SEARCH · PubMed Health

Results for “TLE”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 433 records · Page 24Linked to original sources

PubMed2001

Surgery for temporal lobe epilepsy in older patients.

OBJECT: The goal of this study was to evaluate the efficacy of surgery for temporal lobe epilepsy (TLE) in older (> or = 50 years of age) patients. METHODS: The authors conducted a review of all patients 50 years of age or older with TLE surgically treated at the Montreal Neurological Institute and Hospital since 1981 by one surgeon (A.O.). Only patients without a mass lesion were included. Outcome parameters were compared with those of younger individuals with TLE, who were stratified by age at operation. In patients aged 50 years and older, the onset of complex partial seizures occurred 5 to 53 years (mean 35 years) prior to the time of surgery. Postoperatively, over a mean follow-up period of 64 months, 15 patients (83%) obtained a meaningful improvement, becoming either free from seizures or only experiencing a rare seizure. Most surgery outcomes were similar in both older and younger individuals, except for a trend to more freedom from seizures and increased likelihood of returning to work or usual activities in the younger patients. Note that a patient's long-standing seizure disorder did not negatively affect their ability to achieve freedom from seizures following surgery. CONCLUSIONS: Surgery for TLE appears to be effective for older individuals, comparing favorably with results in younger age groups, and carries a small risk of postoperative complications.

Adolescent↗

PubMed2002

Extravascular collagen in the human epileptic brain: a potential substrate for aberrant cell migration in cases of temporal lobe epilepsy.

OBJECT: Several lines of evidence have demonstrated a number of cellular changes that occur within the hippocampus in patients with temporal lobe epilepsy (TLE). These include aberrant migration of granule cells and sprouting of mossy fibers, processes that have been linked to the hyperexcitability phenomenon observed in cases of TLE. In the present study the authors examined brain tissues obtained in patients undergoing temporal lobectomy surgery and in patients at autopsy (normal human control specimens), and compared the subcellular composition of regions of the hippocampus containing dispersed granule cells. METHODS: Six human hippocampi were obtained in patients undergoing temporal lobectomies for intractable seizures. The patients ranged in age from 24 to 50 years. Two of the six patients had a history of head trauma and one had experienced a febrile seizure during childhood. Immediately following excision from the brain, the tissue was placed in an acrolein-paraformaldehyde fixative. The hippocampi were processed along with six human brain control specimens obtained at autopsy for light and electron microscopic evaluation. The tissues were then labeled for collagen types I through IV. Positive collagen labeling was identified, with the aid of both light and electron microscopy, in the parenchyma of all patients with TLE but not in the control tissues. CONCLUSIONS: The authors report the first localization of collagen outside of the vasculature and meninges in the brains of patients with TLE. Recent evidence of collagen's chemoattractant properties and its role in epileptogenesis in animal models suggests that collagen may play a role in cellular migration and seizure activity in a subset of patients. Further studies with a larger series of patients are warranted.

Adult↗

PubMed2002

Prognostic factors and outcome after different types of resection for temporal lobe epilepsy.

OBJECT: It is unknown whether different resection strategies for temporal lobe epilepsy (TLE) produce alterations in seizure control or neuropsychological performance. METHODS: A series of 321 patients who underwent surgery for TLE between 1989 and 1997 was submitted to a uni- and multifactorial analysis of clinical, electrophysiological, neuroimaging, neuropsychological, and surgical factors to determine independent predictors of outcome. Until 1993, most patients with TLE underwent standard anterior temporal lobectomy (ATL); beginning in 1993, surgical procedures were increasingly restricted to lesions detected on magnetic resonance (MR) imaging and the presumed epileptogenic foci: for example, amygdalohippocampectomy (AH) or lesionectomy/corticectomy began to be used more often. The mean follow-up duration in this study was 38 months. Two hundred twenty-seven patients were classified as seizure free (70.7%), and 36 patients had rare and nondisabling seizures (11.2%); these groups were summarized as having good seizure control (81.9%). Twenty-four patients attained more than 75% improvement (7.5%), and no worthwhile improvement was seen in 34 cases (10.6%); these groups were summarized as having unsatisfactory seizure control (18.1%). On unifactorial analysis the following preoperative factors were associated with good seizure control (p < 0.05): single and concordant lateralizing focus on electroencephalography studies, low seizure frequency, absence of status epilepticus, concordant lateralizing memory deficit, clear abnormality on MR images, suspected ganglioglioma or dysembryoplastic neuroepithelial tumor (DNT), and absence of dysplasia on MR images. Stepwise logistic regression revealed a model containing five factors that were predictive for good seizure control (p < 0.1): 1) clear abnormality on MR images; 2) absence of status epilepticus; 3) MR imaging-confirmed ganglioglioma or DNT; 4) concordant lateralizing memory deficit; and 5) absence of dysplasia on MR images. Seizure outcome was mainly correlated with diagnosis and clinical factors. No significant differences were found regarding different resection types performed for comparable tumors. Neuropsychological testing revealed better postoperative results after limited resections compared with standard ATL, especially with regard to attention level, verbal memory, and calculated total neuropsychological performance. CONCLUSIONS: Different strategies for surgical approaches in TLE result in equally good outcomes. Seizure outcome is mainly dependent on the diagnosis and clinical factors, whereas the neuropsychological results are more beneficial after resections limited to an epileptogenic lesion and focus.

