SEARCH · PubMed Health

Results for “outbreak response”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 451 records · Page 25Linked to original sources

PubMed2003

A large infantile gastroenteritis outbreak in Albania caused by multiple emerging rotavirus genotypes.

By the end of December 2000, the epidemiological system 'Alert' of the Public Health Institute in Tirane reported an outbreak of acute gastroenteritis. The outbreak involved children in Tirane and in the rural area. In total, 2722 children were seen in Tirane Hospital and 982 (56.4%) were treated for acute gastroenteritis. The age group with the highest morbidity was 0-5 years (89.7%), followed by the 6-9 (6.2%) and 10-15 years age groups (4.1%). The distribution of acute gastroenteritis cases, which occurred along the same water distribution system, suggests a waterborne origin. The nucleic acid amplification confirmed the co-circulation of different genotypes of rotavirus, mainly P[8]G9 and P[8]G3, responsible for the outbreak. Other enteric viruses such as astrovirus serotype 1, adenovirus and Norovirus, genogroups I and II were detected. Co-infections with different rotavirus genotypes and even with different enteric viruses were detected in several samples.

Acute Disease↗

PubMed2005

Infectious disease emergencies: role of the infectious disease specialist.

The importance of infections for public health has become obvious during the last decades. Examples are emerging infections such as HIV/AIDS and severe acute respiratory syndrome, deliberate release of microorganisms, such as the anthrax episode in the USA, the increasing problems with organisms resistant to antimicrobial treatment, such as methicillin-resistant Staphylococcus aureus, and the threat of a new influenza pandemic with a case fatality rate similar to that in the 1918 outbreak. An effective response to infectious disease emergencies requires careful planning and establishment of resources in advance. The medical specialties involved are clinical microbiology, clinical infectious diseases and epidemiology. Clinical microbiology should include bacteriology, virology, and parasitology; the technical developments during the last 15 years have clearly erased most of the methodological differences between these branches of microbiology. New techniques such as new generations of Polymerase Chain Reaction (PCR), rapid methods for nucleic acid sequence analyses and microarrays have enabled more rapid identification of organisms and provide powerful tools in the epidemiological analysis of an outbreak. The infectious disease specialists are necessary for rapid and adequate clinical diagnoses, optimal use of antimicrobial agents and provision of facilities for containment of patients who may spread the infections. The need for isolation units became acute when many countries prepared themselves for a possible severe acute respiratory syndrome outbreak in Europe. With few exceptions, Europe still lacks epidemiological field forces, and it has been embarrassing to be obliged to call upon the Centers for Disease Control for European outbreaks. Hopefully, this will be corrected with the creation of the European Centre for Disease Prevention and Control (ECDC).

Communicable Disease Control↗

PubMed2000

Occupational asthma caused by soybean flour in bakers--differences with soybean-induced epidemic asthma.

BACKGROUND: Soybean dust has been identified as the causative agent of occupational asthma and asthma epidemics. Two main soybean hull allergens responsible for asthma outbreaks, Gly m 1 and Gly m 2, have been identified and purified. OBJECTIVE: The soybean allergens causing occupational asthma in exposed bakers were investigated and compared with those involved in epidemic asthma. METHODS: We report four bakers or confectioners with work-related respiratory symptoms who were exposed to soybean flour used as a baking additive. The causative role of soybean flour was investigated by immunological tests and specific inhalation challenge tests. Soybean flour allergens causing occupational asthma were characterized by immunoblotting. Immunoglobulin (Ig) E-reactivity to Gly m 1 and Gly m 2 was assessed using enzyme-linked immunosorbent assay. RESULTS: Sensitization to soybean flour was demonstrated by skin and serological tests and was confirmed by positive inhalation tests. Bronchial challenge test to soybean flour extract elicited immediate or dual asthmatic responses. Immunoblotting with soybean flour and soybean hull extracts showed IgE-binding mainly to high molecular weight (MW) allergens. There was an important individually different allergic response to inhalant soybean components. None of the patients showed IgE-reactivity against Gly m 1 and only one patient showed IgE-reactivity to the soybean hull allergen Gly m 2. CONCLUSION: These bakery workers had developed IgE-mediated occupational asthma to soybean flour. The allergens involved in occupational asthma caused by soybean flour are predominantly high MW proteins that are present both in soybean hull and flour, and they are different from the allergens causing asthma outbreaks, which are mainly low MW proteins concentrated in the hull.

