequence repeats) have been analyzed for size variation among ten different inbred strains of mice; 62/80 (77.5%) showed polymorphism of at least three alleles. We have been able to detect all the polymorphisms by agarose gel electrophoresis, often running the gels for up to 3 h. Between individual pairs of mouse strains to be used in chromosomal mapping studies in our laboratory, 35-60% polymorphism occurred. There are potentially enough microsatellites within the mouse and human genome to have a marker at every 1-cM distance. This simple approach will, therefore, continue to be useful in genome mapping studies, leading eventually to high-resolution maps of both the mouse and human genomes; this should allow for physical mapping and cloning of specific genes.

Animals↗

PubMed1999

Isolation and characterization of polymorphic microsatellites in Cocos nucifera L.

Microsatellites or simple sequence repeats (SSRs) were isolated from coconut (Cocos nucifera) and tested for polymorphism on restricted germplasm. Sequencing of 197 clones from a cv. Tagnanan Tall-enriched genomic library showed that 75% contained a microsatellite, of which 64% were dinucleotide (GA/CT, CA/GT and GC/CG), 6% were trinucleotide, and 30% were compound repeats. Of 41 primer pairs tested on Tagnanan Tall genomic DNA, 38 gave the expected size product, two amplified two loci, and another gave a multilocus pattern. On 20 coconut samples, the 38 SSRs detected 198 alleles (average: 5.2 alleles per microsatellite). Genetic diversity (D = 1 - sigma pi2) values ranged from 0.141 to 0.809. Heterozygotes were present at high frequencies among some dwarf samples. Analysis of similarity matrices based either on shared alleles at each locus (simple matching coefficient) or on allele bands across all loci (Jaccard coefficient) showed similar results. Dwarfs grouped separately from talls and showed less genetic diversity. In a wider test on 40 samples, 8 SSRs detected 64 alleles (average: eight alleles per microsatellite). These results indicate the high potential of microsatellites to detect genetic diversity in coconut germplasm.

Cocos↗

PubMed2000

Phylogenetic information in inter-SINE and inter-SSR fingerprints of the artiodactyla and evolution of the bov-tA SINE.

Various interspersed repeated sequences and elements (IRSs) can be utilized to generate PCR-based multilocus fingerprint profiles by amplifying the interelement segments, using primers matching the elements themselves. We assessed the utility of inter-IRS fingerprinting in phylogenetic comparisons among six artiodactyl species using several primers derived from two abundant genomic components: the Bov-tA short interspersed nuclear elements (SINEs) and simple sequence repeats or microsatellites (SSRs). Character- and distance-based analyses of the fingerprint data produced trees conforming to the established phylogenetic relationships of species. The strength of phylogenetic signal from different primers varied; combining data from different experiments resulted in robust trees. Within the Cervidae, the hierarchical relationship [(Odocoileus, Rangifer) Alces] was strongly supported. Both methods appear useful tools for systematic studies at time scales <30 Myr. To elucidate the material basis of inter-SINE fingerprints, we obtained the first sequences of the 'bovid' Bov-tA element also from two cervids (reindeer and white-tailed deer) and analysed their relationship to a number of paralogous bovid elements. The differences among sequences, both intra- and interspecific, were relatively high (mean 18.5%); the sequences showed no clear clustering with the species from which they had been isolated. Most individual elements probably date back to the cervid-bovid ancestor >25 Myr ago, which is in line with the observed fingerprint distributions.

Animals↗

PubMed2001

Differentiation of industrial wine yeast strains using microsatellite markers.

AIMS: To differentiate nine industrial wine strains of Saccharomyces cerevisiae using microsatellite (simple sequence repeats, SSR) markers. METHODS AND RESULTS: Six of the strains were indigenous yeasts currently used as high-density starter monocultures by the Uruguayan wine industry. Unequivocal differentiation of these six native strains and three commercial S. cerevisiae wine strains was achieved by PCR amplification and polymorphism analysis of loci containing microsatellite markers. CONCLUSION: We recommend the use of this reproducible and simple molecular method to routinely discriminate wine yeast strains. SIGNIFICANCE AND IMPACT OF THE STUDY: Microsatellites are superior to other methods for typing yeasts because the results can be exchanged as quantitative data. Knowledge of the frequencies of the alleles for different SSR markers will eventually lead to an accurate typing method to identify industrial wine yeast strains.

