SEARCH · PubMed Health

Results for “Translational control”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 415 records · Page 23Linked to original sources

PubMed2006

CPEB3 and CPEB4 in neurons: analysis of RNA-binding specificity and translational control of AMPA receptor GluR2 mRNA.

CPEB is a sequence-specific RNA-binding protein that promotes polyadenylation-induced translation in oocytes and neurons. Vertebrates contain three additional genes that encode CPEB-like proteins, all of which are expressed in the brain. Here, we use SELEX, RNA structure probing, and RNA footprinting to show that CPEB and the CPEB-like proteins interact with different RNA sequences and thus constitute different classes of RNA-binding proteins. In transfected neurons, CPEB3 represses the translation of a reporter RNA in tethered function assays; in response to NMDA receptor activation, translation is stimulated. In contrast to CPEB, CPEB3-mediated translation is unlikely to involve cytoplasmic polyadenylation, as it requires neither the cis-acting AAUAAA nor the trans-acting cleavage and polyadenylation specificity factor, both of which are necessary for CPEB-induced polyadenylation. One target of CPEB3-mediated translation is GluR2 mRNA; not only does CPEB3 bind this RNA in vitro and in vivo, but an RNAi knockdown of CPEB3 in neurons results in elevated levels of GluR2 protein. These results indicate that CPEB3 is a sequence-specific translational regulatory protein.

3' Untranslated Regions↗

PubMed2005

The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex.

Repression of poly(A)-binding protein (PABP) mRNA translation involves the binding of PABP to the adenine-rich autoregulatory sequence (ARS) in the 5'-untranslated region of its own mRNA. In this report, we show that the ARS forms a complex in vitro with PABP, and two additional polypeptides of 63 and 105 kDa. The 63 and 105 kDa polypeptides were identified, as IMP1, an ortholog of chicken zip-code binding polypeptide, and UNR, a PABP binding polypeptide, respectively, by mass spectrometry of the ARS RNA affinity purified samples. Using a modified ribonucleoprotein (RNP) immunoprecipitation procedure we further show that indeed, both IMP1 and UNR bind to the ARS containing reporter RNA in vivo. Although both IMP1 and UNR could bind independently to the ARS RNA in vitro, their RNA-binding ability was stimulated by PABP. Mutational analyses of the ARS show that the presence of four of the six oligo(A) regions of the ARS was sufficient to repress translation and the length of the conserved pyrimidine spacers between the oligo(A) sequences was important for ARS function. The ability of mutant ARS RNAs to form the PABP, IMP1 and UNR containing RNP complex correlates well with the translational repressor activity of the ARS. There is also a direct relationship between the length of the poly(A) RNAs and their ability to form a trimeric complex with PABP, and to repress mRNA translation. UV crosslinking studies suggest that the ARS is less efficient than a poly(A) RNA of similar length, to bind to PABP. We show here that the ARS cannot efficiently form a trimeric complex with PABP; therefore, additional interactions with IMP1 and UNR to form a heteromeric RNP complex may be required for maximal repression of PABP mRNA translation under physiological conditions.

5' Untranslated Regions↗

PubMed2006

IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain.

Repression of poly(A)-binding protein (PABP) mRNA translation involves the formation of a heterotrimeric ribonucleoprotein complex by the binding of PABP, insulin-like growth factor II mRNA binding protein-1 (IMP1) and the unr gene encoded polypeptide (UNR) to the adenine-rich autoregulatory sequence (ARS) located at the 5' untranslated region of the PABP-mRNA. In this report, we have further characterized the interaction between PABP and IMP1 with the ARS at the molecular level. The dissociation constants of PABP and IMP1 for binding to the ARS RNA were determined to be 2.3 nM and 5.9 nM, respectively. Both PABP and IMP1 interact with each other, regardless of the presence of the ARS, through the conserved C-terminal PABP-C and K-homology (KH) III-IV domains, respectively. Interaction of PABP with the ARS requires at least three out of its four RNA-binding domains, whereas KH III-IV domain of IMP1 is necessary and sufficient for binding to the ARS. In addition, the strongest binding site for both PABP and IMP1 on the ARS was determined to be within the 22 nucleotide-long CCCAAAAAAAUUUACAAAAAA sequence located at the 3' end of the ARS. Results of our analysis suggest that both protein x protein and protein x RNA interactions are involved in forming a stable ribonucleoprotein complex at the ARS of PABP mRNA.

5' Untranslated Regions↗

PubMed1992

Translational control by poly(A) elongation during Xenopus development: differential repression and enhancement by a novel cytoplasmic polyadenylation element.

