SEARCH · PubMed Health

Results for “simple sequence repeat”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 397 records · Page 22Linked to original sources

PubMed2004

In silico mapping of quantitative trait loci in maize.

Quantitative trait loci (QTL) are most often detected through designed mapping experiments. An alternative approach is in silico mapping, whereby genes are detected using existing phenotypic and genomic databases. We explored the usefulness of in silico mapping via a mixed-model approach in maize (Zea mays L.). Specifically, our objective was to determine if the procedure gave results that were repeatable across populations. Multilocation data were obtained from the 1995-2002 hybrid testing program of Limagrain Genetics in Europe. Nine heterotic patterns comprised 22,774 single crosses. These single crosses were made from 1,266 inbreds that had data for 96 simple sequence repeat (SSR) markers. By a mixed-model approach, we estimated the general combining ability effects associated with marker alleles in each heterotic pattern. The numbers of marker loci with significant effects--37 for plant height, 24 for smut [Ustilago maydis (DC.) Cda.] resistance, and 44 for grain moisture--were consistent with previous results from designed mapping experiments. Each trait had many loci with small effects and few loci with large effects. For smut resistance, a marker in bin 8.05 on chromosome 8 had a significant effect in seven (out of a maximum of 18) instances. For this major QTL, the maximum effect of an allele substitution ranged from 5.4% to 41.9%, with an average of 22.0%. We conclude that in silico mapping via a mixed-model approach can detect associations that are repeatable across different populations. We speculate that in silico mapping will be more useful for gene discovery than for selection in plant breeding programs.

Analysis of Variance↗

PubMed2006

Defining the sunflower (Helianthus annuus L.) linkage group ends with the Arabidopsis-type telomere sequence repeat-derived markers.

The target region amplification polymorphism (TRAP) marker technique was employed to define sunflower (Helianthus annuus L.) linkage group ends. In combination with eight arbitrary primers, nine fixed primers containing the Arabidopsis-type telomere repeat sequences worked successfully in generating polymorphic markers in the mapping population of 92 F(7) recombinant inbred lines (RIL) derived from the cross RHA 280 x RHA 801. This population was used in the construction of the densest sunflower linkage map of 577 simple sequence repeat (SSR) markers. With 18 sets of PCR reactions, 226 polymorphic TRAP markers were amplified from the two parental lines and 92 RIL. The computer program, Mapmaker, placed 183 markers into the established 17 linkage groups of the SSR map. Although most of the added markers spread across the genome, 32 markers were mapped to the outermost positions of the linkage groups, defining 21 of the 34 linkage group ends of the sunflower linkage map. The telomeric origin of a few of these markers was confirmed by sequence analyses. These telomere-associated markers will provide an accurate assessment of the completeness of a linkage group and a better estimate of the actual genetic lengths. The potential application of the telomere mapping to sunflower improvement is discussed.

Arabidopsis↗

PubMed1990

Towards construction of a high resolution map of the mouse genome using PCR-analysed microsatellites.

Fifty sequences from the mouse genome database containing simple sequence repeats or microsatellites have been analysed for size variation using the polymerase chain reaction and gel electrophoresis. 88% of the sequences, most of which contain the dinucleotide repeat, CA/GT, showed size variations between different inbred strains of mice and the wild mouse, Mus spretus. 62% of sequences had 3 or more alleles. GA/CT and AT/TA-containing sequences were also variable. About half of these size variants were detectable by agarose gel electrophoresis. This simple approach is extremely useful in linkage and genome mapping studies and will facilitate construction of high resolution maps of both the mouse and human genomes.

Animals↗

PubMed2005

Destabilization of tetranucleotide repeats in Haemophilus influenzae mutants lacking RnaseHI or the Klenow domain of PolI.

A feature of Haemophilus influenzae genomes is the presence of several loci containing tracts of six or more identical tetranucleotide repeat units. These repeat tracts are unstable and mediate high frequency, reversible alterations in the expression of surface antigens. This process, termed phase variation (PV), enables H.influenzae to rapidly adapt to fluctuations in the host environment. Perturbation of lagging strand DNA synthesis is known to destabilize simple sequence repeats in yeast and Escherichia coli. By using a chromosomally located reporter construct, we demonstrated that the mutation of an H.influenzae rnhA (encoding RnaseHI) homologue increases the mutation rates of tetranucleotide repeats approximately 3-fold. Additionally, deletion of the Klenow domain of DNA polymerase I (PolI) resulted in a approximately 35-fold increase in tetranucleotide repeat-mediated PV rates. Deletion of the PolI 5'>3' exonuclease domain appears to be lethal. The phenotypes of these mutants suggest that delayed or mutagenic Okazaki fragment processing destabilizes H.influenzae tetranucleotide repeat tracts.

