PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “Thermococcus”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 415 records · Page 23Linked to original sources
PubMed2004

Transglycosylation activity of Dictyoglomus thermophilum amylase A.

Amylase A from Dictyoglomus thermophilum is a thermophilic enzyme and has about 40% identity with 4-alpha-glucanotransferase (GTase) from Thermococcus litoralis, and both of these enzymes belong to family 57 glycosyl hydrolase. Since the transglycosylation activity of T. litoralis GTase has been well characterized, the substrate specificity and reaction products of amylase A from D. thermophilum were examined. alpha-1,4 Glucan was produced from maltooligosaccharides, and glucoamylase-resistant molecules (cycloamyloses) were produced from longer chain amylose (average molecular mass 200 kDa). It has been reported that amylase A from D. thermophilum hydrolyzes starch, but in this study it was found that the enzyme was also able to use maltooligosaccharides and long chain amylose as substrate and has transglycosylation activity.

Amylases↗
PubMed1986

Quinones from archaebacteria, II. Different types of quinones from sulphur-dependent archaebacteria.

From the sulphur-dependent, anaerobically grown archaebacterium Sulfolobus ambivalens Caldariella quinone, CQ-6(12H) and the new Sulfolobus quinone SQ-6(12H), 6-(3,7,11,15,19,23-hexamethyltetracosyl)-5-methyl-benz[b]thioph en-4, 7-quinone have been isolated as main components. Lower homologues SQ-5-(10H), SQ-4(8H), SQ-3(6H), phylloquinone-like species CQ-6(10H), SQ-6(10H) and the menaquinone MK-6(12H) are present as minor components. The results are compared with those from Sulfolobus acidocaldarius. Thermococcus celer, Desulfurococcus mucosus and Desulfurococcus mobilis do not contain quinones in comparable amounts.

Anaerobiosis↗
PubMedDate not supplied

[Phylogenetic diversity and activity of anaerobic microorganisms of high-temperature horizons of the Dagang Oilfield (China)].

The number of microorganisms of major metabolic groups and the rates of sulfate-reducing and methanogenic processes in the formation waters of the high-temperature horizons of Dagang oilfield have been determined. Using cultural methods, it was shown that the microbial community contained aerobic bacteria oxidizing crude oil, anaerobic fermentative bacteria, sulfate-reducing bacteria, and methanogenic bacteria. Using cultural methods, the possibility of methane production from a mixture of hydrogen and carbon dioxide (H2 + CO2) and from acetate was established, and this result was confirmed by radioassays involving NaH14CO3 and 14CH3COONa. Analysis of 16S rDNA of enrichment cultures of methanogens demonstrated that these microorganisms belong to Methanothermobacter sp. (M. thermoautotrophicus), which consumes hydrogen and carbon dioxide as basic substrates. The genes of acetate-utilizing bacteria were not identified. Phylotypes of the representatives of Thermococcus spp. were found among 16S rDNAs of archaea. 16S rRNA genes of bacterial clones belong to the orders Thermoanaerobacteriales (Thermoanaerobacter, Thermovenabulum, Thermacetogenium, and Coprothermobacter spp.), Thermotogales, Nitrospirales (Thermodesulfovibrio sp.) and Planctomycetales. 16S rDNA of a bacterium capable of oxidizing acetate in the course of syntrophic growth with H2-utilizing methanogens was found at high-temperature petroleum reservoirs for the first time. These results provide further insight into the composition of microbial communities of high-temperature petroleum reservoirs, indicating that syntrophic processes play an important part in acetate degradation accompanied by methane production.

Anaerobiosis↗
PubMed1994

Occurrence of tertiary and quaternary branched polyamines in thermophilic archaebacteria.