One characteristic of oocyte maturation and embryogenesis in Xenopus laevis is the activation of translationally repressed (masked) maternal mRNAs by cytoplasmic poly(A) elongation. At maturation, poly(A) elongation is controlled by two cis-acting elements in the 3'-untranslated regions (UTRs) of responsive mRNAs, the hexanucleotide AAUAAA and the cytoplasmic polyadenylation element (CPE), consisting of UUUUUAU or other similar sequences. To investigate poly(A) elongation and translational activation during embryogenesis, we have focused on Cl2 RNA, a representative transcript that undergoes these processes. By injecting radiolabeled Cl2 RNA into fertilized eggs and allowing development to proceed, we found that maximal polyadenylation of this RNA is reached by the 4000-cell blastula stage and that it requires two cis-acting elements, the hexanucleotide AAUAAA and a novel CPE, which is dodecauridine. Interestingly, a shortening of the distance between the two elements changes the timing of maximal polyadenylation to the four-cell stage. The injection of a chloramphenicol acetyl transferase (CAT)-Cl2 chimeric RNA into fertilized eggs not only results in embryonic polyadenylation of the transcript but also 5- to 15-fold more CAT activity compared with eggs injected with CAT RNA or CAT-Cl2 chimeric RNA that is prevented from undergoing poly(A) elongation by a mutation in the polyadenylation hexanucleotide. However, eggs injected with a CAT-Cl2 chimeric RNA that is preadenylated but that cannot undergo further poly(A) elongation contain no more CAT activity than eggs injected with the same RNA without a poly(A) tail, suggesting that the process of poly(A) elongation, and not poly(A) tail length, is important for translation. Finally, we show that precocious poly(A) elongation of Cl2 RNA during oocyte maturation is prevented by a large "masking" element that includes the dodecauridine CPE. The dual role of the CPE in both repression and activation of poly(A) elongation is discussed.

Animals↗

PubMed2005

eIF2B, a mediator of general and gene-specific translational control.

eIF2B (eukaryotic initiation factor 2B) is a multisubunit protein that is required for protein synthesis initiation and its regulation in all eukaryotic cells. Mutations in eIF2B have also recently been found to cause a fatal human disease called CACH (childhood ataxia with central nervous system hypomyelination) or VWM (vanishing white matter disease). This review provides a general background to translation initiation and mechanisms known to control eIF2B function, before describing molecular genetic and biochemical analysis of eIF2B structure and function, integrating work from studies of the yeast and mammalian eIF2B proteins.

Animals↗

PubMed2004

Translational control by internal ribosome entry site in Saccharomyces cerevisiae.

To confirm the active involvement of the internal ribosome entry site (IRES)-dependent translation in living eukaryotes, Saccharomyces cerevisiae and HAP4 IRES were used for in vitro and in vivo experiments. Since HAP4 protein might be required for activating mRNAs transcription in yeast cells when they are released from catabolite repression, the translational efficiency of HAP4 mRNA is presumed to increase under such a condition. The in vitro experiment showed clearly that the translational mechanism was shifted from the cap-dependent to the completely IRES-dependent translation when the yeast cells were derepressed from catabolite repression. From in vivo experiment, it was confirmed that the IRES-dependent translational efficiency was in a low level at the beginning of the stationary growth phase, and was enhanced at the glucose-exhausted phase. These results indicate that yeast cells on the catabolite derepressed condition could get a large amount of HAP4 protein for the completely IRES-dependent translation, while the IRES-dependent translational efficiency is increased. It has been proven that IRES functions directing the initiation of translation in living yeast cells.

Gene Expression Regulation, Fungal↗

PubMed2006

Gene expression during acute and prolonged hypoxia is regulated by distinct mechanisms of translational control.

Hypoxia has recently been shown to activate the endoplasmic reticulum kinase PERK, leading to phosphorylation of eIF2alpha and inhibition of mRNA translation initiation. Using a quantitative assay, we show that this inhibition exhibits a biphasic response mediated through two distinct pathways. The first occurs rapidly, reaching a maximum at 1-2 h and is due to phosphorylation of eIF2alpha. Continued hypoxic exposure activates a second, eIF2alpha-independent pathway that maintains repression of translation. This phase is characterized by disruption of eIF4F and sequestration of eIF4E by its inhibitor 4E-BP1 and transporter 4E-T. Quantitative RT-PCR analysis of polysomal RNA indicates that the translation efficiency of individual genes varies widely during hypoxia. Furthermore, the translation efficiency of individual genes is dynamic, changing dramatically during hypoxic exposure due to the initial phosphorylation and subsequent dephosphorylation of eIF2alpha. Together, our data indicate that acute and prolonged hypoxia regulates mRNA translation through distinct mechanisms, each with important contributions to hypoxic gene expression.