Adult↗

PubMed1992

An outbreak of respiratory syncytial virus in a bone marrow transplant center.

An outbreak of respiratory syncytial virus (RSV) infection occurred among 31 patients in a marrow transplant center over a 13-week period beginning in January 1990. RSV infection was also documented in 35 family members and employees. Of 18 patients with pneumonia, 14 (78%) died. None of 13 with upper respiratory infection died. Preengraftment patients tended to develop pneumonia more frequently than did engrafted patients. Early administration of ribavirin may have had a beneficial effect in patients with pneumonia. Antigenic and genomic analysis of 14 available isolates suggested that at least four different viral strains were responsible for the outbreak. One group of patients and 1 employee in spatial proximity were infected with the same strain and likely acquired their infections nosocomially. RSV infection in marrow transplant patients is a serious and life-threatening infection with a high mortality rate once pneumonia develops.

Adolescent↗

PubMedDate not supplied

Characterization of Mycobacterium fortuitum isolates from sternotomy wounds by antimicrobial susceptibilities, plasmid profiles, and ribosomal ribonucleic acid gene restriction patterns.

An outbreak of sternotomy infections due to Mycobacterium fortuitum in patients who had received cardiovascular surgery occurred in a cardiothoracic hospital in Hong Kong, and 21 such isolates from different patients had antimicrobial susceptibility studies against 14 drugs in vitro. These isolates were also studied for plasmid profiles and ribosomal ribonucleic acid gene restriction patterns. The latter method proved valuable in categorization of these isolates into two groups (comprising of nine and seven isolates, respectively) and five other sporadic strains. When the plasmid profiles and ribotyping are matched against the clinical and epidemiologic data, multisource contamination is suspected to be responsible for the outbreak. The organisms were probably derived from the environment rather than contaminated surgical equipments and materials.

Adult↗

PubMed2006

An outbreak of endophthalmitis after extracapsular cataract surgery probably caused by endotoxin contaminated distilled water used to dissolve acetylcholine.

AIM: To study possible causes of an outbreak of severe endophthalmitis after planned extracapsular cataract surgery in Medan, Indonesia. METHODS: In a 3 week period in November 2001, 17 of 43 patients developed signs of endophthalmitis after planned extracapsular cataract surgery. A search for possible causes was undertaken 4 months later. RESULTS: In autoclaved stored distilled water used to dissolve acetylcholine (used in 16 of 17 patients with endophthalmitis) a high amount of endotoxin was detected in a human blood essay, as well as a small number of non-typeable Pseudomonas spp. CONCLUSIONS: These findings suggest that distilled water used as solvent for acetylcholine was responsible for this outbreak of endophthalmitis. As a consequence, we now rely on solvents that are regularly checked for impurities such as an intravenous infusion fluid, rather than on vials with distilled water that is presumed to be sterile and kept for some time.

Acetylcholine↗

PubMed1996

Attachment and entry of recombinant Norwalk virus capsids to cultured human and animal cell lines.

