SEARCH · PubMed Health

Results for “GIBBERELLINS”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 415 records · Page 23Linked to original sources

PubMed2001

Distinct cell-specific expression patterns of early and late gibberellin biosynthetic genes during Arabidopsis seed germination.

Gibberellins (GAs) are biosynthesized through a complex pathway that involves several classes of enzymes. To predict sites of individual GA biosynthetic steps, we studied cell type-specific expression of genes encoding early and late GA biosynthetic enzymes in germinating Arabidopsis seeds. We showed that expression of two genes, AtGA3ox1 and AtGA3ox2, encoding GA 3-oxidase, which catalyzes the terminal biosynthetic step, was mainly localized in the cortex and endodermis of embryo axes in germinating seeds. Because another GA biosynthetic gene, AtKO1, coding for ent-kaurene oxidase, exhibited a similar cell-specific expression pattern, we predicted that the synthesis of bioactive GAs from ent-kaurene oxidation occurs in the same cell types during seed germination. We also showed that the cortical cells expand during germination, suggesting a spatial correlation between GA production and response. However, promoter activity of the AtCPS1 gene, responsible for the first committed step in GA biosynthesis, was detected exclusively in the embryo provasculature in germinating seeds. When the AtCPS1 cDNA was expressed only in the cortex and endodermis of non-germinating ga1-3 seeds (deficient in AtCPS1) using the AtGA3ox2 promoter, germination was not as resistant to a GA biosynthesis inhibitor as expression in the provasculature. These results suggest that the biosynthesis of GAs during seed germination takes place in two separate locations with the early step occurring in the provasculature and the later steps in the cortex and endodermis. This implies that intercellular transport of an intermediate of the GA biosynthetic pathway is required to produce bioactive GAs.

Arabidopsis↗

PubMed2003

Two cis-acting elements necessary and sufficient for gibberellin-upregulated proteinase expression in rice seeds.

In germinating rice seeds, a cysteine proteinase (REP-1), synthesized in aleurone-layer cells, is a key enzyme in the degradation of the major storage protein, glutelin. The expression of the gene for REP-1 (Rep1) is induced by gibberellins (GAs) and repressed by abscisic acid (ABA). To identify GA-responsive elements in the Rep1 promoter, we developed a transient expression system in rice aleurone cells. Deletion and point-mutation analyses indicated that the GA-response complex was composed of TAACAGA, TAACGTA, and two copies of CAACTC. The two former sequences were identical to GAREs conserved in the promoter of genes for alpha-amylase and proteinases in cereals. The latter, termed as CAACTC regulatory elements (CAREs), were novel GAREs. Gain-of-function experiments revealed that two pairs of GARE and CARE were necessary and sufficient to confer GA inducibility. The sequences were also required for effective transactivation by the transcription factor OsGAMyb. Four copies of either GARE or CARE showed transactivation neither by OsGAMyb nor by GA induction. CARE and GARE were also found in the promoters of a rice alpha-amylase gene, RAmy1A, and a barley proteinase gene, EPB1, which are expressed in germinating seeds. Mutations of CARE in their promoters caused a loss of GA inducibility and GAMyb transactivation, suggesting that CARE is the regulatory element for GA-inducible expression of hydrolase genes in the germinating seeds.

Base Sequence↗

PubMed2003

The SOC1 MADS-box gene integrates vernalization and gibberellin signals for flowering in Arabidopsis.