Adolescent↗

PubMed2005

Electro-clinical characteristics and postoperative outcome of medically refractory tumoral temporal lobe epilepsy.

BACKGROUND: Very few studies have specifically addressed surgical treatment and outcome of patients with tumor-related temporal lobe epilepsy (TLE). AIM: To define the postoperative seizure outcome and the factors that influenced the outcome of patients with tumor-related TLE. MATERIALS AND METHODS: We selected patients whose surgical pathology revealed a temporal lobe neoplasm and who had completed > 1 year of postoperative follow-up. We reviewed the clinical, EEG, radiological and pathological data, and the seizure outcome of these patients and assessed the factors that influenced the outcome. RESULTS: Out of the 409 patients who underwent surgery for refractory TLE during the 8-year study period, there were 34 (8.3%) patients with temporal lobe neoplasms. The median age at surgery was 20 years and the median duration of epilepsy prior to surgery was 9.0 years. MRI revealed tumor in the mesial location in 21 (61.8%) patients. Interictal and ictal epileptiform EEG abnormalities were localized to the side of th lesion in the majority. Mesial temporal lobe structures were included in the resection, if they were involved by the tumor; otherwise, lesionectomy alone was performed. During a median follow-up of 4 years, 27 (79%) patients were completely seizure-free. The only factor that predicted long-term seizure-free outcome was being seizure-free during the first two postoperative years. CONCLUSIONS: Our results emphasize the fact that in patients with tumoral TLE, when the seizures are medically refractory, surgery offers potential for cure of epilepsy in the majority.

Adolescent↗

PubMed2000

Lack of association between temporal lobe epilepsy and a novel polymorphism in the alpha 2 subunit gene (ATP1A2) of the sodium potassium transporting ATPase.

Genetic linkage studies in rodents and humans have identified specific chromosomal regions harboring seizure susceptibility genes. We have identified a novel polymorphism in the human alpha 2 subunit gene (ATP1A2) of the sodium potassium transporting ATPase (NaK-pump), a candidate gene for human temporal lobe epilepsy (TLE) based on its chromosomal location and function in ion homeostasis. The polymorphism consists of a four base pair insertion 12 base pairs upstream of the start of exon 2. We performed an association study between this polymorphism and TLE. Our study did not find a significant difference in the frequency of this polymorphism between TLE patients and controls, indicating that this variation is not a major susceptibility factor. However, since the number of patients studied so far is small and the functional consequence of the polymorphism is unknown, the variation may yet be found to play a minor role in increased risk for seizure susceptibility. In contrast to the findings in TLE patients and controls, we did find a significant difference in the frequency of the variation between African Americans and persons of European descent. This finding demonstrates the potential effect of population stratification on studies of this type and supports the growing use of parental and familial samples for controls in association studies. Further study of this polymorphism is warranted as it may be involved in other disease processes for which there are known ethnic-specific susceptibilities. Am. J. Med. Genet. (Neuropsychiatr. Genet.) 96:79-83, 2000.

Base Sequence↗

PubMed2000

Selective alterations in GABAA receptor subtypes in human temporal lobe epilepsy.