Polyamines of thermophilic archaebacteria were analysed by high-performance liquid chromatography and gas chromatography. Thermoplasma acidophilum and Thermoplasma volcanium ubiquitously contained spermidine and spermine. Four species of Sulfolobus, S. acidocaldarius, S. solfataricus, S. metallicus and S. shibatae, two species of Acidianus, A. brierleyi and A. infernus, and Metallosphaera sedula, contained norspermidine and norspermine in addition to spermidine and spermine, but quantitative distribution profiles were species-specific. A tertiary tetra-amine, N4-aminopropylspermidine, and a quaternary penta-amine, N4-bis(aminopropyl)spermidine, were detected as a major polyamine in three species of Thermococcus, T. celer, T. litoralis and T. stetteri, and two Pyrococcus species, P. furiosus and P. woesei. This is the first report on the occurrence of branched polyamines in archaebacteria.

Archaea↗
PubMed1993

Characterization, cloning, and in vitro expression of the extremely thermostable glutamate dehydrogenase from the hyperthermophilic Archaeon, ES4.

Glutamate dehydrogenase (GDH) from the hyperthermophilic Archaeon ES4 (optimal growth temperature 98 degrees C and maximum growth temperature 110 degrees C) was purified to homogeneity. The purified native enzyme had an M(r) of 270,000 +/- 5,000 and was shown by gel filtration and SDS-polyacrylamide gel electrophoresis to be a hexamer with identical subunits of M(r) = 46,000 +/- 3,000. The hexameric subunit composition was also evident from electron micrographs, which show a triangular antiprism structure very similar to that of bovine GDH. The enzyme is exceptionally thermostable, with a half-time of inactivation of 3.5 h at 105 degrees C. Differential scanning calorimetry revealed a tm for denaturation of 113 degrees C, and a tm for activation at 60 degrees C. Antigenic cross-reaction with ES4 GDH was observed with the purified GDH from the thermophilic Archaea, Pyrococcus furiosus and Thermococcus litoralis as well as with bovine and yeast GDHs. The genome of ES4 was shown to contain a single copy of the gdhA gene, and this was cloned and sequenced. The deduced amino acid sequence of the GDH from ES4 corresponded to the NH2-terminal amino acid sequence obtained from the pure protein. From the nucleotide sequence the ES4 protein is composed of 420 residues. It has a relatively high hydrophobicity and a low number of sulfur-containing residues compared with mesophilic GDHs. Relatively high homology (52%) exists between the deduced amino acid sequence of ES4 GDH and Clostridium difficile GDH. Of the two distinct families of GDH sequences known, ES4 GDH belongs to the same family as vertebrates, C. difficile, and other Archaea. The gdhA gene of ES4 was expressed in vitro in a rabbit reticulocyte cell-free lysate, thus providing a system for structural studies of the mechanisms of thermostability in hyper-thermophilic proteins.

Amino Acid Sequence↗
PubMed1993

Identification of molybdopterin as the organic component of the tungsten cofactor in four enzymes from hyperthermophilic Archaea.

The hyperthermophilic Archaea represent some of the most ancient organisms on earth. A study of enzymatic cofactors in these organisms could provide basic information on the origins of related cofactors in man and other more recently evolved organisms. To this end, the nature of the tungsten cofactor in aldehyde ferredoxin oxidoreductases from Pyrococcus furiosus and ES-4 and in formaldehyde ferredoxin oxidoreductases from P. furiosus and Thermococcus litoralis has been investigated. All four proteins contain molybdopterin, previously characterized as the organic component of the molybdenum cofactor in a large number of molybdoenzymes. Molybdopterin was identified by conversion to the dicarboxamidomethyl derivative by alkylation of the vicinal sulfhydryl groups on the pterin side chain and by conversion to the oxidized fluorescent derivative, Form A. The pterin of the tungsten cofactor in the four enzymes was examined for the presence of appended GMP, CMP, AMP, or IMP previously observed in molybdenum cofactors of some molybdoenzymes. No evidence for the presence of a molybdopterin dinucleotide or other modified form of molybdopterin was obtained. These results further document the essential nature of molybdopterin for the function of molybdenum and tungsten enzymes in diverse life forms.