Adaptor Proteins, Signal Transducing↗

PubMed1988

Translational control in E. coli: the case of threonyl-tRNA synthetase.

Genetic studies have shown that expression of the E. coli threonyl-tRNA synthetase (thrS) gene is negatively auto-regulated at the translational level. A region called the operator, located 110 nucleotides downstream of the 5' end of the mRNA and between 10 and 50 bp upstream of the translational initiation codon in the thrS gene, is directly involved in that control. The conformation of an in vitro RNA fragment extending over the thrS regulatory region has been investigated with chemical and enzymatic probes. The operator locus displays structural similarities to the anti-codon arm of threonyl tRNA. The conformation of 3 constituent mutants containing single base changes in the operator region shows that replacement of a base in the anti-codon-like loop does not induce any conformational change, suggesting that the residue concerned is directly involved in regulation. However mutation in or close to the anti-codon-like stem results in a partial or complete rearrangement of the structure of the operator region. Further experiments indicate that there is a clear correlation between the way the synthetase recognises each operator, causing translational repression, and threonyl-tRNA.

Amino Acyl-tRNA Synthetases↗

PubMed1983

Haploid accumulation and translational control of phosphoglycerate kinase-2 messenger RNA during mouse spermatogenesis.

The intracellular location of the mRNA for the testis-specific isozyme of phosphoglycerate kinase-2 (PGK-2) has been determined for two spermatogenic cell types. The mRNA activity for PGK-2 from the polysomal and nonpolysomal fractions of pachytene primary spermatocytes or round spermatids has been assayed by cell-free translation with the polypeptide products monitored by immunoprecipitation, followed by one-dimensional or two-dimensional electrophoresis and fluorography. The results reveal that the majority of PGK-2 mRNA activity of round spermatids was present in the polysomal fraction while the relatively less abundant PGK-2 mRNA of pachytene primary spermatocytes was present in the nonpolysomal fraction. No PGK-2 mRNA activity was observed in the cytoplasmic RNA from primitive type A spermatogonia or prepubertal Sertoli cells. These data indicate that mature PGK-2 mRNA first appears in the cytoplasm of spermatogenic cells during the prophase of meiosis and increases in amount after meiosis. Although mature PGK-2 mRNA is present in meiotic cells it is not actively translated until after meiosis has been completed. Thus, mRNA accumulation and translational mechanisms are involved in the control of phosphoglycerate kinase-2 synthesis during spermatogenesis.

Animals↗

PubMed1991

The 5' untranslated regions of acetyl-coenzyme A carboxylase mRNA provide specific translational control in vitro.

Acetyl-coenzyme A carboxylase (ACC) catalyzes the rate-limiting step in the biosynthesis of long-chain fatty acids. Transcription of the single-copy ACC gene from two independent promoters, together with the differential splicing of the transcripts, gives rise to mature ACC mRNA having the same open reading frame (ORF), but exhibiting heterogeneity in their 5' untranslated region (5'-UTR). Class 1 ACC mRNA are transcribed from the inducible promoter 1 and their 5'-end leading sequences are provided by exon 1. Class 2 ACC mRNA are transcribed from the constitutively expressing promoter 2 and their leading sequences are derived from exon 2. In order to understand the role of different 5' UTR of ACC mRNA we have synthesized in vitro transcripts with defined ACC mRNA 5' UTR and examined their relative translational efficiencies in rabbit reticulocyte lysates. The major translation product of both forms of ACC mRNA was initiated at the first AUG of the ORF. Class 1 transcripts had a 6-9-fold better translational efficiency than class 2 transcripts, based on the quantity of major peptide produced by a given amount of transcript. The poor translational efficiency of class 2 transcripts can be improved by the removal of sequences contributed by exon 2, suggesting that they play an inhibitory role in the translation of class 2 types of ACC mRNA. In addition to their higher translational efficiency, the class 1 transcripts can also initiate translation at in-frame non-AUG codons, located in exon 1, i.e. upstream to the starting AUG of the common ACC mRNA ORF. This results in novel ACC peptides with extended N termini. These observations are consistent with the hypothesis that the 5' UTR heterogeneity in the ACC mRNA may be involved in post-transcriptional control, at the level of translation, of the ACC gene expression.