The floral transition in Arabidopsis is regulated by at least four flowering pathways: the long-day, autonomous, vernalization, and gibberellin (GA)-dependent pathways. Previously, we reported that the MADS-box transcription factor SUPPRESSOR OF OVEREXPRESSION OF CO 1 (SOC1) integrates the long-day and vernalization/autonomous pathways. Here, we present evidences that SOC1 also integrates signaling from the GA-dependent pathway, a major flowering pathway under non-inductive short days. Under short days, the flowering time of GA-biosynthetic and -signaling mutants was well correlated with the level of SOC1 expression; overexpression of SOC1 rescued the non-flowering phenotype of ga1-3, and the soc1 null mutant showed reduced sensitivity to GA for flowering. In addition, we show that vernalization-induced repression of FLOWERING LOCUS C (FLC), an upstream negative regulator of SOC1, is not sufficient to activate SOC1; positive factors are also required. Under short days, the GA pathway provides a positive factor for SOC1 activation. In contrast to SOC1, the GA pathway does not regulate expression of other flowering integrators FLC and FT. Our results explain why the GA pathway has a strong effect on flowering under short days and how vernalization and GA interact at the molecular level.

Arabidopsis↗

PubMed2004

Ethylene-mediated enhancement of apical hook formation in etiolated Arabidopsis thaliana seedlings is gibberellin dependent.

Dark-grown Arabidopsis seedlings develop an apical hook by differential elongation and division of hypocotyl cells. This allows the curved hypocotyl to gently drag the apex, which is protected by the cotyledons, upwards through the soil. Several plant hormones are known to be involved in hook development, including ethylene, which causes exaggeration of the hook. We show that gibberellins (GAs) are also involved in this process. Inhibition of GA biosynthesis with paclobutrazol (PAC) prevented hook formation in wild-type (WT) seedlings and in constitutive ethylene response (ctr)1-1, a mutant that exhibits a constitutive ethylene response. In addition, a GA-deficient mutant (ga1-3) did not form an apical hook in the presence of the ethylene precursor 1-aminocyclopropane-1-carboxylate (ACC). Analysis of transgenic Arabidopsis seedlings expressing a green fluorescent protein (GFP)-repressor of ga1-3 (RGA) fusion protein suggested that ACC inhibits cell elongation in the apical hook by inhibition of GA signaling. A decreased feedback of GA possibly causes an induction of GA biosynthesis based upon the expression of genes encoding copalyl diphosphate synthase (CPS; GA1) and GA 2-oxidase (AtGA2ox1). Furthermore, expression of GASA1, a GA-response gene, suggests that differential cell elongation in the apical hook might be a result of differential GA-sensitivity.

Amino Acids, Cyclic↗

PubMed2006

Gibberellin biosynthesis and the regulation of plant development.

Gibberellins (GAs) form a large family of plant growth substances with distinct functions during the whole life cycle of higher plants. The rate of GA biosynthesis and catabolism determines how the GA hormone pool occurs in plants in a tissue and developmentally regulated manner. With the availability of genes coding for GA biosynthetic enzymes, our understanding has improved dramatically of how GA plant hormones regulate and integrate a wide range of growth and developmental processes. This review focuses on two plant systems, pumpkin and Arabidopsis, which have added significantly to our understanding of GA biosynthesis and its regulation. In addition, we present models for regulation of GA biosynthesis in transgenic plants, and discuss their suitability for altering plant growth and development.

Arabidopsis↗

PubMed2004

Floral homeotic genes are targets of gibberellin signaling in flower development.

Gibberellins (GAs) are a class of plant hormones involved in the regulation of flower development in Arabidopsis. The GA-deficient ga1-3 mutant shows retarded growth of all floral organs, especially abortive stamen development that results in complete male sterility. Until now, it has not been clear how GA regulates the late-stage development of floral organs after the establishment of their identities within floral meristems. Various combinations of null mutations of DELLA proteins can gradually rescue floral defects in ga1-3. In particular, the synergistic effect of rga-t2 and rgl2-1 can substantially restore flower development in ga1-3. We find that the transcript levels of floral homeotic genes APETALA3 (AP3), PISTILLATA (PI), and AGAMOUS (AG) are immediately upregulated in young flowers of ga1-3 upon GA treatment. Using a steroid-inducible activation of RGA, we further demonstrated that these floral homeotic genes are transcriptionally repressed by RGA activity in young flowers whereas the expression of LEAFY (LFY) and APETALA1 (AP1) is not substantially affected. In addition, we observed the partial rescue of floral defects in ga1-3 by overexpression of AG. Our results indicate that GA promotes the expression of floral homeotic genes by antagonizing the effects of DELLA proteins, thereby allowing continued flower development.