Norwalk virus (NV) is the prototype strain of a group of noncultivable human caliciviruses responsible for epidemic outbreaks of acute gastroenteritis. While these viruses do not grow in tissue culture cells or animal models, expression of the capsid protein in insect cells results in the self-assembly of recombinant Norwalk virus-like particles (rNV VLPs) that are morphologically and antigenically similar to native NV. We have used these rNV VLPs to examine virus-cell interactions. Binding and internalization of VLPs to cultured human and animal cell lines were studied in an attempt to identify potentially susceptible cell lines for virus propagation in vitro and to determine if early events in the replication cycle were responsible for the narrow host range and restriction of virus growth in cell culture. Radiolabeled VLPs specifically bound to a saturable number of binding molecules on the cell surface of 13 cell lines from different origins, including human intestine (differentiated and undifferentiated Caco-2) and insect (Spodoptera frugiperda 9) ovary. Differentiated Caco-2 cells bound significantly more rNV VLPs than the other cell lines. Variations in the amount of bound VLPs among the different cell lines did not correlate with the tissue or species of origin. VLP binding was specific, as determined by competition experiments with unlabeled rNV VLPs; however, only 1.4 to 6.8% of the specifically prebound radiolabeled VLPs became internalized into cells. Blocking experiments using polygonal and monoclonal anti-rNV sera and specific antipeptide sera were performed to map the domains on rNV VLPs involved in binding to cells. One monoclonal antibody (NV8812) blocked binding of rNV VLPs to human and animal cell lines. The binding site of monoclonal antibody NV8812 was localized to the C-terminal 300 to 384 residues of the capsid protein by immunoprecipitation with truncated and cleaved forms of the capsid protein. These data suggest that the C-terminal region of the capsid protein is involved in specific binding of rNV VLPs to cells.

Animals↗

PubMed2026

Core genome and whole genome multi-locus sequence typing of Cronobacter isolates.

UNLABELLED: Cronobacter species, especially C. sakazakii and C. malonaticus, are opportunistic pathogens that are linked to severe infections in infants with high case fatality rates. In this study, we investigated whole genome sequencing (WGS) analysis approaches, specifically 7-gene multi-locus sequence typing (7-gene MLST), core genome MLST (cgMLST), and whole genome MLST (wgMLST) to subtype Cronobacter isolates. We analyzed a comprehensive set of 743 Cronobacter isolates derived from clinical, food, and environmental sources. We also evaluated high-quality single nucleotide polymorphism (hqSNP), cgMLST, and wgMLST to cluster epidemiologically related and differentiate sporadic C. sakazakii isolates. Our results indicate that both cgMLST and wgMLST accurately identify closely related isolates and are consistent with epidemiological findings. The allele-based analyses were also comparable with hqSNP analyses, the current gold standard. Our workflow also outputs 7-gene MLST allele calls, Cronobacter sequence types, and clonal complexes, which may be useful for historic comparisons during outbreak investigations. Following the recent classification of Cronobacter infections as nationally notifiable in the United States, our findings demonstrate the efficacy of WGS-based approaches within the PulseNet framework to improve outbreak detection and response strategies for Cronobacter. IMPORTANCE: Cronobacter species, specifically C. sakazakii and C. malonaticus, are opportunistic pathogens linked to severe infections in infants with high case fatality rates. This study highlights the critical importance of advanced molecular techniques in public health surveillance, using whole genome sequencing (WGS) methodologies such as multi-locus sequence typing (7-gene MLST), core genome MLST (cgMLST), and whole genome MLST (wgMLST). The validation of these WGS-based approaches within the PulseNet framework is timely, especially following the recent classification of Cronobacter infections as nationally notifiable in the United States. WGS methods not only enhance outbreak detection but can also inform public health guidance aimed at preventing infections and reducing mortality in vulnerable populations, especially infants. Our research supports implementation of cgMLST as a standardized approach for routine PulseNet surveillance of Cronobacter, with wgMLST and hqSNP analyses providing additional discriminatory power for outbreak investigations and high resolution phylogenetic analysis.

Multilocus Sequence Typing↗

PubMed2005

Staphylococcus aureus isolates carrying Panton-Valentine leucocidin genes in England and Wales: frequency, characterization, and association with clinical disease.