Aldehyde Oxidoreductases↗
PubMed2001

Characterization of parazoanthoxanthin A binding to a series of natural and synthetic host DNA duplexes.

Parazoanthoxanthin A is a fluorescent yellow nitrogenous pigment of the group of zoanthoxanthins, which show a broad range of biological activity. These include, among others, the ability to bind to DNA. In this study we have used a variety of spectroscopic (intrinsic fluorescence emission and UV-spectroscopy) and hydrodynamic techniques (viscometry) to characterize in more detail the binding of parazoanthoxanthin A to a variety of natural and synthetic DNA duplexes in different buffer conditions. Our results reveal the following five significant features: (i) Parazoanthoxanthin A exhibits two modes of DNA binding: One binding mode exhibits properties of intercalation, while the second binding mode is predominantly electrostatic in origin. (ii) The apparent binding "site size" for parazoanthoxanthin A near physiological salt concentration (100 mM NaCl) is in the range of 7 +/- 1 base pairs for natural genomic DNA duplexes (calf thymus and salmon testes DNA) and alternating synthetic polynucleotides (poly[d(AT)]. poly[d(AT)] and poly[d(GC)]. poly[d(GC)]). A slightly larger apparent binding site size of 9 +/- 1 bp was obtained for parazoanthoxanthin A binding to the synthetic homopolymer poly[d(A)]. poly[d(T)]. (iii) Near physiological salt concentration (100 mM NaCl) parazoanthoxanthin A binds with the same approximate binding affinity of 2-5 x 10(5) M(-1) to all DNA polymers studied. (iv) At low salt concentration, parazoanthoxanthin A preferentially binds alternating poly[d(AT)]. poly[d(AT)] and poly[d(GC)]. poly[d(GC)] host duplexes. (v) Parazoanthoxanthin A inhibits DNA polymerase in vitro.

Animals↗
PubMed1998

Enzyme activity below the dynamical transition at 220 K.

Enzyme activity requires the activation of anharmonic motions, such as jumps between potential energy wells. However, in general, the forms and time scales of the functionally important anharmonic dynamics coupled to motion along the reaction coordinate remain to be determined. In particular, the question arises whether the temperature-dependent dynamical transition from harmonic to anharmonic motion in proteins, which has been observed experimentally and using molecular dynamics simulation, involves the activation of motions required for enzyme function. Here we present parallel measurements of the activity and dynamics of a cryosolution of glutamate dehydrogenase as a function of temperature. The dynamical atomic fluctuations faster than approximately 100 ps were determined using neutron scattering. The results show that the enzyme remains active below the dynamical transition observed at approximately 220 K, i.e., at temperatures where no anharmonic motion is detected. Furthermore, the activity shows no significant deviation from Arrhenius behavior down to 190 K. The results indicate that the observed transition in the enzyme's dynamics is decoupled from the rate-limiting step along the reaction coordinate.

Catalysis↗
PubMed1999

Enzyme dynamics and activity: time-scale dependence of dynamical transitions in glutamate dehydrogenase solution.

We have examined the temperature dependence of motions in a cryosolution of the enzyme glutamate dehydrogenase (GDH) and compared these with activity. Dynamic neutron scattering was performed with two instruments of different energy resolution, permitting the separate determination of the average dynamical mean square displacements on the sub-approximately 100 ps and sub-approximately 5 ns time scales. The results demonstrate a marked dependence on the time scale of the temperature profile of the mean square displacement. The lowest temperature at which anharmonic motion is observed is heavily dependent on the time window of the instrument used to observe the dynamics. Several dynamical transitions (inflexions of the mean squared displacement) are observed in the slower dynamics. Comparison with the temperature profile of the activity of the enzyme in the same solvent reveals dynamical transitions that have no effect on GDH function.

Calorimetry, Differential Scanning↗
PubMed2004

Very efficient template/primer-independent DNA synthesis by thermophilic DNA polymerase in the presence of a thermophilic restriction endonuclease.