Temporal lobe epilepsy (TLE) is associated with impaired inhibitory neurotransmission. Studies in animal models suggest that GABA(A) receptor dysfunction contributes to epileptogenesis. To understand the mechanisms underlying TLE in humans, it is fundamental to determine whether and how GABA(A) receptor subtypes are altered. Furthermore, identifying novel receptor targets is a prerequisite for developing selective antiepileptic drugs. We have therefore analyzed subunit composition and distribution of the three major GABA(A) receptor subtypes immunohistochemically with subunit-specific antibodies (alpha1, alpha2, alpha3, beta2,3, and gamma2) in surgical specimens from TLE patients with hippocampal sclerosis (n = 16). Profound alterations in GABA(A) receptor subtype expression were observed when compared with control hippocampi (n = 10). Although decreased GABA(A) receptor subunit staining, reflecting cell loss, was observed in CA1, CA3, and hilus, the distinct neuron-specific expression pattern of the alpha-subunit variants observed in controls was markedly changed in surviving neurons. In granule cells, prominent upregulation mainly of the alpha2-subunit was seen on somata and apical dendrites with reduced labeling on basal dendrites. In CA2, differential rearrangement of all three alpha-subunits occurred. Moreover, there was layer-specific loss of alpha1-subunit-immunoreactive interneurons in hippocampus proper, whereas surviving interneurons exhibited extensive changes in dendritic morphology. Throughout, expression patterns of beta2,3- and gamma2-subunits largely followed those of alpha-subunit variants. These results demonstrate unique subtype-specific expression of GABA(A) receptors in human hippocampus. The significant reorganization of distinct receptor subtypes in surviving hippocampal neurons of TLE patients with hippocampal sclerosis underlines the potential for synaptic plasticity in the human GABA system.

Adolescent↗

PubMed2000

Mitochondrial complex I deficiency in the epileptic focus of patients with temporal lobe epilepsy.

Mitochondria are cellular organelles crucial for energy supply and calcium homeostasis in neuronal cells, and their dysfunction causes seizure activity in some rare human epilepsies. To directly test whether mitochondrial respiratory chain enzymes are abnormal in the most common form of chronic epilepsy, temporal lobe epilepsy (TLE), living human brain specimens from 57 epileptic patients and 2 nonepileptic controls were investigated. In TLE patients with a hippocampal epileptic focus, we demonstrated a specific deficiency of complex I of the mitochondrial respiratory chain in the hippocampal CA3 region. In contrast, TLE patients with a parahippocampal epileptic focus showed reduced complex I activity only in parahippocampal tissue. Inhibitor titrations of the maximal respiration rate of intact human brain slices revealed that the observed reduction in complex I activity is sufficient to affect the adenosine triphosphate production rate. The abnormal complex I activity in the hippocampal CA3 region was paralleled by increased succinate dehydrogenase staining of neurons and marked ultrastructural abnormalities of mitochondria. Therefore, mitochondrial dysfunction is suggested to be specific for the epileptic focus and may constitute a pathomechanism contributing to altered excitability and selective neuronal vulnerability in TLE.

Adolescent↗

PubMed2001

Ictal hyperperfusion of cerebellum and basal ganglia in temporal lobe epilepsy: SPECT subtraction with MRI coregistration.

UNLABELLED: The ictal hyperperfusion (compared with the interictal state) of the cerebellum and basal ganglia has not been investigated systematically in patients with temporal lobe epilepsy (TLE). Their ictal perfusion patterns were analyzed in relation to temporal and frontal hyperperfusion during TLE seizures using SPECT subtraction. METHODS: Thirty-three TLE patients had interictal and ictal SPECT, video-electroencephalographic (EEG) monitoring, and volumetric MRI. SPECT subtraction with MRI coregistration was performed using commercial software. The presence of ictal hyperperfusion was determined in the ipsilateral and contralateral temporal lobe, frontal lobe, cerebellum, and basal ganglia. RESULTS: All patients showed ictal hyperperfusion in the temporal lobe of seizure origin. Vermian cerebellar hyperperfusion (CH) was observed in 26 patients (78.8%) and hemispheric CH was found in 25 (75.8%). Compared with the side of the epileptogenic temporal lobe, there were 7 patients with ipsilateral hemispheric CH (28.0%), 15 with contralateral hemispheric CH (60.0%), and 3 with bilateral hemispheric CH (12.0%). CH was observed more frequently in patients with additional frontal hyperperfusion (14/15, 93.3%; 2 ipsilateral to the seizure focus, 10 contralateral, and 2 bilateral) than in patients without frontal hyperperfusion (11/18, 61.1%). Among 18 patients with temporal hyperperfusion without frontal hyperperfusion, 11 patients showed hemispheric CH (5 ipsilateral to seizure focus, 5 contralateral, 1 bilateral). Hyperperfusion in the basal ganglia (BGH) was seen in 11 of the 15 patients with temporal and frontal hyperperfusion (73.3%) and in 11 of the 18 with only temporal hyperperfusion (61.1%). In 17 patients with unilateral BGH (13 ipsilateral to the seizure focus, 4 contralateral), CH contralateral to the BGH was observed in 14 (82.5%), CH ipsilateral to the BGH was found in 2 (11.8%), and CH bilateral to the BGH was found in 1 (5.9%). CONCLUSION: During TLE seizures, hemispheric CH occurred not only in contralateral but also in ipsilateral or bilateral cerebellar hemispheres to the side of seizure origin. Although temporal lobe origin seizures associated with additional frontal hyperperfusion produced more frequent hemispheric CH, seizures showing only temporal hyperperfusion without frontal hyperperfusion could produce BGH and CH. To determine the side of hemispheric CH, the most important factor appears to be the side of BGH, not the side of seizure origin.