Alleles↗

PubMed1990

Intramolecular DNA triplexes, bent DNA and DNA unwinding elements in the initiation region of an amplified dihydrofolate reductase replicon.

The nucleotide sequence of 6.2 kb (1 kb = 10(3) base-pairs) of DNA that encompasses the earliest replicating portion of the amplified dihydrofolate reductase domains of CHOC 400 cells has been determined. Origin region DNA contains two AluI family repeats, a novel repetitive element (termed ORR-1), a TGGGT-rich region, and several homopurine/homopyrimidine and alternating purine/pyrimidine tracts, including an unusual cluster of simple repeating sequences composed of (G-C)5, (A-C)18, (A-G)21, (G)9, (CAGA)4, GAGGGAGAGAGGCAGAGAGGG, (A-G)27. Recombinant plasmids containing origin region sequences were examined for DNA structural conformations previously implicated in origin activation. Mung bean nuclease sensitivity assays for DNA unwinding elements show the preferred order of nuclease cleavage at neutral pH in supercoiled origin plasmids to be: (A-T)23 much greater than the (A-G) cluster much greater than (A)38 much greater than vector = (AATT)n. At acid pH, the hierarchy of cleavage preferences changes to: the (A-G) cluster much greater than (A-T)23 much greater than (AATT)n greater than vector = (A)38. A region of stably bent DNA was identified and shown not to be reactive in the mung bean nuclease unwinding assay at either acid or neutral pH. Intermolecular hybridization studies show that, in the presence of torsional stress at pH 5.2, the (A-G) cluster forms triple-stranded DNA. These results show that the origin region of an amplified chromosomal replicon contains a novel repetitive element and multiple sequence elements that facilitate DNA bending, DNA unwinding and the formation of intramolecular triple-stranded DNA.

Animals↗

PubMedDate not supplied

Analysis of MSH3 in endometrial cancers with defective DNA mismatch repair.

OBJECTIVE: To clarify the origin of defective mismatch repair (MMR) in sporadic endometrial cancers with microsatellite instability (MSI), a thorough mutation analysis was performed on the human mismatch repair gene MSH3. METHODS: Twenty-eight MSI-positive endometrial cancers were investigated for mutations in the human mismatch repair gene MSH3 using single-strand conformation variant (SSCV) analysis of all 24 exons. All variants were sequenced. Loss of heterozygosity was investigated at all MSH3 polymorphisms discovered. A subset of tumors were investigated for methylation of the 5' promoter region of MSH3 using Southern blot hybridization. RESULTS: An identical single-base deletion (delta A) predicted to result in a truncated proteins was discovered in six tumors (21.4%). This deletion occurs in a string of eight consecutive adenosine residues (A8). Because simple repeat sequences are unstable in cells with defective MMR, the observed mutation may be an effect, rather than a cause, of MSI. Evidence of inactivation of the second MSH3 allele in tumors with the delta A mutation would strongly support a causal role for these MSH3 mutations. However, there was no evidence of a second mutation, loss of sequences, or methylation of the promoter region in any of the tumors with the delta A mutation. CONCLUSION: Although the delta A mutation is a frequent event in sporadic MSI-positive endometrial cancers, it may not be causally associated with defective DNA MMR.

Blotting, Southern↗

PubMed1997

Recent advances in molecular genetics of colorectal cancer.