We have found that, in the presence of a thermophilic restriction endonuclease, thermophilic DNA polymerase efficiently synthesizes and amplifies DNA in the absence of any added template and primer nucleic acid under isothermal conditions. More than 10 microg of DNA can be synthesized by 1 unit of DNA polymerase in 1 h, and the reaction proceeds until available dNTPs are consumed. We used mostly the Tsp509I restriction endonuclease (recognition sequence: decreasing AATT), the TspRI restriction endonuclease (recognition sequence: NNCA(G/C)TGNN decreasing), and Vent (exo(-)) and Vent DNA polymerase. The synthesized double-stranded DNA has a highly repetitive palindromic sequence, e.g. (AAAAATTTTT)(n) and (ATACACTGTATATACAGTGTAT)(n). In every repeating unit, there are one or two recognition sites for the restriction enzyme. Our data show that the high efficiency of the restriction-endonuclease-DNA-polymerase (RE-pol) DNA synthesis results from an efficient exponential amplification involving digestion-elongation cycles: a longer DNA with numerous recognition sites for the restriction enzyme is digested to short fragments, and the short fragments are used as seeds for elongation to synthesize longer DNA. A possible role of RE-pol DNA synthesis in the evolutionary development of genetic materials is briefly discussed.

Archaeal Proteins↗
PubMed2003

The dynamic transition in proteins may have a simple explanation.

The transition that has been observed in the dynamics of hydrated proteins at low temperatures (180-230 K) is normally interpreted as a change from vibrational, harmonic motion at low temperatures to anharmonic motions as the temperature is raised. It is taken to be an intrinsic property of proteins and has been associated with the onset of protein functions. Examination of the dynamic behaviour of proteins in solution within a defined timescale window suggests that certain observations can be explained without the need to invoke a discontinuity in the dynamics of proteins with temperature, i.e. the existence of a dynamical transition is not required. This is discussed in the context of recent evidence that enzyme activity is independent of the activation of anharmonic picosecond dynamics and declines steadily with temperature through the apparent dynamic transition, in accordance with the Arrhenius relationship. That similar timescale dependent dynamical behaviour has been observed experimentally in chain polymers, and seen also in computer simulations of silica glasses, suggests that the phenomenon may be of wide general relevance in both simple glassy and more complex polymeric systems.

Enzymes↗
PubMed2004

16 S rDNA primers and the unbiased assessment of thermophile diversity.

Our understanding of thermophile diversity is based predominantly on PCR studies of community DNA. "Universal" and domain-specific rRNA gene PCR primers have historically been used for the assessment of microbial diversity without adequate regard to the degree of specificity of primer pairs to different prokaryotic groups. In a reassessment of the published primers commonly used for "universal" and archaeal 16 S rDNA sequence amplification we note that substantial variations in specificity exist. An unconsidered choice of primers may therefore lead to significant bias in determination of microbial community composition. In particular, Archaea-specific primer sequences typically lack specificity for the Korarchaeota and Nanoarchaea and are often biased towards certain clades. New primer pairs specifically designed for "universal" archaeal 16 S rDNA sequence amplification, with homology to all four archaeal groups, have been designed. Here we present the application of these new primers for preparation of 16 S libraries from thermophile communities.

Base Sequence↗
PubMed2006

Crystal structure of the sugar binding domain of the archaeal transcriptional regulator TrmB.

TrmB is an alpha-glucoside-sensing transcriptional regulator controlling two operons encoding maltose/trehalose and maltodextrin ABC transporters of Pyrococcus furiosus. The crystal structure of an N-terminal truncated derivative of TrmB (amino acids 2-109 deleted; TrmB(delta2-109)) was solved at 1.5 A resolution. This protein has lost its DNA binding domain but has retained its sugar recognition site. The structure represents a novel sugar-binding fold. TrmB(delta2-109) bound maltose, glucose, sucrose, and maltotriose, exhibiting Kd values of 6.8, 25, 34, and 160 microM, respectively. TrmB(delta2-109) behaved as a monomer in dilute buffer solution in contrast to the full-length protein, which is a dimer. Co-crystallization with bound maltose identified a binding site involving seven amino acid residues: Ser229, Asn305, Gly320, Met321, Val324, Ile325, and Glu326. Six of these residues interact with the nonreducing glucosyl residue of maltose. The nonreducing glucosyl residue is shared by all substrates bound to TrmB, suggesting it as a common recognition motif.