Cell Proliferation↗

PubMed2006

Exact word matches in rice pseudomolecules.

Using pseudomolecules of assembled genomic sequence, we computed the frequencies of 6 to 24 bp oligonucleotide (oligo) "words" across the genome of rice (Oryza sativa L. subsp. japonica). All oligos of 10 or fewer basepairs were repeated at least 12 times in the genome. The percentage of unique (non-repeated) oligos ranged from 0.1% for 12 bp oligos to 76.0% for 24 bp oligos. For three 200 kb regions, we annotated each nucleotide position with the genome-wide frequency of the 18 bp oligo starting at that position. These frequencies formed landscapes consisting of high- and low-frequency zones. Low-frequency zones contained occasional high-frequency spikes; these may represent footprints of RIM2 transposon activity. BLASTn searches of high-frequency non-SSR (simple sequence repeat) 18 bp oligos returned few sequences from species other than rice. These results demonstrate that, in rice, words are not randomly used between different regions within the same genome, and indicate that words that are frequently repeated within the rice genome tend to be unique to rice.

Base Sequence↗

PubMed2006

(CA)n microsatellite polymorphism of ERBB-1 in breast cancer.

The aim of this study was to determine polymorphism of repeated sequences (CA)(n) in the ERBB-1 gene. The study group included 197 breast cancer patients and 180 healthy women. DNA was isolated from fresh-frozen tumour tissue and from peripheral blood. ERBB-1 (CA)(n) microsatellite polymorphism was examined by polymerase chain reaction (PCR). A polymorphic simple sequence repeat region of 9-23 CA repeats was detected in both groups. Homozygotes comprised 22% and 34% of breast cancer patients and controls, respectively (P=0.009). An allelic imbalance (AI), mostly in the shorter allele, was found in 27% of breast cancer patients. AI occurrence was associated with the lack of oestrogen receptors in tumour cells (P=0.05); otherwise, there were no correlations between histoclinical features and (CA)(n) microsatellite polymorphism of ERBB-1. It was concluded that an allelic imbalance is a common feature in breast cancer patients and may coincide with the lack of oestrogen receptors in tumour cells. The clinical relevance of ERBB-1 microsatellite polymorphism in breast cancer remains to be established.

Allelic Imbalance↗

PubMed2001

Polymorphism of PCR-based markers targeting exons, introns, promoter regions, and SSRs in maize and introns and repeat sequences in oat.

Sequence databases could be efficiently exploited for development of DNA markers if it were known which gene regions reveal the most polymorphism when amplified by PCR. We developed PCR primer pairs that target specific regions of previously sequenced genes from Avena and Zea species. Primers were targeted to amplify 40 introns, 24 exons, and 23 promoter regions within 54 maize genes. We surveyed 48 maize inbred lines (previously assayed for simple-sequence repeat (SSR) polymorphism) for amplification-product polymorphism. We also developed primers to target 14 SSRs and 12 introns within 18 Avena genes, and surveyed 22 hexaploid oat cultivars and 2 diploid Avena species for amplification-product polymorphism. In maize, 67% of promoter markers, 58% of intron markers, and 13% of exon markers exhibited amplification-product polymorphisms. Among polymorphic primer pairs in maize, genotype diversity was highest for SSR markers (0.60) followed by intron markers (0.46), exon markers (0.42), and promoter markers (0.28). Among all Avena genotypes, 64% of SSR markers and 58% of intron markers revealed polymorphisms, but among the cultivars only, 21% of SSR markers and 50% of intron markers were polymorphic. Polymorphic-sequence-tagged sites for plant-breeding applications can be created easily by targeting noncoding gene regions.

Avena↗

PubMed2004

Involvement of genes of genome maintenance in the regulation of phase variation frequencies in Neisseria meningitidis.

In Neisseria meningitidis, the reversible expression of surface antigens, i.e. phase variation, results from changes within repeated simple sequence motifs located in coding or promoter regions of the genes involved in their biosynthesis. The mutation rates of these simple sequences, which have a major influence on the generation of phenotypic diversity, can affect the fitness of the population. The aim of the present study was to investigate the involvement of genetic factors involved (mutS and dam) and not yet analysed (drg and dinB) in the regulation of phase variation frequencies of genes associated with a variety of repeat tracts. The frequency of frameshifts occurring in the polycytidine (polyC) tracts associated with siaD, spr and lgtG and in the tetranucleotide (TAAA) repeat tract associated with nadA was determined by colony immunoblotting or using the lacZ gene as a reporter. Inactivation of mutS increased the frequency of phase variation of genes presenting homopolymeric tracts of diverse length. Overexpression of dinB enhanced the instability of the homopolymeric tract associated with siaD. Investigation of the dam locus in a population of genetically distinct N. meningitidis strains revealed that 27 % of strains associated with invasive disease contained the dam gene. In all strains where a Dam function was absent, the drg gene had been inserted into the dam locus. Disruption of dam and drg in strains representative of each genotype, i.e. dam(+)/drg and dam/drg(+), did not modify phase variation frequencies. In contrast to the effects of certain genes on homopolymeric tracts, none of the genetic factors investigated affected the stability of tetranucleotide repeat tracts.