Adolescent↗

PubMedDate not supplied

Olfactory dysfunction in schizophrenia and temporal lobe epilepsy.

BACKGROUND: Schizophrenia and mesial temporal lobe epilepsy (TLE) represent two common brain disorders that share dysfunction of temporo-limbic neural substrates. OBJECTIVE: We evaluated whether patients with schizophrenia exhibited olfactory performance more similar to right or left temporal lobe epilepsy patients. METHODS: Odor identification ability and detection threshold sensitivity were measured in 40 patients with schizophrenia, 14 patients with right- and 18 patients with left-temporal lobe epilepsy (TLE) patients, and 25 healthy controls. Odor identification was assessed with the University of Pennsylvania Smell Identification Test (UPSIT) and odor detection threshold sensitivity with a single-staircase procedure using the stimulant phenyl ethyl alcohol (PEA). RESULTS: Relative to controls, only patients with schizophrenia and right TLE exhibited significant impairment in UPSIT performance. Left TLE patients and controls performed comparably on the UPSIT. Detection threshold sensitivity to PEA did not differ significantly among the four groups. CONCLUSIONS: These data suggest a greater reliance of olfactory processing on right hemisphere structures and are also consistent with recent neuroimaging studies that have implicated aberrant processing of olfactory information in right hemispheric brain regions in schizophrenia.

Adult↗

PubMed2001

[Comparison of (1)H MRS, PET and EEG in lateralization of temporal lobe epilepsy].

OBJECTIVE: To evaluate and compare the role of (1)H MRS, PET and EEG in lateralization diagnosis (LD) of temporal lobe epilepsy (TLE). METHODS: 15 patients with intractable TLE verified by operation and pathology were studied. Before unilateral anterior temporal lobectomy, (1)H MRS, PET and EEG were performed for the LD of TLE. The diagnostic value of (1)H MRS, PET and EEG was compared based on the pathology and follow-up results. RESULTS: With video scalp EEG monitoring, the focus was localized in one temporal lobe for 13 patients among which 5 had abnormal waves conducted to the contralateral lobe. Intracranial EEG was performed for other 2 patients because scalp EEG failed to make the LD. Ultimately, partial temporal lobectomy was performed in all patients based on LD by scalp EEG or intracranial EEG. The pathological findings of operation specimens showed various degree of hippocampal sclerosis. The surgery was proved to be effective by follow-ups of all 15 patients, with their conditions controlled in 12 cases and better in two. EEG succeeded to make correct LD in all cases. (1)H MRS made correct LD in 12 cases (80%) and incorrect LD in 1 case, and failed to made LD in 2 cases. Five bilateral abnormalities (33%) were found by MRS. FDG-PET made correct LD in 14 cases (93%) and incorrect LD in 1 case, and found two cases with bilateral abnormalities (13%). CONCLUSION: (1)H MRS, PET and EEG are all effective means in LD of TLE. Up to now, scalp EEG is the first choice and continuous video EEG monitoring has its own unique advantage. As a kind of simple, noninvasive and objective method, MRS can be used as a routine examination in conjunction with conventional MRI. Although PET is quite sensitive, it is expensive and has a number of limitations. So it can be used depending on the affordability of patients or diagnostic need. Combination of MRI, MRS, PET and scalp EEG may improve the reliability of the LD compared with use of any one of them alone. While the results of these methods are controversial, intracranial EEG is inevitable.