Advances in molecular biology have identified two important genes responsible for the hereditary colorectal cancers familial adenomatous polyposis (FAP) and hereditary nonpolyposis colorectal cancer. They are the APC gene and mismatch repair genes. The role of these genes in colorectal carcinogenesis has been studied intensively. The adenoma-carcinoma sequence was initially proposed by Vogelstein, and the multistep carcinogenesis theory is now well accepted. The various functions of the APC gene have been elucidated. APC genes are considered to play a role in shedding of the epithelial cells into the lumen. The mechanism behind formation of a unicryptal adenoma is now better understood. Adenoma formation is a monoclonal event with two hits of the APCgene. There is no zonal extension of the proliferative zone in the background colonic mucosa of FAP patients. In addition to the adenoma-carcinoma sequence, there seem to be various carcinogenetic pathways in the development of colorectal cancer. A depressed type of early cancer was recently found by the use of magnifying endoscopy. The incidence of K-ras mutation was extremely low in this group of early cancers. Some of the minute cancers show the p53mutation before the occurrence of APC mutation. Cancers of microsatellite mutator phenotype show exaggerated genomic instability at simple repeat sequences, such as TGFbetaRII. These genes may play a suppressor role in a p53 independent pathway of colorectal carcinogenesis. We are now in an exciting era of this progressing field of science. This genetic information may be more widely applicable clinically in the near future (e.g., for presymptomatic diagnosis, selection of patients for the most appropriate treatments, and assessment of malignant potential).

Adenomatous Polyposis Coli↗

PubMed2006

Word frequency analysis reveals enrichment of dinucleotide repeats on the human X chromosome and [GATA]n in the X escape region.

Most of the human genome encodes neither protein nor known functional RNA, yet available approaches to seek meaningful information in the "noncoding" sequence are limited. The unique biology of the X chromosome, one of which is silenced in mammalian females, can yield clues into sequence motifs involved in chromosome packaging and function. Although autosomal chromatin has some capacity for inactivation, evidence indicates that sequences enriched on the X chromosome render it fully competent for silencing, except in specific regions that escape inactivation. Here we have used a linguistic approach by analyzing the frequency and distribution of nine base-pair genomic "words" throughout the human genome. Results identify previously unknown sequence differences on the human X chromosome. Notably, the dinucleotide repeats [AT]n, [AC]n, and [AG]n are significantly enriched across the X chromosome compared with autosomes. Moreover, a striking enrichment (>10-fold) of [GATA]n is revealed throughout the 10-Mb segment at Xp22 that escapes inactivation, and is confirmed by fluorescence in situ hybridization. A similar enrichment is found in other eutherian genomes. Our findings clearly demonstrate sequence differences relevant to the novel biology and evolution of the X chromosome. Furthermore, they implicate simple sequence repeats, linked to gene regulation and unusual DNA structures, in the regulation and formation of facultative heterochromatin. Results suggest a new paradigm whereby a regional escape from X inactivation is due to the presence of elements that prevent heterochromatinization, rather than the lack of other elements that promote it.

Chromosome Mapping↗

PubMed2003

Microsatellite instability and mutations in DNA mismatch repair genes in sporadic colorectal cancers.

