PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “PRINTING”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 415 records · Page 23Linked to original sources

Does reading about stroke increase stroke knowledge? The impact of different print materials.

The purpose of this study was to determine whether print materials on stroke resulted in increased knowledge in a sample of lay people. One hundred and seventy-seven participants received (at random) one of five versions of a stroke information packet, or a control packet on colorectal cancer. Participants rated the materials on readability, understandability and usefulness immediately after reading. After a delay of 18 days on average, participants answered questions assessing stroke knowledge. Ratings of all packets were generally positive; however, stroke knowledge scores were significantly higher for the stroke information groups compared to the control group only for knowledge of causal mechanisms (stroke pathophysiology). While there was some indication that the fictionalized material on stroke was more effective than the expository materials, overall the impact of print materials on stroke knowledge, measured after a delay of at least 1 week, was minimal at best. Further research is needed to determine whether fictional contexts make some information more memorable.

Adult↗

Development of a screen-printed amperometric biosensor for the determination of L-lactate dehydrogenase level.

We attempted to develop a screen-printed biosensor for the amperometric determination of L-lactate dehydrogenase (LDH) level on the basis of NAD(+)/NADH-dependent dehydrogenase reaction. The printing ink for the working electrode consisted of L-lactate, NAD(+), composite polymer of hydroxyethyl cellulose with ethylene glycol, 3,4-dihydroxybenzaldehyde (3,4-DHB) as an electron transferring mediator, and graphite as the conducting material. The 3,4-DHB was electropolymerized on the carboneous working electrode by potential cycling between -200 and +300 mV vs. Ag/AgCl reference electrode. Through the electrocatalytic reaction with immobilized 3,4-DHB, the NADH generated by the LDH reaction could be efficiently oxidized at lower potential than the unmodified carbon electrode. The analytical performance of the electrode was characterized in terms of linear sensing range and detection limit for LDH. The response from the developed biosensor was linear up to 500 U/l of LDH, and the detection limit of 50 U/l was observed at the signal-to-noise ratio of 3.

Biosensing Techniques↗

Demonstration of labeless detection of food pathogens using electrochemical redox probe and screen printed gold electrodes.

The demonstration of a labeless immunosensor for the detection of pathogenic bacteria using screen printed gold electrodes (SPGEs) and a potassium hexacyanoferrate(II) redox probe is reported. Gold electrodes were produced using screen printing and the gold surfaces were modified by a thiol based self assembled monolayer (SAM) to facilitate antibody immobilisation. SAMs based on the use of thioctic acid (TA), mercaptopropionic acid (MPA) and mercaptoundecanoic acid (MUA) were evaluated. Following antibody immobilisation via the optimum SAM, the redox behaviour and diffusion co-efficient (D) of the potassium hexacyanoferrate(II) probe was monitored in the absence and presence of analyte. In the presence of analyte, a change in the apparent diffusion co-efficient of the redox probe was observed, attributable to impedance of the diffusion of redox electrons to the electrode surface due to the formation of the antibody-bacteria immunocomplex. No change in the diffusion co-efficient was observed when a non-specific antibody (mouse IgG) was immobilised and antigen added. The system has been demonstrated with Listeria monocytogenes and Bacillus cereus.

Antibodies, Bacterial↗

Preparation of poly(thionine) modified screen-printed carbon electrode and its application to determine NADH in flow injection analysis system.

A poly(thionine) modified screen-printed carbon electrode has been prepared by an electrooxidative polymerization of thionine in neutral phosphate buffer. The modified electrodes are found to give stable and reproducible electrocatlytic responses to NADH and exhibit good stability. Several techniques, including cyclic voltammetry, X-ray photoelectron spectroscopy (XPS) and scanning electron microscopy (SEM), have been employed to characterize the poly(thionine) film. Further, the modified screen-printed carbon electrode was found to be promising as an amperometric detector for the flow injection analysis (FIA) of NADH, typically with a dynamic range of 5-100 microM.