Adolescent↗

PubMed2002

Correlation between PET and SISCOM in temporal lobe epilepsy.

UNLABELLED: The subtraction of interictal from ictal SPECT coregistered to 3-dimensional (3D) MRI (SISCOM) and (18)F-FDG PET are 2 techniques that are involved in the definition of the epileptogenic zone in refractory partial temporal lobe epilepsy (TLE). The aim of this study was compare, region by region, the functional patterns obtained by both strategies, SISCOM and PET, in patients with unilateral TLE. METHODS: Perfusion data using SISCOM and metabolic data using (18)F-FDG PET scans were acquired from 17 patients with unilateral TLE. The functional metabolism and perfusion maps were overlaid onto a 3D rendering of the patient's anatomic MRI scans. RESULTS: The functional patterns that were observed with PET and SISCOM were found mainly in the ipsilateral and contralateral temporal lobes, in the orbitofrontal and insular cortices. Despite the high rate of concordance, in some cases discrepancies could be observed between PET and SISCOM abnormalities: In the mesial regions, as in the anterior neocortex, PET abnormalities were found more frequently than SISCOM changes. SISCOM abnormalities were found more frequently in the posterior temporal neocortex. In the extratemporal cortex, SISCOM abnormalities were more widespread. CONCLUSION: The marked rate of concordance between PET and SISCOM abnormalities observed in relatively extensive regions shows that, in TLE, seizures were generated and spread in metabolically abnormal regions.

Adult↗

PubMed2003

Surgery of intractable temporal lobe epilepsy presented with structural lesions.

BACKGROUND: Structural lesions are found in about 30% of surgical specimens resected for intractable temporal lobe epilepsy (TLE). Detailed presurgical evaluations can identify the epileptogenic foci, the structural lesions and their correlation. Different surgical approaches have variable seizure control outcomes. METHODS: The preoperative investigations for the intractable TLE consisted of serial electroencephalogram (EEG) recordings, long-term EEG/video monitoring with sphenoidal electrodes, magnetic resonance imaging (MRI), magnetic resonance spectroscopy (MRS), positron emission tomography with fluorodeoxyglucose (FDG-PET) and neuropsychological assessment. Among the 217 patients who underwent anterior temporal lobectomy (ATL) for TLE at Taipei Veterans General Hospital between 1987 and 1998, 47 (21.7%) had structural lesions in the resected specimen. The patients were divided into neoplastic (n = 35) and vascular (n = 12) groups, based on the pathological findings. RESULTS: In the neoplastic group, the interictal scalp-sphenoidal EEG recordings were abnormal in all 35 cases and lateralizing in 30 (85.7%). MRI revealed tumor growth within the temporal lobe in 26 patients (74.3%). FDG-PET was performed on 17 patients. Fifteen (88.2%) of them revealed unilateral mesial temporal lobe hypometabolism. In the vascular group, the interictal EEG tracings revealed unilateral mesial temporal lobe spikes in 11 patients (91.6%). MRI revealed abnormal enhanced lesions within the temporal lobes in all 12 patients. FDG-PET was available for 7 patients, 6 (86%) of whom had unilateral mesial temporal lobe hypometabolism. At the last follow-up (range 2-10 years, with a mean period of 4.2 years), 25 patients (73%) in the neoplastic group became and remained seizure-free postoperatively, 3 (9%) had fewer than 3 attacks per year. Among the vascular group, all 12 patients became and remained seizure-free after surgery. CONCLUSIONS: For intractable TLE with structural lesions, detailed presurgical evaluations are mandatory to identify the concordance of the lesions and the epileptogenic foci. Standard ATL with removal of the lesion may offer good seizure control postoperatively.

Brain Neoplasms↗

PubMedDate not supplied

[Mesial temporal lobe epilepsy: its physiopathology, clinical characteristics, treatment and prognosis].