PURPOSE: This study was designed to investigate the frequency of mutations in DNA mismatch repair genes in sporadic colorectal cancers. METHODS: Genomic DNAs procured from paraffin blocks of the pathologic specimens from 230 consecutive patients with colorectal cancer were examined for their microsatellite instability status using a mononucleotide microsatellite marker, BAT-26, and also evaluated expressions of hMLH1, hMSH2, and hMSH6 proteins by immunohistochemical staining. Any of these 230 patients did not have family histories of hereditary nonpolyposis colorectal cancer, familial adenomatous polyposis, colorectal cancer, or hereditary nonpolyposis colorectal-related cancers, such as endometrial, small bowel, and ureteral and renal pelvic cancers. When microsatellite instability was positive, mutations in the simple repeated sequences of TGF-betaRII, BAX, IGF IIR, hMSH3, and hMSH6 genes were examined. In microsatellite instability-positive or staining-negative cases, polymerase chain reaction-single-strand conformation polymorphism and DNA sequencing detected mutations of hMLH1, hMSH2, and hMSH6 genes. If mutations were found in tumor tissue samples, we tested for a germline mutation with a microdissected corresponding normal tissue. RESULTS: Among 230 cases of sporadic colorectal cancer, 21 (9.1 percent) manifested microsatellite instability. In the immunohistochemical staining, 20 (8.6 percent) showed loss of expressions. All 20 staining-negative cases were microsatellite instability-positive. Only 1 of 21 (4.8 percent) microsatellite instability-positive cases showed intact staining for three proteins. The frame-shift mutations of the simple repetitive sequences were found in 17 cases (81.0 percent) in TGF-betaRII, 11 (52.4 percent) in BAX, 5 (23.8 percent) in IGF IIR, 7 (33.3 percent) in hMSH3, and 8 (38.1 percent) in hMSH6 genes. Germline mutation was observed in only one case, which accounts for 4.8 percent among positive microsatellite instability and 0.4 percent of total patients, and was found in hMSH2. Five somatic mutations (2 in hMLH1, 2 in hMSH2, and 1 in hMSH6) also were found. CONCLUSION: The results indicated that a germline mutation of DNA mismatch repair gene was a rare event in sporadic colorectal cancers.

Base Pair Mismatch↗

PubMedDate not supplied

Microsatellite marker development and analysis in the eastern oyster (Crassostrea virginica): confirmation of null alleles and non-Mendelian segregation ratios.

Eighteen microsatellite markers were developed for the Crassostrea virginica nuclear genome, including di-, tri-, and tetranucleotide microsatellite repeat regions that included perfect, imperfect, and compound repeat sequences. A reference panel with DNA from the parents and four progeny of 10 full-sib families was used for a preliminary confirmation of polymorphism at these loci and indications of null alleles. Null alleles were discovered at three loci; in two instances, primer redesign enabled their amplification. Two to five representative alleles from each locus were sequenced to ensure that the targeted loci were amplifying. The sequence analysis revealed not only variation in the number of simple sequence repeat units, but also polymorphisms in the microsatellite flanking regions. A total of 3626 bp of combined microsatellite flanking region from the 18 loci was examined, revealing indels as well as nucleotide site substitutions. Overall, 16 indels and 146 substitutions were found with an average of 4.5% polymorphism across all loci. Eight markers were tested on the parents and 39-61 progeny from each of four families for examination of allelic inheritance patterns and genotypic ratios. Twenty-six tests of segregation ratios revealed eight significant departures from expected Mendelian ratios, three of which remained significant after correction for multiple tests. Deviations were observed in both the directions of heterozygote excess and deficiency.

Alleles↗

PubMed1994

Exchange kinetics of individual amide protons in 15N-labeled helical peptides measured by isotope-edited NMR.

Amide proton exchange measured by one-dimensional 15N-edited proton NMR has been used to probe helical structure in an alanine-based peptide. This study is the first report of individual peptide NH exchange rates determined in a simple, repeating sequence peptide whose helical structure can be predicted by helix-coil theory. Measured protection factors directly demonstrate that the ends of the helix are frayed. The protection factors are compared to the Lifson-Roig theory, modified to include N-capping, using known values for helix propensities and N-cap propensities. Base-catalyzed exchange rates are shown to measure the extent of hydrogen bonding of the peptide NHs, and the results are fitted by a simple model in which hydrogen bonding of the peptide NH group provides protection and no exchange occurs from the hydrogen-bonded state. Protection from acid-catalyzed exchange correlates with hydrogen bonding by both the NH and CO groups of a peptide unit: the data are fitted by a model in which exchange occurs only when both hydrogen bonds formed by a peptide unit are broken. This result indicates that acid-catalyzed exchange occurs by the O-protonation mechanism, in agreement with earlier work [Perrin & Arrhenius (1982) J. Am. Chem. Soc. 104, 6693-6696; Perrin et al. (1984) J. Am. Chem. Soc. 106, 2749-2753; Tüchsen & Woodward (1985) J. Mol. Biol. 185, 421-430].

Amides↗