Arabidopsis↗

PubMed2004

Recessive-interfering mutations in the gibberellin signaling gene SLEEPY1 are rescued by overexpression of its homologue, SNEEZY.

This article reports the genetic interaction of two F-box genes, SLEEPY1 (SLY1) and SNEEZY (SNE), in Arabidopsis thaliana gibberellin (GA) signaling. The SLY1 gene encodes an F-box subunit of a Skp1-cullin-F-box (SCF) E3 ubiquitin ligase complex that positively regulates GA signaling. The sly1-2 and sly1-10 mutants have recessive, GA-insensitive phenotypes including delayed germination, dwarfism, reduced fertility, and overaccumulation of the DELLA proteins RGA (Repressor of ga1-3), GAI (GA-Insensitive), and RGL2 (RGA-Like 2). The DELLA domain proteins are putative transcription factors that negatively regulate GA signaling. The requirement for SLY1 in GA-stimulated disappearance of DELLA proteins suggests that GA targets DELLA proteins for destruction via SCF(SLY1)-mediated ubiquitylation. Overexpression of SLY1 in sly1-2 and sly1-10 plants rescues the recessive GA-insensitive phenotype of these mutants. Surprisingly, antisense expression of SLY1 also suppresses these mutants. This result caused us to hypothesize that the SLY1 homologue SNE can functionally replace SLY1 in the absence of the recessive interfering sly1-2 or sly1-10 genes. This hypothesis was supported because overexpression of SNE in sly1-10 rescues the dwarf phenotype. In addition to rescuing the sly1-10 dwarf phenotype, SNE overexpression also restored normal RGA protein levels, suggesting that the SNE F-box protein can replace SLY1 in the GA-induced proteolysis of RGA. If the C-terminal truncation in the sly1-2 and sly1-10 alleles interferes with SNE rescue, we reasoned that overexpression of sly1-2 might interfere with wild-type SLY1 function. Indeed, overexpression of sly1-2 in wild-type Ler (Landsberg erecta) yields dwarf plants.

Alkyl and Aryl Transferases↗

PubMed2001

The P450-1 gene of Gibberella fujikuroi encodes a multifunctional enzyme in gibberellin biosynthesis.

Recent studies have shown that the genes of the gibberellin (GA) biosynthesis pathway in the fungus Gibberella fujikuroi are organized in a cluster of at least seven genes. P450-1 is one of four cytochrome P450 monooxygenase genes in this cluster. Disruption of the P450-1 gene in the GA-producing wild-type strain IMI 58289 led to total loss of GA production. Analysis of the P450-1-disrupted mutants indicated that GA biosynthesis was blocked immediately after ent-kaurenoic acid. The function of the P450-1 gene product was investigated further by inserting the gene into mutants of G. fujikuroi that lack the entire GA gene cluster; the gene was highly expressed under GA production conditions in the absence of the other GA-biosynthesis genes. Cultures of transformants containing P450-1 converted ent-[(14)C]kaurenoic acid efficiently into [(14)C]GA(14), indicating that P450-1 catalyzes four sequential steps in the GA-biosynthetic pathway: 7beta-hydroxylation, contraction of ring B by oxidation at C-6, 3beta-hydroxylation, and oxidation at C-7. The GA precursors ent-7alpha-hydroxy[(14)C]kaurenoic acid, [(14)C]GA(12)-aldehyde, and [(14)C]GA(12) were also converted to [(14)C]GA(14). In addition, there is an indication that P450-1 may also be involved in the formation of the kaurenolides and fujenoic acids, which are by-products of GA biosynthesis in G. fujikuroi. Thus, P450-1 displays remarkable multifunctionality and may be responsible for the formation of 12 products.

Base Sequence↗

PubMed2001

The DELLA motif is essential for gibberellin-induced degradation of RGA.