INTRODUCTION: The prevalence of epilepsy in the population is between 15 and 18 per 1000. About 60 to 80% of the people affected are considered to have an appropriate long term prognosis (from 5 to 10 years), while between 20 and 40% respond partially to pharmacological therapy. Temporal lobe epilepsy (TLE) is the main cause of refractory epilepsies and is associated to atrophy and sclerosis of the hippocampus. Aims. To determine the physiopathology, clinical characteristics, modes of therapy and prognosis of TLE through a survey of the literature. DEVELOPMENT: The physiopathology of this disease is unknown but early brain injury, with ensuing neuronal death and loss, triggered by mechanisms of excitotoxicity has been put forward as an explanation. TLE presents a clinical picture, which is heterogeneous in childhood and homogeneous in adulthood, that is characterised by the presence of simple partial seizures and complex partial seizures. These seizures can become generalised. Diagnosis is based on the results from the electroencephalogram and from the cranial magnetic resonance, which is currently considered to be the standard diagnostic method. The pharmacological treatment of TLE only achieves complete control over the seizures in less than 20% of patients. Surgical methods, such as anterior temporal lobectomy and amygdalohippocampectomy, reach control rates in 67 85% of patients, with low morbidity and mortality rates. Although prognosis depends on a number of factors, surgical treatment improves the quality of life of these patients.

Adult↗

PubMed2005

[MRI findings in patients with epilepsy debuting with febrile seizures].

One of the most controversial issues in epilepsy research is whether prolonged febrile seizures (FS) cause mesial temporal sclerosis (MTS) and temporal lobe epilepsy (TLE). Mesial temporal sclerosis is the pathological substrate found in patients with TLE and history of FS. The reasons that determine development of TLE and FC are presented by two main groups: perinatal and postnatal. 16 patients with TLE were examined to study the relation between FC and MTS. 10 patients (62,5%) had a history of complex febrile convulsions (with prolonged duration, focal features, posttical periods). We present specific magnetic resonance characteristics of mesial temporal sclerosis. Temporal size decrease and ipsilateral dilatation of the inferior horn of lateral ventricle were identified as specific MTS markers. One of the most characteristic magnetic resonance (MR) findings in temporal lobe epilepsy patients with FC is a high-signal area observable on T2-weighted images, mainly in the mesial temporal region.

Adolescent↗

PubMed2005

[Cloning and bioinformatics analysis of a thrombin-like enzyme gene from Agkistrodon acutus].

The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the venom thrombin-like enzyme (TLE). A 0.8 kb DNA fragment was specifically amplified, inserted into the pMD18-T vector and transformed into Escherichia coli strain DH5alpha, then identified by PCR and sequencing. The results showed that this cDNA shared great sequence homology (98.5%) with the published snake TLE cDNA sequence, the deduced amino acid sequence of this TLE encoded by the 783 bp consisted of 260 amino acids, which included a signal peptide of 24 amino acids and a matured peptide of 236 amino acids. In conclusion, a new cDNA encoding snake TLE was obtained by amplificantion.

Agkistrodon↗

PubMed2006

Apparent diffusion coefficient mapping of the hippocampus and the amygdala in pharmaco-resistant temporal lobe epilepsy.