Staphylococcus aureus isolates carrying the genes that encode for Panton-Valentine leucocidin (PVL), a highly potent toxin, have been responsible for recent outbreaks of severe invasive disease in previously healthy children and adults in the United States of America and Europe. To determine the frequency of PVL-positive isolates sent to the Staphylococcus Reference Unit (United Kingdom) for epidemiological purposes, we tested 515 isolates of S. aureus, and 8 (1.6%) were positive for the PVL locus. A further 470 isolates were selected to explore the association of PVL-positive S. aureus with clinical disease. Of these, 23 (4.9%) were PVL positive and most were associated with skin and soft tissue infections (especially abscesses). The PVL genes were also detected in isolates responsible for community-acquired pneumonia, burn infections, bacteremia, and scalded skin syndrome. Genotyping by pulsed-field gel electrophoresis and multilocus sequence typing revealed that the PVL-positive isolates were from diverse genetic backgrounds, although one prevalent clone of 12 geographically dispersed methicillin-resistant S. aureus (MRSA) isolates was identified (ST80). All 12 isolates were stapylococcal cassette chromosome mec type IVc, had an agr3 allele, and shared a common toxin gene profile (sea-see, seg-sej, eta, etb, and tst negative but etd positive). ST80 strains with similar genetic characteristics have been responsible for community-acquired infections in France and Switzerland. The remaining PVL-positive isolates were mostly methicillin-sensitive S. aureus and belonged to 12 different sequence types, including ST22 and ST30, which are closely related to the most prevalent MRSA clones in United Kingdom hospitals, EMRSA-15 and EMRSA-16, respectively.

Bacterial Toxins↗

PubMed1997

A serological survey of measles vaccine in a rural region of Eskişehir in Turkey.

We designed this longitudinal study as a response to measles outbreaks which occur occasionally in Eskişehir in Turkey to investigate the incidence of primary and secondary vaccine failure. The investigation was conducted over two periods (December 1993 to October 1994 and April 1995 to October 1995). Two study groups were involved, infants aged 9-11 months and children aged 18 months to 9 y. During December 1993 to October 1994 prevaccination sera was collected from 35 infants aged 9-11 months and tested to determine if maternally derived antibodies were present. The infants were vaccinated and subsequently the 31 infants who could be traced were retested 30-40 d later to determine their response to vaccination. The following was done to determine whether seropositivity rates alter over time. The second group, a randomised sample of 117 children aged between 18 months to 9 y was chosen; all of whom had been previously vaccinated and who had no history of measles. Sera was taken and tested during December 1993 to October 1994 in order to determine whether seropositivity rates varied with time. During April 1995 to October 1995 out of all the children in both groups 123 children were retested. All sera samples were studied by an enzyme-lined immunosorbent assay (ELISA). Out of the 35 infants in group 1 only four (11.4%) had maternal antibody against measles on initial testing. Out of 31 infants followed up 30-40 d after vaccination (61.3%) were found to be seropositive for measles. In the second group, of the 117 previously vaccinated children ninety-three (71.5%) had measles IgG antibody. Seropositivity rates did not show significant difference with time after vaccination. There was no association between first and second screening seropositivity rates. We conclude that the presence of maternal antibody reduces the success of vaccination. These results suggest the vaccination policy in Turkey should be re-examined with a view to revision.

Antibodies, Viral↗

PubMed1993

An outbreak of hepatitis A among health care workers: risk factors for transmission.

OBJECTIVES: The purpose of this study was to investigate a nosocomial outbreak of hepatitis A that occurred in the burn treatment center of a referral hospital. METHODS: Retrospective cohort and case-control studies were performed to determine acquisition rates and risk factors for transmission. Adjusted infection rates were calculated by week of exposure. A case-control study was conducted to determine potential mechanisms for nosocomial acquisition. Recently infected health care workers were defined as case patients; exposed, serosusceptible health care workers without infection served as controls. RESULTS: The outbreak of hepatitis A affected 11 health care workers and 1 other burn patient (1 secondary patient case). All 11 health care workers became ill after the admission of a man and his 8-month-old son who developed hepatitis A while in the hospital. The cumulative incidence risk ratio was elevated for health care workers caring for either the infant or the father during the same week of exposure. The case-control study implicated the behavior of eating on the hospital ward as the single most important risk factor for infection. CONCLUSION: Inadequate hand-washing and subsequent oral contamination appear responsible for the outbreak. Hospitals may witness other institutional outbreaks if health care workers regularly eat on the wards.

Adult↗

PubMed2003

Veterinarians and public health: the Epidemic Intelligence Service of the Centers for Disease Control and Prevention, 1951-2002.