Biosensing Techniques↗

Electrochemical study of chemically modified and screen-printed graphite electrodes with

The preparation and electrochemical characterization of graphite electrodes modified with hexadecylpyridinium-bis(chlorilato)-antimonyl(V), [SbVO(CHL)2]Hex, (CMEs) as well as their behavior as electrocatalysts toward the oxidation of sulfide are described. The self-exchange rate constant ko of immobilized [SbVO(CHL)2]Hex and the effect of the surface coverage were evaluated. [SbVO(CHL)2]Hex is a new compound. Synthesis protocol and some identification studies are given. The fabrication of screen-printed electrodes (SPEs) with a mixture of 5% (w/ w) [SbVO(CHL)2]Hex/graphite powder in 1.5% (w/v) ethyl cellulose in 2-butoxyethyl acetate is also described. SPEs, poised at +0.08 mV versus Ag/AgCl, at pH 6.5 were utilized for the determination of sulfide in simulated wastewater samples. Interference of various compounds was also tested. The proposed method correlates well with a colorimetric method. Calibration graphs were linear over the range 0.01-0.7 mM sodium sulfide and the CV was 2.8% (n = 8) for 0.1 mM sodium sulfide. Recovery ranged from 94 to 102%. Both [SbVO(CHL)2]Hex CMEs and SPE showed very good storage stability. [SbVO(CHL)2]Hex CMEs showed poor working stability in contrast to printed electrodes, which operated with no remarkable loss of their initial activity for more than 100 runs.

Journal Article↗

Mercury-free disposable lead sensors based on potentiometric stripping analysis at gold-coated screen-printed electrodes.

Gold-coated screen-printed electrodes offer reliable quantitation of trace lead in connection with potentiometric stripping analysis (PSA). Such replacement of mercury-based sensors, with gold-coated ones, avoids environmental contamination associated with the disposal of mercury electrodes in connection with large-scale screening for lead poisoning. The PSA operation obviates the need for oxygen removal, offers low background contributions, and minimizes surfactant interferences. Changes in the peak intensity and position (vs mercury-coated strips) offer new selectivity dimensions. Various experimental parameters are optimized to allow convenient monitoring of micrograms per liter lead concentrations following short deposition periods. Applicability to urine and drinking water samples is illustrated. The highly stable response of these screen-printed electrodes makes them very attractive for both single-use and multiple applications.

Disposable Equipment↗

Pin-printed chemical sensor arrays for simultaneous multianalyte quantification.

A new approach to rapidly produce micrometer-scale sensor elements into reusable multianalyte chemical sensor arrays is demonstrated. By using pin printing technology in concert with sol-gel processing methods, we form discrete xerogel-based microsensors on a planar substrate. We illustrate the new approach by forming discrete 02- and pH-responsive sensing elements into arrays that allow one to simultaneously determine O2 and pH in aqueous samples. The pin printing method allows one to prepare sensor elements that are on the order of 100 microm in diameter, 1-2 microm thick, at a rate of approximately one sensor element per second with a single pin. Within a given calibrated array, the sensor element-to-sensor element response is reproducible to within 5%, the sensor element short- and long-term reproducibilities are 3 and 6%, respectively, and the array-to-array response reproducibility is 11%. These results demonstrate the potential of this methodology for rapidly forming ensembles of reusable sensor arrays for simultaneous multianalyte detection.

Journal Article↗

Prototyping of microfluidic devices in poly(dimethylsiloxane) using solid-object printing.

A solid-object printer was used to produce masters for the fabrication of microfluidic devices in poly(dimethylsiloxane) (PDMS). The printer provides an alternative to photolithography for applications where features of > 250 microm are needed. Solid-object printing is capable of delivering objects that have dimensions as large as 250 x 190 x 200 mm (x, y, z) with feature sizes that can range from 10 cm to 250 microm. The user designs a device in 3-D in a CAD program, and the CAD file is used by the printer to fabricate a master directly without the need for a mask. The printer can produce complex structures, including multilevel features, in one unattended printing. The masters are robust and inexpensive and can be fabricated rapidly. Once a master was obtained, a PDMS replica was fabricated by molding against it and used to fabricate a microfluidic device. The capabilities of this method are demonstrated by fabricating devices that contain multilevel and tall features, devices that cover a large area (approximately 150 cm2), and devices that contain nonintersecting, crossing channels.