BACKGROUND AND PURPOSE: The purpose of this study is to determine whether interictal apparent diffusion coefficients (ADC) provide a robust means for detecting amygdalo-hippocampal abnormalities in adult patients with localization-related chronic temporal lobe epilepsy (TLE) undergoing presurgical evaluation. METHODS: Fifty-five patients and 20 age-matched controls were studied with hippocampal and amygdala ADC maps (HADC and AMYADC), volumes (HCVOL, AMYVOL), T2 relaxometry (HCT2, AMYT2), and hippocampal N-acetylaspartate to choline and creatine/phosphocreatine ratios (HCSI). Mean values and 99% confidence ellipses were computed for the groups. Individual ADC mapping was compared with electroencephalography (EEG) data and further correlated with the quantitative MR measures and with the age at onset and duration of TLE. Moreover, we evaluated the association and the predictive value of HADC and AMYADC with respect to the surgical outcome in a subgroup of patients (n = 21) operated on the side of maximal EEG lateralization and with MR imaging criteria for hippocampal sclerosis, 71% of which became seizure-free. RESULTS: In controls, there was no relation between ADC values and age, sex, or right-left asymmetries. In TLE groups with right (n = 29) or left epileptogenic foci (n = 26), group comparisons showed that ADC mapping detected changes ipsilateral to the focus in the hippocampus (P < .01) and the amygdala (P < .05), accordingly with the volumes, T2 maps, and HCSI. Significant Pearson correlations (2-tailed) were obtained between ADC maps and the volume of the hippocampus (r = -0.64) and of the amygdala (r = -0.55; both P < .01), T2 (r = 0.70, r = 0.29; both P < .01), but not with HCSI. Individual ADC analysis showed ipsilateral pathology in 82% of cases (hippocampus) and 35% (amygdala) and included a moderate association between ipsilateral HADC and AMYADC (r = 0.54; P < .01). Bilateral abnormalities were found in 7% (hippocampus) and 5% (amygdala) of cases. Except for HCSI and the amygdala data, there were significant correlations between the asymmetry indices and the duration of epilepsy (HADC: r = 0.42; HCT2: r = 0.50; HCVOL: r = 0.35; all P < .01). Age at onset was associated only with ipsilateral HADC (r = 0.35; P < .01) and HCVOL and HCT2 (both P < .05). The association with postsurgical successes was characteristic of HADC (Fisher exact test, 2-tailed: P =.031; Spearman correlation: r(s) = -0.75; P = .0002), but not AMYADC. The predictive value regarding a favorable outcome was 0.87 (odds ratio 26; 95% confidence interval 2.33-38.86). As determined by regression models, both larger ipsilateral HADCs and asymmetry indices predicted surgical success. CONCLUSION: Interictal ADC mapping lateralizes efficiently the lesion side in accordance with the EEG data and might be used to study the differential regional aspects of mesio-temporal sclerosis. HADC--not AMYADC--maps discriminate favorably postoperative outcome and can be added to the multidisciplinary evaluation workout of pharmacoresistant TLE patients.

Adolescent↗

PubMedDate not supplied

[The pathophysiological foundations of temporal-lobe epilepsy: studies in humans and animals].

INTRODUCTION: Temporal lobe epilepsy (TLE) is the most frequent form of pharmaco-resistant epilepsy in human. Research using material from TLE patients undergoing surgery and animal models has significantly increased in the last decade. DEVELOPMENT: We review recent findings obtained over the last years from electrophysiological and anatomical studies in human and animal models of TLE. Data suggest a large heterogeneity and inter-individual variability depending on the model and the system under study. However, a common principle that appears to underlie the epileptic condition is the reorganization of excitation and inhibition resulting in hyperexcitability. Recent research combining in vitro electrophysiology together with depth recordings in vivo and new analytical methodologies is also discussed. CONCLUSIONS: A multidisciplinary approach using both human and animal models can help to fill gaps in our knowledge and to provide unique insights into the pathophysiology of TLE.

Animals↗

PubMed1990

Altered patterns of dynorphin immunoreactivity suggest mossy fiber reorganization in human hippocampal epilepsy.

Dynorphin A(1-17), an opioid peptide that is normally present in the hippocampal mossy fiber system, was localized immunocytochemically in the hippocampal formation of control autopsy and temporal lobe epilepsy (TLE) specimens. In control tissue, dynorphin-like immunoreactive (Dyn-IR) structures were confined to the mossy fiber path and were most highly concentrated in the polymorph (hilar) region of the dentate gyrus. Very few Dyn-IR structures were present in the molecular and granule cell layers of the dentate gyrus. In contrast, in all TLE specimens, Dyn-IR elements were present in these layers. The extent of aberrant staining varied among the TLE specimens, and 2 major patterns were observed. The first was a relatively wide band of reaction product in the inner one-third to one-fourth of the molecular layer (8 cases), and the second was a more limited distribution of immunoreactive fibers and presumptive terminals in the granule cell and immediately adjacent supragranular regions (2 cases). The extent of aberrant Dyn-IR structures appeared to be related to the amount of cell loss in the polymorph and CA3 fields and to dispersion of the granule cell somata. Specimens processed with the Timm's sulfide silver method for heavy metals provided independent evidence for the distribution of mossy fibers. In both control and TLE specimens, the patterns of labeling were virtually identical to those of dynorphin localization. These findings suggest that sprouting of mossy fibers or their axon collaterals has occurred in hippocampal epilepsy and that the reorganized fibers contain at least one of the neuropeptides that are normally present in this system. Such fibers could form recurrent excitatory circuits and contribute to synchronous firing and epileptiform activity, as suggested in studies of experimental models of epilepsy.

Cell Survival↗