Adenosine Triphosphatases↗

PubMed1992

PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains.

Eighty sequences from the mouse genome database containing microsatellites (simple sequence repeats) have been analyzed for size variation among ten different inbred strains of mice; 62/80 (77.5%) showed polymorphism of at least three alleles. We have been able to detect all the polymorphisms by agarose gel electrophoresis, often running the gels for up to 3 h. Between individual pairs of mouse strains to be used in chromosomal mapping studies in our laboratory, 35-60% polymorphism occurred. There are potentially enough microsatellites within the mouse and human genome to have a marker at every 1-cM distance. This simple approach will, therefore, continue to be useful in genome mapping studies, leading eventually to high-resolution maps of both the mouse and human genomes; this should allow for physical mapping and cloning of specific genes.

Animals↗

PubMed1999

Isolation and characterization of polymorphic microsatellites in Cocos nucifera L.

Microsatellites or simple sequence repeats (SSRs) were isolated from coconut (Cocos nucifera) and tested for polymorphism on restricted germplasm. Sequencing of 197 clones from a cv. Tagnanan Tall-enriched genomic library showed that 75% contained a microsatellite, of which 64% were dinucleotide (GA/CT, CA/GT and GC/CG), 6% were trinucleotide, and 30% were compound repeats. Of 41 primer pairs tested on Tagnanan Tall genomic DNA, 38 gave the expected size product, two amplified two loci, and another gave a multilocus pattern. On 20 coconut samples, the 38 SSRs detected 198 alleles (average: 5.2 alleles per microsatellite). Genetic diversity (D = 1 - sigma pi2) values ranged from 0.141 to 0.809. Heterozygotes were present at high frequencies among some dwarf samples. Analysis of similarity matrices based either on shared alleles at each locus (simple matching coefficient) or on allele bands across all loci (Jaccard coefficient) showed similar results. Dwarfs grouped separately from talls and showed less genetic diversity. In a wider test on 40 samples, 8 SSRs detected 64 alleles (average: eight alleles per microsatellite). These results indicate the high potential of microsatellites to detect genetic diversity in coconut germplasm.

Cocos↗

PubMed2000

Phylogenetic information in inter-SINE and inter-SSR fingerprints of the artiodactyla and evolution of the bov-tA SINE.

Various interspersed repeated sequences and elements (IRSs) can be utilized to generate PCR-based multilocus fingerprint profiles by amplifying the interelement segments, using primers matching the elements themselves. We assessed the utility of inter-IRS fingerprinting in phylogenetic comparisons among six artiodactyl species using several primers derived from two abundant genomic components: the Bov-tA short interspersed nuclear elements (SINEs) and simple sequence repeats or microsatellites (SSRs). Character- and distance-based analyses of the fingerprint data produced trees conforming to the established phylogenetic relationships of species. The strength of phylogenetic signal from different primers varied; combining data from different experiments resulted in robust trees. Within the Cervidae, the hierarchical relationship [(Odocoileus, Rangifer) Alces] was strongly supported. Both methods appear useful tools for systematic studies at time scales <30 Myr. To elucidate the material basis of inter-SINE fingerprints, we obtained the first sequences of the 'bovid' Bov-tA element also from two cervids (reindeer and white-tailed deer) and analysed their relationship to a number of paralogous bovid elements. The differences among sequences, both intra- and interspecific, were relatively high (mean 18.5%); the sequences showed no clear clustering with the species from which they had been isolated. Most individual elements probably date back to the cervid-bovid ancestor >25 Myr ago, which is in line with the observed fingerprint distributions.

Animals↗

PubMed2001

Differentiation of industrial wine yeast strains using microsatellite markers.