Animals↗

Voltammetric characterization of a N,N'-diphenyl-p-phenylenediamine-loaded screen-printed electrode: a disposable sensor for hydrogen sulfide.

The voltammetric response of a 10% (by weight) N,N'-diphenyl-p-phenylenediamine (DPPD) and 90% (by weight) carbon and binder screen-printed electrode has been examined in aqueous media over a range of pH using cyclic voltammetry both in the presence and in the absence of sulfide. In the absence, the screen-printed electrode undergoes an initial oxidative process on the surface of the solid organic particles to form an insoluble layer of the corresponding cation radical salt, DPPD(*)(+)X(-), where X(-) is an anion present in the solution. The charge transfer is thought to occur at the three-phase boundary between solid DPPD, carbon, and the aqueous solution. At higher potentials, a second oxidative wave is observed that is attributed to the oxidation of the bulk DPPD with intercalation of the anion species present to form a solid phase of DPPD(*)(+)X(-). The two voltammetric processes were found to stabilize after repetitive scanning, after which time, sulfide was added to the solution. The voltammetric response was found to respond to sulfide by showing a decrease in both the oxidative and reductive waves, which can be attributed to the sulfide effectively blocking the three-phase boundary. The response was found to be independent of the electrode used and at pH 4 produced a linear range from 20 to 165 microM, and a limit of detection of 7.5 microM for sulfide detection was achieved.

Journal Article↗

Screen printing of nucleic acid detecting carbon electrodes.

A large fraction of the presently mass-manufactured (> 10(8) units/year) electrochemical biosensors, used mostly by diabetic people to monitor their blood glucose levels, have screen-printed carbon working electrodes. An earlier study (Campbell, C. N., et al. Anal. Chem. 2002, 74, 158-162) showed that nucleic acids can be assayed at 1 nM concentrations by a sandwich-type amperometric method. The assay was performed with vitreous carbon working electrodes on which an electron-conducting polycationic redox polymer and avidin were coelectrodeposited. Because the rate of the electrodeposition increases with the surface density of the polycationic redox polymer, its practicality depends on pretreatment of the surface, which adds anionic functions. (Gao, Z., et al. Angew. Chem. Int. Ed. 2002, 41, 810-813). Here it is shown that the required conducting redox polymer films can be electrodeposited on potentially mass manufacturable electrodes made by screen-printing hydrophilic carbon inks on polyester sheets. The modified electrodes are made in two steps. First a polycationic electron-conducting redox polymer is cross-linked and electrodeposited by applying a negative potential. Next, an amine-terminated 20-base single-stranded oligonucleotide is electrodeposited by ligand-exchange. Both steps involve exchange of a labile inner sphere chloride ligand of the polymer-bound osmium-complex: Cross-linking and electrodeposition of the redox polymer result when inner-sphere chloride anions of the osmium complexes are exchanged by imidazole functions of neighboring chains. Incorporation of the oligonucleotide in the redox polymer results in the formation of a coordinative bond between the terminal amine (attached through a spacer to the oligonucleotide) and the osmium complex. In testing for the presence of a 38-base oligonucleotide, the analyte, in a 15- or 25-microL droplet of hybridization solution, is hybridized with and captured by the 20-base electrode-bound sequence; then it is hybridized with an 18-base horseradish peroxidase labeled sequence. When the HRP label electrically contacts the redox polymer, the film becomes an electrocatalyst for the reduction of H2O2 to water at 0.10 V (Ag/AgCl). Flow of the H2O2-reduction current indicates the presence of the assayed sequence.

Biosensing Techniques↗

DNA covalent immobilization onto screen-printed electrode networks for direct label-free hybridization detection of p53 sequences.