Acetyl-CoA Carboxylase↗

PubMed1997

Repression of beta-actin synthesis and persistence of ribosomal protein synthesis after infection of HeLa cells by herpes simplex virus type 1 infection are under translational control.

Synthesis and assembly of ribosomal proteins into mature ribosomes persist late after infection of cells with herpes simplex virus type 1, while synthesis of beta-actin is drastically shut off. Since mRNAs encoding ribosomal proteins and beta-actin undergo concomitant degradation in infected HeLa cells, we have advanced the hypothesis that translation of the remaining mRNAs is differentially controlled after infection. The behaviour of mRNAs for three ribosomal proteins and for beta-actin was investigated during the course of infection. In uninfected cells, beta-actin mRNAs are associated with large polyribosomes, while only a part of ribosomal protein mRNAs are present in polyribosomes. In the course of infection, beta-actin mRNAs are released from the ribosomes and are sequestered with 40S ribosomal subunits. Simultaneously, ribosomal protein mRNAs become associated with an increased number of ribosomes, even late in infection. In addition, virally induced phosphorylation of ribosomal protein S6 is more efficient in pre-existing ribosomes than in newly assembled ribosomes. These results indicate that in infected cells (i) translation of beta-actin mRNA is selectively inhibited at a step necessary for binding the 60S ribosomal subunits; (ii) the rate of initiation of translation of ribosomal protein mRNAs increases after infection; and (iii) it is likely that translation of ribosomal protein mRNAs takes place preferentially on pre-existing ribosomes.

Actins↗

PubMed1996

Translational control of endogenous and recoded nuclear genes in yeast mitochondria: regulation and membrane targeting.

Mitochondrial gene expression in yeast, Saccharomyces cerevisiae, depends on translational activation of individual mRNAs by distinct proteins encoded in the nucleus. These unclearly coded mRNA-specific translational activators are bound to the inner membrane and function to mediate the interaction between mRNAs and mitochondrial ribosomes. This complex system, found to date only in organelles, appears to be an adaptation for targeting the synthesis of mitochondrially coded integral membrane proteins to the membrane. In addition, mRNA-specific translational activation is a rate-limiting step used to modulate expression of at least one mitochondrial gene in response to environmental conditions. Direct study of mitochondrial gene regulation and the targeting of mitochondrially coded proteins in vivo will now be possible using synthetic genes inserted into mtDNA that encode soluble reporter/passenger proteins.

Cell Nucleus↗

PubMed1999

Translational control of nuclear lamin B1 mRNA during oogenesis and early development of Xenopus.

Cytoplasmic polyadenylation of specific mRNAs is commonly correlated with their translational activation during development. A canonical nuclear polyadenylation element AAUAAA (NPE) and cytoplasmic polyadenylation element(s) (CPE) are necessary and sufficient for polyadenylation during egg maturation. We have characterized cis-acting sequences of Xenopus nuclear lamin B1 mRNA that mediate translational regulation. By injection of synthetic RNAs into oocytes we show that the two CPE-like elements found in the 3'-untranslated region of B1 mRNA act as translational repressors in oocytes. The same CPEs in conjunction with the NPE confer transient polyadenylation and translational activation during egg maturation. Poly(A) length determination of the endogenous lamin B1 mRNA reveals a gradual increase of poly(A) tail length in early development up to mid-blastula, and a shortening of poly(A) tails during gastrulation and neurulation. The same kinetic and extent of polyadenylation and poly(A) tail shortening is observed with synthetic RNAs injected into fertilized eggs. Polyadenylation and translational activation of these RNAs is independent of the two CPEs and a NPE during early development. While translational regulation of lamin B1 mRNA functions in parts via established mechanisms, the pattern of polyadenylation and deadenylation during early development points to a novel mode of translational regulation.

3' Untranslated Regions↗

PubMed1991

Stress-Induced Translational Control in Potato Tubers May Be Mediated by Polysome-Associated Proteins.

Potato tubers exhibit distinct responses to wounding and hypoxia that include selective translation of stress-induced mRNAs. Newly synthesized wound-response mRNAs are bound to polysomes, whereas preexisting mRNAs are displaced and degraded. mRNAs that are induced and translated during hypoxic conditions are bound to ribosomes as expected. However, preexisting wound-response mRNAs whose translation is inhibited during hypoxia remain bound to polysomes, indicating that there are at least two distinct mechanisms by which translation is regulated in response to stress conditions. A 32-kD phosphoprotein is associated with polyribosomes from wounded tubers. This protein remains polysome bound as long as wound-response mRNAs are present, even during hypoxia when these mRNAs are no longer translated. However, association of the 32-kD protein with polysomes is not elicited by hypoxic stress alone. The kinase that phosphorylates this protein is active only for the first 24 hr after wounding and is not active during periods of hypoxia. This protein may mediate recognition of the wound-response mRNAs by ribosomes.