AIMS: To differentiate nine industrial wine strains of Saccharomyces cerevisiae using microsatellite (simple sequence repeats, SSR) markers. METHODS AND RESULTS: Six of the strains were indigenous yeasts currently used as high-density starter monocultures by the Uruguayan wine industry. Unequivocal differentiation of these six native strains and three commercial S. cerevisiae wine strains was achieved by PCR amplification and polymorphism analysis of loci containing microsatellite markers. CONCLUSION: We recommend the use of this reproducible and simple molecular method to routinely discriminate wine yeast strains. SIGNIFICANCE AND IMPACT OF THE STUDY: Microsatellites are superior to other methods for typing yeasts because the results can be exchanged as quantitative data. Knowledge of the frequencies of the alleles for different SSR markers will eventually lead to an accurate typing method to identify industrial wine yeast strains.

Alleles↗

PubMed2005

Microsatellite instability regulates transcription factor binding and gene expression.

Microsatellites are tandemly repeated simple sequence DNA motifs widely prevalent in eukaryotic and prokaryotic genomes. In pathogenic bacteria, instability of these hypermutable loci through slipped-strand mispairing mediates the high-frequency reversible switching of phenotype expression, i.e., phase variation. Phase-variable expression of NadA, an outer membrane protein and adhesin of the pathogen Neisseria meningitidis, is mediated by changes in the number of TAAA repeats located upstream of the core promoter of nadA. Here we report that loss or gain of TAAA repeats affects the binding of the transcriptional regulatory protein IHF to the nadA promoter. Thus, phase-variable transcription of nadA potentially incorporates interplay between stochastic (mutational) and prescriptive (classical) mechanisms of gene regulation.

Amino Acid Sequence↗

PubMed1990

Intramolecular DNA triplexes, bent DNA and DNA unwinding elements in the initiation region of an amplified dihydrofolate reductase replicon.

The nucleotide sequence of 6.2 kb (1 kb = 10(3) base-pairs) of DNA that encompasses the earliest replicating portion of the amplified dihydrofolate reductase domains of CHOC 400 cells has been determined. Origin region DNA contains two AluI family repeats, a novel repetitive element (termed ORR-1), a TGGGT-rich region, and several homopurine/homopyrimidine and alternating purine/pyrimidine tracts, including an unusual cluster of simple repeating sequences composed of (G-C)5, (A-C)18, (A-G)21, (G)9, (CAGA)4, GAGGGAGAGAGGCAGAGAGGG, (A-G)27. Recombinant plasmids containing origin region sequences were examined for DNA structural conformations previously implicated in origin activation. Mung bean nuclease sensitivity assays for DNA unwinding elements show the preferred order of nuclease cleavage at neutral pH in supercoiled origin plasmids to be: (A-T)23 much greater than the (A-G) cluster much greater than (A)38 much greater than vector = (AATT)n. At acid pH, the hierarchy of cleavage preferences changes to: the (A-G) cluster much greater than (A-T)23 much greater than (AATT)n greater than vector = (A)38. A region of stably bent DNA was identified and shown not to be reactive in the mung bean nuclease unwinding assay at either acid or neutral pH. Intermolecular hybridization studies show that, in the presence of torsional stress at pH 5.2, the (A-G) cluster forms triple-stranded DNA. These results show that the origin region of an amplified chromosomal replicon contains a novel repetitive element and multiple sequence elements that facilitate DNA bending, DNA unwinding and the formation of intramolecular triple-stranded DNA.

Animals↗

PubMed2004

Chemically induced increases and decreases in the rate of expansion of a CAG*CTG triplet repeat.

Somatic mosaicism of repeat length is prominent in repeat expansion disorders such as Huntington disease and myotonic dystrophy. Somatic mosaicism is age-dependent, tissue-specific and expansion-biased, and likely contributes toward the tissue-specificity and progressive nature of the symptoms. We propose that therapies targeted at somatic repeat expansion may have general utility in these disorders. Specifically, suppression of somatic expansion would be expected to be therapeutic, whilst reversion of the expanded mutant repeat to within the normal range would be predicted to be curative. However, the effects of genotoxic agents on the mutational properties of specific nuclear genes are notoriously difficult to define. Nonetheless, we have determined that chronic exposure over a three month period to a number of genotoxic agents can alter the rate of triplet repeat expansion in whole populations of mammalian cells. Interestingly, high doses of caffeine increased the rate of expansion by approximately 60%. More importantly, cytosine arabinoside, ethidium bromide, 5-azacytidine and aspirin all significantly reduced the rate of expansion by from 35 to 75%. These data establish that drug induced suppression of somatic expansion is possible. These data also suggest that highly unstable expanded simple sequence repeats may act as sensitive reporters of genotoxic assault in the soma.

Animals↗

PubMed1999

Genetic determinants of plasma ACE and renin activity in young normotensive twins.