Public health affords important and exciting career opportunities for veterinarians. The Epidemic Intelligence Service Program (EIS) of the Centers for Disease Prevention and Control (CDC) is a two-year post-graduate program of service and on-the-job training for health professionals, including veterinarians, who are interested in careers in epidemiology and public health. EIS serves as a major point of entry into the public health arena. Veterinarians applying to the program must have a Master of Public Health or equivalent degree, or demonstrated public health experience or course work. EIS officers are assigned to positions at CDC headquarters or in state and local health departments. During two-year assignments, they are trained in applied epidemiology, biostatistics, conducting outbreak investigations, emergency preparedness and response, and scientific communications. They conduct epidemiologic outbreak and other investigations, perform applied research and public health surveillance, serve the epidemiologic needs of state health departments, present at scientific and medical conferences, publish in the scientific literature, and disseminate vital public health information to the media and the public. EIS officers apply their training and skills to actual public health problems and issues, establish mentorships with recognized experts from CDC and other national and international health agencies, and travel domestically and internationally. Since 1951, 195 veterinarians have graduated from the program and gone on to make substantial contributions to public health in positions with federal, state, or local governments, academia, industry, and non-governmental organizations.

Adult↗

PubMed1995

Escherichia coli O157 infection associated with a farm visitor centre.

During the summer of 1994, four cases of bloody diarrhoea and/or haemolytic uraemic syndrome were reported to the consultants in communicable disease control in Nottingham and Leicester. One case was an adult, and there were three children aged 2 to 4 years. The initial investigation failed to reveal any common foodstuff as the cause of the outbreak, but all four cases had attended a farm visitor centre in Leicestershire in the three weeks before they became ill. A further three cases were found who had visited the same farm. A joint investigation took place with environmental health officers and the local veterinary investigation centre of the Ministry of Agriculture, Fisheries and Food. A questionnaire designed to ascertain possible sources of infection was sent to all cases. Several of the animals on the farm were sampled for Escherichia coli O157 and the farm's facilities for food preparation and hygiene were assessed. The pattern of infection did not suggest a point source for the outbreak. Analysis of responses to the questionnaires failed to reveal any common factor other than the visit to the farm, and all but one case remembered stroking and feeding the animals. Food preparation in the farm restaurant appeared to be satisfactory and there was no evidence of contamination of food with pathogenic bacteria. E. coli O157: H7, PT2, VT2 was isolated from four of the seven human cases and also from four cattle and six goats. Further analysis using restriction fragment length polymorphism (RFLP) showed that the four human strains were indistinguishable from nine of the 10 animal strains. It was concluded that the most likely cause of this outbreak was direct contact with the animals. This was further supported by poor handwashing facilities and lack of information for the visitors on the importance of personal hygiene.

Adolescent↗

PubMed1998

[Multidrug-resistant tuberculosis. 5. Human immunodeficiency virus infection and multidrug-resistant tuberculosis].

Outbreaks of multidrug-resistant tuberculosis (MDR-TB) among human immunodeficiency virus (HIV)-infected persons reported in the United States were very serious and the risks were increased by the delay of diagnosis, rapid progression from infection to active disease, inadequate therapy and poor tuberculosis (TB) control. Prevalence of drug-resistant TB among HIV-infected patients in Japan was studied. The results of drug susceptibility were collected through the nationwide working group for a survey of HIV-infected TB. Data of susceptibility for 39 cases were obtained. The isolates of two cases were resistant to isoniazid and rifampicin (including clinical failure of response), although no outbreak of MDR-TB was found in Japan. Case study of a patient who developed MDR-TB revealed that drug resistance might be selected by insufficient anti-TB therapy. The rate of resistance to any of the anti-TB drugs in HIV-infected patients seemed to be high, although strictly evaluation was difficult due to no standardization for drug susceptibility testing. Of 9 cases with resistance to any of the anti-TB drugs, 8 had extrapulmonary TB including 5 cases of disseminated TB. In contrast thirteen of 30 cases without drug resistance had extrapulmonary TB. Since it has been reported that HIV infection is related to increased rates of drug resistance of TB bacilli, treatment with four-drug regimen should be started and sufficient courses of therapy are needed in HIV-infected TB patients.