RGA and GAI are homologous genes that encode putative transcriptional regulators that repress gibberellin (GA) signaling in Arabidopsis. Previously we showed that the green fluorescent protein (GFP)-RGA fusion protein is localized to the nucleus in transgenic Arabidopsis, and expression of this fusion protein rescues the rga null mutation. The GA signal seems to derepress the GA response pathway by degrading the repressor protein RGA. The GA-insensitive, semidominant, semidwarf gai-1 mutant encodes a mutant protein with a 17-amino acid deletion within the DELLA domain of GAI. It was hypothesized that this mutation turns the gai protein into a constitutive repressor of GA signaling. Because the sequences missing in gai-1 are identical between GAI and RGA, we tested whether an identical mutation (rga-Delta 17) in the RGA gene would confer a phenotype similar to gai-1. We demonstrated that expression of rga-Delta 17 or GFP-(rga-Delta 17) under the control of the RGA promoter caused a GA-unresponsive severe dwarf phenotype in transgenic Arabidopsis. Analysis of the mRNA levels of a GA biosynthetic gene, GA4, showed that the feedback control of GA biosynthesis in these transgenic plants was less responsive to GA than that in wild type. Immunoblot and confocal microscopy analyses indicated that rga-Delta17 and GFP-(rga-Delta 17) proteins were resistant to degradation after GA application. Our results illustrate that the DELLA domain in RGA plays a regulatory role in GA-induced degradation of RGA. Deletion of this region stabilizes the rga-Delta 17 mutant protein, and regardless of the endogenous GA status rga-Delta 17 becomes a constitutively active repressor of GA signaling.

Amino Acid Motifs↗

PubMed1990

Endogenous gibberellins in Arabidopsis thaliana and possible steps blocked in the biosynthetic pathways of the semidwarf ga4 and ga5 mutants.

Twenty gibberellins (GAs) have been identified in extracts from shoots of the Landsberg erecta line of Arabidopsis thaliana by full-scan gas chromatography-mass spectrometry and Kovats retention indices. Eight of them are members of the early-13-hydroxylation pathway (GA53, GA44, GA19, GA17, GA20, GA1, GA29, and GA8), six are members of the early-3-hydroxylation pathway (GA37, GA27, GA36, GA13, GA4, and GA34), and the remaining six are members of the non-3,13-hydroxylation pathway (GA12, GA15, GA24, GA25, GA9, and GA51). Seven of these GAs were quantified in the Landsberg erecta line of Arabidopsis and in the semidwarf ga4 and ga5 mutants by gas chromatography-selected ion monitoring (SIM) using internal standards. The relative levels of the remaining 13 GAs were compared by the use of ion intensities only. In comparison with the Landsberg erecta line, the ga4 mutant had reduced levels of the 3-hydroxy- and 3,13-dihydroxy-GAs, and it accumulated the 13-hydroxy-GAs, except GA53, and the non-3,13-hydroxy-GAs, except GA12. The GA4 gene encodes, therefore, a protein with 3 beta-hydroxylation activity. The ga5 mutant had reduced levels of the C19-GAs, which indicates that the product of the GA5 gene catalyzes the elimination of C-20 at the aldehyde level. The ga5 mutant also had increased levels of certain C20-GAs, which indicates existence of an additional control, possibly hydroxylation of C-20. The growth-response data, as well as the accumulation of GA9 in the ga4 mutant, indicate that GA9 is not active in Arabidopsis, but it must be 3 beta-hydroxylated to GA4 to become bioactive. It is concluded that the reduced levels of the 3 beta-hydroxy-GAs, GA1 and GA4, are the cause of the semidwarf growth habit of both mutants.

Chromatography, High Pressure Liquid↗

PubMed1991

cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid.