Amino Acid Motifs↗
PubMed2004

Equilibrium and kinetic stability of a hyperthermophilic protein, O6-methylguanine-DNA methyltransferase under various extreme conditions.

In this work we have studied the equilibrium and kinetic stability of a hyperthermophilic protein, O(6)-methylguanine-DNA methyltransferase (Tk-MGMT), and its mesophilic counterpart AdaC, in various chemical solutions. In an unfolding experiment using guanidine hydrochloride (GdnHCl), the unfolding free-energy change of Tk-MGMT at 30 degrees C was 42.0 kJ mol(-1), and the half time for unfolding was 4.5 x 10(6) s, which is much slower than that of AdaC and representative mesophilic proteins. In unfolding experiments using methanol, ethanol, 2-propanol, trifluoroethanol (TFE), and sodium dodecyl sulfate (SDS), Tk-MGMT retained its native structure at high concentrations, despite the fact that these chemical solutions affect protein conformations in a number of different ways. Kinetic studies using TFE and SDS indicate that the unfolding rates of Tk-MGMT in these solutions are slow as in GdnHCl. Further, the results of a mutational experiment suggest that an ion-pair network plays a key role in this slow unfolding. This slow rate of unfolding under extreme conditions is a significant property that distinguishes Tk-MGMT from mesophilic proteins.

2-Propanol↗
PubMed1999

Determinants of nucleotide sugar recognition in an archaeon DNA polymerase.

Vent DNA polymerase normally discriminates strongly against incorporation of ribonucleotides, 3'-deoxyribonucleotides (such as cordycepin) and 2',3'-dideoxyribonucleotides. To explore the basis for this discrimination we have generated a family of variants with point mutations of residues in conserved Regions II and III and assayed incorporation of nucleo-tides with modified sugars by these variants, all of which were created in an exonuclease-deficient form of the enzyme. A Y412V variant incorporates ribonucleotides at least 200-fold more efficiently than the wild-type enzyme, consistent with Y412 acting as a 'steric gate' to specifically exclude ribonucleotides. The most striking variants tested involved changes to A488, a residue predicted to be facing away from the nucleotide binding site. The pattern of relaxed specificity at this position roughly correlates with the size of the substituted amino acid sidechain and affects a variety of modified nucleotide sugars.

Amino Acid Sequence↗
PubMed2004

Analyses of PCR products using DNA templates containing a consecutive deoxyinosine sequence.

We determined nucleotide incorporation specificity of four thermostable DNA polymerases opposite deoxyinosine in order to evaluate the mutagenic effect of the presence of a consecutive deoxyinosine sequence during PCR amplification. Deoxycytosine was the only incorporated nucleotide opposite deoxyinosine during PCR amplification, irrespective of origin of DNA polymerase.

Base Pairing↗
PubMed2001

Inhibition of phosphofructokinases by copper(II).

The biochemical inhibition by Cu2+ on eight phylogenetically and biochemically different phosphofructokinases (PFKs) was investigated. The enzymes screened included representatives from thermophilic and mesophilic bacteria, a hyperthermophilic archaeon and a eukaryote, covering all three phosphoryl donor subtypes (ATP, ADP and pyrophosphate). The sensitivities of the enzymes to Cu2+ varied greatly, with the archaeal ADP-PFK being the least and the eukaryote ATP-PFK being the most sensitive. The bacterial ATP- and pyrophosphate-dependent PFKs showed intermediate sensitivity with the exception of the Spirochaeta thermophila enzyme (pyrophosphate-dependent) which was relatively resistant.

Animals↗