OBJECTIVE: We investigated the determinants of plasma renin activity (PRA) and plasma levels of angiotensin-converting enzyme (pACE), including the effect of the D/I polymorphism of the angiotensin-converting enzyme (ACE) gene, in monozygotic (MZ) and dizygotic (DZ) twins. METHODS: Sixty-nine pairs of twins underwent measurements of blood pressure, pACE and ACE D/I genotyping. In addition, in 30 pairs ambulatory blood pressure (ABP) monitoring was carried out. To ascertain twin's zygosity, some highly discriminating variable number of tandem repeats micro- and mini-satellite systems were analysed by polymerase chain reaction (PCR) followed by polyacrylamide gel electrophoresis and silver staining. The D/I polymorphism was assessed by PCR; pACE was measured in triplicate with a colorimetric assay, and PRA by a commercial kit. In DZ twins, identity by descent of the D/I alleles was examined by PCR amplification of a highly polymorphic simple sequence repeat at the human growth hormone gene. RESULTS: pACE levels were significantly (P < 0.01) higher in DD (9.27 +/- 2.60 IU/l, mean +/-SD) than in II (6.68 +/- 3.0), with DI having intermediate levels (7.93 +/- 2.7). No difference of PRA between different D/I genotypes was found. Twin data analysis showed a statistically significant heritability of pACE, but not of PRA. No differences between MZ and DZ twins in PRA, pACE and the relationship of the D/I genotype with pACE was found. Besides showing that the D/I genotype was the most important predictor of pACE, a multivariate analysis demonstrated that identity by descent of the D/I allele, as assessed by growth hormone (GH) genotyping, also significantly affected pACE. CONCLUSIONS: In this study of normotensive twins, pACE and not PRA showed significant heritability, the former being tightly associated with the D/I ACE gene polymorphism, and/or with a quantitative trait locus in linkage disequilibrium with it.

Adult↗

PubMed1998

A detailed linkage map of rainbow trout produced using doubled haploids.

We report the first detailed genetic linkage map of rainbow trout (Oncorhynchus mykiss). The segregation analysis was performed using 76 doubled haploid rainbow trout produced by androgenesis from a hybrid between the "OSU" and "Arlee" androgenetically derived homozygous lines. Four hundred and seventy-six markers segregated into 31 major linkage groups and 11 small groups (< 5 markers/group). The minimum genome size is estimated to be 2627.5 cM in length. The sex-determining locus segregated to a distal position on one of the linkage groups. We analyzed the chromosomal distribution of three classes of markers: (1) amplified fragment length polymorphisms, (2) variable number of tandem repeats, and (3) markers obtained using probes homologous to the 5' or 3' end of salmonid-specific small interspersed nuclear elements. Many of the first class of markers were clustered in regions that appear to correspond to centromeres. The second class of markers were more telomeric in distribution, and the third class were intermediate. Tetrasomic inheritance, apparently related to the tetraploid ancestry of salmonid fishes, was detected at one simple sequence repeat locus and suggested by the presence of one extremely large linkage group that appeared to consist of two smaller groups linked at their tips. The double haploid rainbow trout lines and linkage map present a foundation for further genomic studies.

Animals↗

PubMed2006

Word frequency analysis reveals enrichment of dinucleotide repeats on the human X chromosome and [GATA]n in the X escape region.

Most of the human genome encodes neither protein nor known functional RNA, yet available approaches to seek meaningful information in the "noncoding" sequence are limited. The unique biology of the X chromosome, one of which is silenced in mammalian females, can yield clues into sequence motifs involved in chromosome packaging and function. Although autosomal chromatin has some capacity for inactivation, evidence indicates that sequences enriched on the X chromosome render it fully competent for silencing, except in specific regions that escape inactivation. Here we have used a linguistic approach by analyzing the frequency and distribution of nine base-pair genomic "words" throughout the human genome. Results identify previously unknown sequence differences on the human X chromosome. Notably, the dinucleotide repeats [AT]n, [AC]n, and [AG]n are significantly enriched across the X chromosome compared with autosomes. Moreover, a striking enrichment (>10-fold) of [GATA]n is revealed throughout the 10-Mb segment at Xp22 that escapes inactivation, and is confirmed by fluorescence in situ hybridization. A similar enrichment is found in other eutherian genomes. Our findings clearly demonstrate sequence differences relevant to the novel biology and evolution of the X chromosome. Furthermore, they implicate simple sequence repeats, linked to gene regulation and unusual DNA structures, in the regulation and formation of facultative heterochromatin. Results suggest a new paradigm whereby a regional escape from X inactivation is due to the presence of elements that prevent heterochromatinization, rather than the lack of other elements that promote it.

Chromosome Mapping↗