We have used a transient expression assay in aleurone protoplasts of barley to delineate hormone response elements of the abscisic acid (ABA)-responsive rice gene Rab16A and of the gibberellin A3 (GA3)-responsive barley alpha-amylase gene Amy 1/6-4. Our approach used transcriptional fusions between their 5' upstream sequences and a bacterial chloramphenicol acetyltransferase reporter gene. A chimeric promoter containing six copies of the -181 to -171 region of Rab 16A fused to a minimal promoter conferred ABA-responsive expression on the reporter gene. Transcription from this ABA response element (GTACGTGGCGC) was unaffected by GA3. A chimeric promoter containing six copies of the -148 to -128 sequence of Amy 1/6-4 fused to the minimal promoter conferred GA3-responsive expression on the reporter gene. Transcription from this GA3 response element (GGCCGATAACAAACTCCGGCC) was repressed by ABA. The effect on transcription from both hormone response elements was orientation-independent, indicating that they function as inducible enhancers in their native genes.

Abscisic Acid↗

PubMed1992

Hydrolysis and reconjugation of gibberellin A20 glucosyl ester by seedlings of Zea mays L.

The [6-2H]glucosyl ester of [17-13C,3H]gibberellin A20 (GA20) was injected into light-grown 14-day-old seedlings of normal, dwarf-1, and dwarf-5 maize (Zea mays L.). The plant material was extracted 24 h later, and the extracts were purified by solvent partitioning, column chromatography, and HPLC. 13C-labeled metabolites were identified from the purified extracts by full-scan gas chromatography/mass spectrometry and selected ion current monitoring in conjunction with Kovats retention indices. The metabolites, [13C]GA20, [13C]GA29, [13C]GA20-13-O-glucoside, and [13C]GA29-2-O-glucoside, were identified from normal, dwarf-1, and dwarf-5 seedlings. [13C]GA8 and [13C]GA8-2-O-glucoside were also identified from normal and dwarf-5 seedlings but not from dwarf-1 seedlings. The data provide definitive evidence for the endogenous hydrolysis by the seedlings of the introduced conjugate and its reconjugation to three glucosides.

Esters↗

PubMed1997

Expression of an ortholog of replication protein A1 (RPA1) is induced by gibberellin in deepwater rice.

Internodes of deepwater rice are induced to grow rapidly when plants become submerged. This adaptation enables deepwater rice to keep part of its foliage above the rising flood waters during the monsoon season and to avoid drowning. This growth response is, ultimately, elicited by the plant hormone gibberellin (GA). The primary target tissue for GA action is the intercalary meristem of the internode. Using differential display of mRNA, we have isolated a number of genes whose expression in the intercalary meristem is regulated by GA. The product of one of these genes was identified as an ortholog of replication protein A1 (RPA1). RPA is a heterotrimeric protein involved in DNA replication, recombination, and repair and also in regulation of transcription. A chimeric construct, in which the single-stranded DNA-binding domain of rice RPA1 was spliced into the corresponding region of yeast RPA1, was able to complement a yeast rpa1 mutant. The transcript level of rice RPA1 is high in tissues containing dividing cells. RPA1 mRNA levels increase rapidly in the intercalary meristem during submergence and treatment with GA before the increase in the level of histone H3 mRNA, a marker for DNA replication.

Amino Acid Sequence↗

PubMed2000

Rice dwarf mutant d1, which is defective in the alpha subunit of the heterotrimeric G protein, affects gibberellin signal transduction.