Journal Article↗

PubMed1989

Circadian regulation of bioluminescence in Gonyaulax involves translational control.

A 10-fold circadian variation in the amount of luciferin binding protein (LBP) in the marine dinoflagellate Gonyaulax polyedra is reported. This protein binds and stabilizes luciferin, the bioluminescence substrate. In early night phase, when bioluminescence is increasing and LBP levels are rising in the cell, pulse labeling experiments show that LBP is being rapidly synthesized in vivo. At other times, the rate of LBP synthesis is at least 50 times lower, while the rate of synthesis of most other proteins remains the same. The LBP mRNA levels, as determined by in vitro translations and by RNA (Northern) hybridizations, do not vary over the daily cycle, indicating that circadian control of bioluminescence in this species is mediated by translation.

Animals↗

PubMed1988

Expression of the human interferon-alpha 1 gene under transcriptional and translational control of the speA gene.

The human gene for mature interferon-alpha 1 (IFN-alpha 1) was inserted in a new transcription-translation fusion vector system based on the expression and secretion signals of the gene for type A streptococcal pyrogenic exotoxin, speA. As deduced from the known nucleotide sequences of the component elements, the encoded IFN-alpha 1 was a fusion protein carrying an N-terminal extension of 17 amino acids. When inserted in appropriate vectors capable of replication in Escherichia coli, Bacillus subtilis and Streptococcus sanguis, this expression configuration directed the synthesis of antiviral activity in all 3 organisms, as judged by the cythopathic effect inhibition assay of Vesicular Stomatitis Virus. In E. coli JM101, IFN activity was found mainly in the cytoplasmic protein fraction whereas in the gram-positive hosts, it was completely secreted into the culture medium.

Amino Acid Sequence↗

PubMed2003

Translational control of protein synthesis in muscle and liver of growth hormone-treated pigs.

GH treatment increases protein deposition and the efficiency of dietary protein used for growth. To identify the mechanisms that regulate tissue protein synthesis in response to exogenous GH treatment, fully fed, growing swine were treated with GH for 7 d. Fasted and fed pigs were infused with [1-(13)C]leucine to determine protein synthesis rates, and translation initiation factor activity levels were measured in skeletal muscle and liver. Feeding increased protein synthesis and translational efficiency in both muscle and liver of control and GH-treated pigs, and this was associated with increased 4E-BP1 and S6 kinase 1 phosphorylation, decreased association of eukaryotic initiation factor (eIF) 4E with 4E-BP1, and increased association of eIF4E with eIF4G. GH increased muscle protein synthesis and translational efficiency in fed pigs. GH increased liver protein synthesis of fasted and fed pigs in association with increased ribosome number. In muscle, but not liver, GH increased eIF2B activity and 4E-BP1 phosphorylation in both the fasted and fed state and increased the association of eIF4E with eIF4G in the fed state. We conclude that GH increases muscle protein synthesis in the fed state, in part, via mechanisms that enhance the binding of mRNA and methionyl-tRNA to the 40S ribosomal subunit, whereas GH increases liver protein synthesis in the fasted and fed states by increasing ribosome number. The results further indicate that the GH-induced protein synthetic response is dependent upon nutritional state and is tissue specific.

Animals↗

PubMed1989

Conserved structural domains in the 5'-untranslated region of picornaviral genomes: an analysis of the segment controlling translation and neurovirulence.

A model of secondary structure common for the central part (ca. 400 nucleotides) of the 5'-untranslated regions (5'-UTR) of all the so far sequenced genomes of polioviruses, coxsackieviruses, and rhinoviruses was derived on the basis of evolutionary and thermodynamic considerations. According to the model, this part of the genome comprises three domains, which appear to be involved, at least in the poliovirus genome, in the control of viral neurovirulence and in vitro translation. Some salient features of this model were supported by investigating RNAs of five poliovirus and one coxsackievirus strains with respect to their accessibility to modifications with dimethyl sulfate and sensitivity to single-strand- and double-strand-specific nucleases. In contrast to the previous suggestion, no major changes in the conformation of the Sabin vaccine poliovirus type 3 5'-UTR due to the transition in position 472 were observed. The biological relevance of the conserved primary and secondary structure elements in the picornaviral 5'-UTRs is discussed.

Base Sequence↗