A new electrochemical biochip for the detection of DNA sequences was developed. The entire biochip-i.e., working, reference, and counter electrodes-was constructed based on the screen-printing technique and exhibits eight working electrodes that could be individually addressed and grafted through a simple electrochemical procedure. Screen-printed electrode networks were functionalized electrochemically with 1-ethyl-3-(3dimethylaminopropyl)carbodidiimide according to a simple procedure. Single-stranded DNA with a C6-NH(2) linker at the 5'-end was then covalently bound to the surface to act as probe for the direct, nonlabeled, detection of complementary strands in a conductive liquid medium. In the present system, the study was focused on a particular codon (273) localized in the exon 8 of the p53 gene (20 mer, TTGAGGTGCATGTTTGTGCC). The integrity of the immobilized probes and its ability to capture target sequences was monitored through chemiluminescent detection following the hybridization of a peroxidase-labeled target. The grafting of the probe at the electrode surface was shown to generate significant shifts of the Nyquist curves measured in the 10-kHz to 80-Hz range. These variations of the faradaic impedance were found to be related to changes of the double layer capacitance of the electrochemical system's equivalent circuit. Similarly, hybridization of complementary strands was monitored through the measurements of these shifts, which enabled the detection of target sequences from 1 to 200 nM. Discrimination between complementary, noncomplementary, and single-nucleotide mismatch targets was easily accomplished.

Base Sequence↗

Imprinted polymer-based sensor system for herbicides using differential-pulse voltammetry on screen-printed electrodes.

A sensor system for the herbicide 2,4-dichlorophenoxy-acetic acid has been developed based on specific recognition of the analyte by a molecularly imprinted polymer and electrochemical detection using disposable screen-printed electrodes. The method involves a competitive binding step with a nonrelated electrochemically active probe. For batch binding assays, imprinted polymer particles are incubated in suspension with the analyte and the probe, followed by centrifugation and quantification of the unbound probe in the supernatant. Two different compounds, namely 2,4-dichlorophenol and homogentisic acid, were tested as potential electroactive probes. Both compounds could be conveniently detected by differential-pulse voltammetry on screen-printed, solvent-resistant three-electrode systems having carbon working electrodes. Whereas 2,4-dichlorophenol showed very high nonspecific binding to the polymer, homogentisic acid bound specifically to the imprinted sites and thus allowed calibration curves for the analyte in the micromolar range to be recorded. An integrated sensor was developed by coating the imprinted polymer particles directly onto the working electrode. Following incubation of the modified electrode in a solution containing the analyte and the probe, the bound fraction of the probe is quantified. This system provides a cheap, disposable sensor for rapid determination of environmentally relevant and other analytes.

Electrochemistry↗

A disposable amperometric sensor screen printed on a nitrocellulose strip: a glucose biosensor employing lead oxide as an interference-removing agent.

A new type of disposable amperometric sensor is devised by screen printing thick-film electrodes directly on a porous nitrocellulose (NC) strip. The chromatographic NC strip is then utilized to introduce various sample pretreatment layers. As a preliminary application, a glucose biosensor based on hydrogen peroxide detection is constructed by immobilizing glucose oxidase (GOx) on the NC electrode strip and by formulating a strong oxidation layer (i.e., PbO2) at the sample loading area, placed below the GOx reaction band. The screen-printed PbO2 paste serves as a sample pretreatment layer that removes interference by its strong oxidizing ability. Samples applied are carried chromatographically, via the PbO2 paste, to the GOx layer, and glucose is catalyzed to liberate hydrogen peroxide, which is then detected at the electrode surface. The proposed NC/PbO2 strip sensor is shown to be virtually insusceptible to interfering species such as acetaminophen and ascorbic and uric acids and to exhibit good performance, in terms of the sensor-to-sensor reproducibility (standard deviation, +/-0.026 - +/-0.086 microA), the sensitivity (slope, -0.183 microA/mM), and the linearity (correlation coefficient, 0.994 in the range of 0-10 mM).

Biosensing Techniques↗

Micropattern printing of adhesion, spreading, and migration peptides on poly(tetrafluoroethylene) films to promote endothelialization.