Previously, we reported that the rice dwarf mutant, d1, is defective in the alpha subunit of the heterotrimeric G protein (Galpha). In the present study, gibberellin (GA) signaling in d1 and the role of the Galpha protein in the GA-signaling pathway were investigated. Compared with the wild type, GA induction of alpha-amylase activity in aleurone cells of d1 was greatly reduced. Relative to the wild type, the GA(3)-treated aleurone layer of d1 had lower expression of Ramy1A, which encodes alpha-amylase, and OsGAMYB, which encodes a GA-inducible transcriptional factor, and no increase in expression of Ca(2 +)-ATPase. However, in the presence of high GA concentrations, alpha-amylase induction occurred even in d1. The GA sensitivity of second leaf sheath elongation in d1 was similar to that of the wild type in terms of dose responsiveness, but the response of internode elongation to GA was much lower in d1. Furthermore, Os20ox expression was up-regulated, and the GA content was elevated in the stunted internodes of d1. All these results suggest that d1 affects a part of the GA-signaling pathway, namely the induction of alpha-amylase in the aleurone layer and internode elongation. In addition, a double mutant between d1 and another GA-signaling mutant, slr, revealed that SLR is epistatic to the D1, supporting that the Galpha protein is involved in GA signaling. However, the data also provide evidence for the presence of an alternative GA-signaling pathway that does not involve the Galpha protein. It is proposed that GA signaling via the Galpha protein may be more sensitive than that of the alternative pathway, as indicated by the low GA responsiveness of this Galpha-independent pathway.

Epistasis, Genetic↗

PubMed1997

Ent-kaurene synthase from the fungus Phaeosphaeria sp. L487. cDNA isolation, characterization, and bacterial expression of a bifunctional diterpene cyclase in fungal gibberellin biosynthesis.

ent-Kaurene is the first cyclic diterpene intermediate of gibberellin biosynthesis in both plants and fungi. In plants, ent-kaurene is synthesized from geranylgeranyl diphosphate via copalyl diphosphate in a two-step cyclization catalyzed by copalyl diphosphate synthase and ent-kaurene synthase. A cell-free system of the fungus Phaeosphaeria sp. L487 converted labeled geranylgeranyl diphosphate to ent-kaurene. A cDNA fragment, which possibly encodes copalyl diphosphate synthase, was isolated by reverse transcription-polymerase chain reaction using degenerate primers based on the consensus motifs of plant enzymes. Translation of a full-length cDNA sequence isolated from the fungal cDNA library revealed an open reading frame for a 106-kDa polypeptide. The deduced amino acid sequence shared 24 and 21% identity with maize copalyl diphosphate synthase and pumpkin ent-kaurene synthase, respectively. A fusion protein produced by expression of the cDNA in Escherichia coli catalyzed the two-step cyclization of geranylgeranyl diphosphate to ent-kaurene. Amo-1618 completely inhibited the copalyl diphosphate synthase activity of the enzyme at 10(-6) M, whereas it did not inhibit the ent-kaurene synthase activity even at 10(-4) M. These results indicate that the fungus has a bifunctional diterpene cyclase that can convert geranylgeranyl diphosphate into ent-kaurene. They may be separate catalytic sites for the two cyclization reactions.

Alkyl and Aryl Transferases↗

PubMed2002

Contribution of the mevalonate and methylerythritol phosphate pathways to the biosynthesis of gibberellins in Arabidopsis.

Gibberellins (GAs) are diterpene plant hormones essential for many developmental processes. Although the GA biosynthesis pathway has been well studied, our knowledge on its early stage is still limited. There are two possible routes for the biosynthesis of isoprenoids leading to GAs, the mevalonate (MVA) pathway in the cytosol and the methylerythritol phosphate (MEP) pathway in plastids. To distinguish these possibilities, metabolites from each isoprenoid pathway were selectively labeled with (13)C in Arabidopsis seedlings. Efficient (13)C-labeling was achieved by blocking the endogenous pathway chemically or genetically during the feed of a (13)C-labeled precursor specific to the MVA or MEP pathways. Gas chromatography-mass spectrometry analyses demonstrated that both MVA and MEP pathways can contribute to the biosyntheses of GAs and campesterol, a cytosolic sterol, in Arabidopsis seedlings. While GAs are predominantly synthesized through the MEP pathway, the MVA pathway plays a major role in the biosynthesis of campesterol. Consistent with some crossover between the two pathways, phenotypic defects caused by the block of the MVA and MEP pathways were partially rescued by exogenous application of the MEP and MVA precursors, respectively. We also provide evidence to suggest that the MVA pathway still contributes to GA biosynthesis when this pathway is limiting.