AIDS-Related Opportunistic Infections↗

PubMed2004

Characterization of an avian infectious bronchitis virus isolated in China from chickens with nephritis.

One IBV isolate, SC021202, was isolated from the kidneys of the infected young chickens by inoculating embryonated eggs, and its morphology, physiochemical and haemagglutonating properties were detected. Virulence of the isolate SC021202 was determined with specific pathogen-free (SPF) chicken inoculation. Nucleotide acid sequence of S1 gene of the isolate SC021202 was further sequenced and analysed. The physiochemical and morphological properties of the isolate SC021202 were in accordance to that of typical infectious bronchitis virus (IBV). In a pathogenicity experiment, the clinical signs and related gross lesions resembling those of field outbreak were reproduced and the virus isolate SC021202 was re-isolated from the kidneys of the infected chicken. Sequence data demonstrated that the full length of the amplified S1 gene of the isolate SC021202 was composed of 1931 nucleotides, coding a polypeptide of 543 amino acid residues. Compared with IBV strains from GenBank, the nucleotide and deduced amino acid sequence of S1 gene of the isolate SC021202 shared 60.0-91.4% and 49.1-88.9% identities, respectively. A nucleotide fragment of 'CTTTTTAATTATACTAACGGA' was inserted at nucleotide site 208 in the S1 gene of the isolate. These results indicated that IBV isolate SC021202 was a new variant IBV isolate and responsible for field outbreak of nephritis.

Animals↗

PubMedDate not supplied

Outbreak of mycotic tracheitis in domestic fowl.

An outbreak of mycotic tracheitis was observed in 8000 2-month-old, female White Leghorn birds. The birds were showing difficult respiration and there was mortality of 7-8 birds daily in the flock. On post-mortem examination of the affected birds, the trachea was found to be occluded with a white caseous mass. Microscopically hyphae were found invading the tracheal epithelium, cartilage and serosal layer along with infiltration of macrophages and lymphocytes. Aspergillus fumigatus was isolated in pure culture from the trachea. The birds responded to oral copper sulphate treatment. The ubiquitous occurrence of the organism and the conditions of the harvesting season have been found to be responsible for the outbreak of the disease.

Animals↗

PubMed1993

Molecular technology for hospital epidemiology.

Hospital-acquired infections in the United States contribute to approximately 80,000 deaths per year, with an associated cost of > $4 billion. Some of these infections are associated with outbreaks and clusters occurring within the hospital. The hospital infection control team must respond quickly and decisively to recognize and curtail these outbreaks, but their response often depends on critical laboratory data that characterize or "fingerprint" suspected microbial isolates. This presentation summarizes the simple, easily performed tests and the more molecular approaches that a hospital laboratory may take in support of infection control efforts. In addition to phenotypic data, such as biotype and antibiograms, hospitals that elect to incorporate molecular protocols should limit their first experiences to plasmid analysis and plasmid restriction endonuclease profiles.

Cross Infection↗

PubMed2000

A community outbreak of Cryptosporidium infection associated with a swimming pool complex.

A case-control study was conducted to investigate the cause of a sudden increase in cases of cryptosporidiosis notified to the Brisbane Southside Public Health Unit from January to March 1998. Fifty-two eligible cases were identified over a three-week period early in 1998. Thirty-one of these cases and 21 control subjects participated in the study. Swimming in the 2 weeks before onset of illness was identified as a likely risk factor for cryptosporidiosis infection (OR 3.1, CI 0.8-12.6, P = 0.06). Analysis of swimming pool attendance identified swimming at Pool Complex A as a significant risk factor for the acquisition of cryptosporidiosis (OR 8.9, CI 1.5-67.4, P = 0.004). No other potential risk factors were significantly associated with illness. The detection of cryptosporidium oocysts in three of the four pools at Pool Complex A supported the findings of the case-control study. As a response to this outbreak, Queensland Health has developed a Code of Practice outlining measures for the control and prevention of future outbreaks of swimming pool-associated cryptosporidiosis and/or giardiasis.

Adolescent↗