We report here the development of an original multistep micropatterning technique for printing peptides on surfaces, based on the ink-jet printer technology. Contrary to most micropatterning methods used nowadays, this technique is advantageous because it allows displaying 2D-arrays of multiple biomolecules. Moreover, this low cost procedure allies the advantages of computer-aided design with high flexibility and reproducibility. A Hewlett-Packard printer was modified to print peptide solutions, and Adobe Illustrator was used as the graphic-editing software to design high-resolution checkerboard-like micropatterns. In a first step, PTFE films were treated with ammonia plasma to introduce amino groups on the surface. These chemical functionalities were reacted with heterobifunctional cross-linker sulfo-succinimidyl 4-(N-maleimidomethyl)cycloexane-1-carboxylate (S-SMCC) to allow the subsequent surface covalent conjugation of various cysteine-modified peptides to the polymer substrate. These peptidic molecules containing RGD and WQPPRARI sequences were selected for their adhesive, spreading, and migrational properties toward endothelial cells. On one hand, our data demonstrated that the initial cell adhesion does not depend on the chemical structure and combination of the peptides covalently bonded either through conventional conjugation or micropatterning. On the other hand, spreading and migration of endothelial cells is clearly enhanced while coconjugating the GRGDS peptide in conjunction with WQPPRARI. This behavior is further improved by micropatterning these peptides on specific areas of the polymer surface.

Cell Adhesion↗

Patterned protein films on poly(lipid) bilayers by microcontact printing.

The use of polymerized lipid bilayers as substrates for microcontact printing (muCP) of protein films was investigated. We have previously shown that vesicle fusion of bis-SorbPC, a dienoate lipid, on glass and silica substrates, followed by redox-initiated radical polymerization, produces a planar supported lipid bilayer (PSLB) that is ultrastable(1a) [Ross, E. E.; Rozanski, L. J.; Spratt, T.; Liu, S.; O'Brien, D. F.; Saavedra, S. S. Langmuir 2003, 19, 1752] and highly resistant to nonspecific adsorption of dissolved proteins [Ross, E. E.; Spratt, T.; Liu, S.; Rozanski, L. J.; O'Brien, D. F.; Saavedra, S. S. Langmuir 2003, 19, 1766].(1b) Here we demonstrate that muCP of bovine serum albumin (BSA) onto a dried poly(bis-SorbPC) PSLB from a poly(dimethylsiloxane) (PDMS) stamp produces a layer of strongly adsorbed protein, comparable in surface coverage to films printed on glass surfaces. Immobilization of proteins on poly(PSLB)s has potential applications in biosensing, and this work shows that direct muCP of proteins is a technically simple approach to create immobilized monolayers, as well as multilayers of different proteins.

Biofilms↗

The PRINTS database of protein fingerprints: a novel information resource for computational molecular biology.

PRINTS is a compendium of protein motif fingerprints derived from the OWL composite sequence database. Fingerprints are groups of motifs within sequence alignments whose conserved nature allows them to be used as signatures of family membership. Fingerprints inherently offer improved diagnostic reliability over single motif methods by virtue of the mutual context provided by motif neighbors. To date, 650 fingerprints have been constructed and stored in PRINTS, the size of which has doubled in the last 2 years. The current version, 14.0, encodes 3500 motifs, covering a range of globular and membrane proteins, modular polypeptides, and so on. The database is now accessible via the UCL Bioinformatics Server on http:@ www.biochem.ucl.ac.uk/bsm/dbbrowser/. We describe here progress with the database, its compilation and interrogation software, and its Web interface.

Amino Acid Sequence↗

Positive microcontact printing.

Microcontact printing alkanethiols from an inked, microstructured stamp onto Au or Cu results in the formation of a self-assembled monolayer, which can locally protect the substrate from wet etching. This lithographic technique resembles a negative-type of lithography but can be inverted to the positive process. This is done by printing a type of oligothiol that does not protect the substrate from etching but prevents the adsorption of a protective monolayer from solution.

Journal Article↗

Interfacial chemistries for nanoscale transfer printing.

We describe a patterning technique that uses self-assembled monolayers and other surface chemistries for guiding the transfer of material from relief features on a stamp to a substrate. This purely additive contact printing technique is capable of nanometer resolution. Pattern transfer is fast and it occurs at ambient conditions. We illustrate the versatility of this method by printing single-layer metal patterns with feature sizes from a few tens of microns to a few tens of nanometers. We also demonstrate its use for patterning, in a single step, metal/dielectric/metal multilayers for functional thin film capacitors on plastic substrates.

Journal Article↗