Arabidopsis↗

PubMed2003

Characterization of the final two genes of the gibberellin biosynthesis gene cluster of Gibberella fujikuroi: des and P450-3 encode GA4 desaturase and the 13-hydroxylase, respectively.

Recently, six genes of the gibberellin (GA) biosynthesis gene cluster in Gibberella fujikuroi were cloned and the functions of five of these genes were determined. Here we describe the function of the sixth gene, P450-3, and the cloning and functional analysis of a seventh gene, orf3, located at the left border of the gene cluster. We have thereby defined the complete GA biosynthesis gene cluster in this fungus. The predicted amino acid sequence of orf3 revealed no close homology to known proteins. High performance liquid chromatography and gas chromatography-mass spectrometry analyses of the culture fluid of knock-out mutants identified GA1 and GA4, rather than GA3 and GA7, as the major C19-GA products, suggesting that orf3 encodes the GA4 1,2-desaturase. This was confirmed by transformation of the SG139 mutant, which lacks the GA biosynthesis gene cluster, with the desaturase gene renamed des. The transformants converted GA4 to GA7, and also metabolized GA9 (3-deoxyGA4) to GA120 (1,2-didehydroGA9), but the 2alpha-hydroxylated compound GA40 was the major product in this case. We demonstrate also by gene disruption that P450-3, one of the four cytochrome P450 monooxygenase genes in the GA gene cluster, encodes the 13-hydroxylase, which catalyzes the conversion of GA7 to GA3, in the last step of the pathway. This enzyme also catalyzes the 13-hydroxylation of GA4 to GA1. Disruption of the des gene in an UV-induced P450-3 mutant produced a double mutant lacking both desaturase and 13-hydroxylase activities that accumulated high amounts of the commercially important GA4. The des and P450-3 genes differ in their regulation by nitrogen metabolite repression. In common with the other five GA biosynthesis genes, expression of the desaturase gene is repressed by high amounts of nitrogen in the culture medium, whereas P450-3 is the only gene in the cluster not repressed by nitrogen.

Base Sequence↗

PubMed2004

The NADPH-cytochrome P450 reductase gene from Gibberella fujikuroi is essential for gibberellin biosynthesis.

The fungus Gibberella fujikuroi is used for the commercial production of gibberellins (GAs), which it produces in very large quantities. Four of the seven GA biosynthetic genes in this species encode cytochrome P450 monooxygenases, which function in association with NADPH-cytochrome P450 reductases (CPRs) that mediate the transfer of electrons from NADPH to the P450 monooxygenases. Only one cpr gene (cpr-Gf) was found in G. fujikuroi and cloned by a PCR approach. The encoded protein contains the conserved CPR functional domains, including the FAD, FMN, and NADPH binding motifs. cpr-Gf disruption mutants were viable but showed a reduced growth rate. Furthermore, disruption resulted in total loss of GA(3), GA(4), and GA(7) production, but low levels of non-hydroxylated C(20)-GAs (GA(15) and GA(24)) were still detected. In addition, the knock-out mutants were much more sensitive to benzoate than the wild type due to loss of activity of another P450 monooxygenase, the detoxifying enzyme, benzoate p-hydroxylase. The UV-induced mutant of G. fujikuroi, SG138, which was shown to be blocked at most of the GA biosynthetic steps catalyzed by P450 monooxygenases, displayed the same phenotype. Sequence analysis of the mutant cpr allele in SG138 revealed a nonsense mutation at amino acid position 627. The mutant was complemented with the cpr-Gf and the Aspergillus niger cprA genes, both genes fully restoring the ability to produce GAs. Northern blot analysis revealed co-regulated expression of the cpr-Gf gene and the GA biosynthetic genes P450-1, P450-2, P450-4 under GA production conditions (nitrogen starvation). In addition, expression of cpr-Gf is induced by benzoate. These results indicate that CPR-Gf is the main but not the only electron donor for several P450 monooxygenases from primary and secondary metabolism.

Base Sequence↗