PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “Databases, Nucleic Acid”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 469 records · Page 26Linked to original sources
PubMed2003

Identification of aerobic mesophilic bacilli isolated from board and paper products containing recycled fibres.

AIMS: To identify aerobic mesophilic bacteria isolated from coreboard, kitchen roll paper and food packaging boards containing recycled fibres and to create a rapid fingerprint-based database for their identification. METHODS AND RESULTS: A total of 197 isolates and 20 relevant type strains were characterized by automated ribotyping and as far as possible identified by the similarities of their riboprints to the relevant type strains. One strain from each unidentified ribotype, a total of 87 strains, was subjected to partial 16S rDNA sequencing and in most cases also to fatty acid analysis and physiological tests. From the isolates 113 and seven different ribotypes were generated belonging to the genera Bacillus and Paenibacillus, respectively. The dominating species, or closest related to them, were B. simplex (22.8% of isolates), B. licheniformis (18.3%) and B. amyloliquefaciens (12.7%); 5.1% of the isolates were identified as B. cereus, a potential food-borne pathogen. In particular, this species was present in one food packaging board (26.3% of isolates). Based on these results, 40.1% of the isolates and 45.0% of ribotypes were so different from the relevant type strains that they may represent novel species. CONCLUSIONS: All isolates were aerobic spore-formers, indicating that all non-spore-formers were eliminated during the drying stage of the processes. Although many isolates could be affiliated to described species of Bacillus or Paenibacillus, a significant proportion of the isolates could not be identified unambiguously as members of a described species. SIGNIFICANCE AND IMPACT OF THE STUDY: A RiboPrint identification database, composed of 120 composite patters, was established for bacteria originating from the pulp and paper industry. Considering the discrimination power of ribotyping, this database will be extremely useful in future for the reliable and rapid identification of bacteria isolated from pulp and paper industrial sources.

Bacillus↗
PubMed2001

ABCD1 mutations and the X-linked adrenoleukodystrophy mutation database: role in diagnosis and clinical correlations.

X-linked adrenoleukodystrophy (X-ALD) is caused by mutations in the ABCD1 gene, which encodes a peroxisomal ABC half-transporter (ALDP) involved in the import of very long-chain fatty acids (VLCFA) into the peroxisome. The disease is characterized by a striking and unpredictable variation in phenotypic expression. Phenotypes include the rapidly progressive childhood cerebral form (CCALD), the milder adult form, adrenomyeloneuropathy (AMN), and variants without neurologic involvement. There is no apparent correlation between genotype and phenotype. In males, unambiguous diagnosis can be achieved by demonstration of elevated levels of VLCFA in plasma. In 15 to 20% of obligate heterozygotes, however, test results are false-negative. Therefore, mutation analysis is the only reliable method for the identification of heterozygotes. Since most X-ALD kindreds have a unique mutation, a great number of mutations have been identified in the ABCD1 gene in the last seven years. In order to catalog and facilitate the analysis of these mutations, we have established a mutation database for X-ALD ( http://www.x-ald.nl). In this review we report a detailed analysis of all 406 X-ALD mutations currently included in the database. Also, we present 47 novel mutations. In addition, we review the various X-ALD phenotypes, the different diagnostic tools, and the need for extended family screening for the identification of new patients.

ATP Binding Cassette Transporter, Subfamily D, Mem↗
PubMed2003

Mutational spectrum of the WFS1 gene in Wolfram syndrome, nonsyndromic hearing impairment, diabetes mellitus, and psychiatric disease.

WFS1 is a novel gene and encodes an 890 amino-acid glycoprotein (wolframin), predominantly localized in the endoplasmic reticulum. Mutations in WFS1 underlie autosomal recessive Wolfram syndrome and autosomal dominant low frequency sensorineural hearing impairment (LFSNHI) DFNA6/14. In addition, several WFS1 sequence variants have been shown to be significantly associated with diabetes mellitus and this gene has also been implicated in psychiatric diseases. Wolfram syndrome is highly variable in its clinical manifestations, which include diabetes insipidus, diabetes mellitus, optic atrophy, and deafness. Wolfram syndrome mutations are spread over the entire coding region, and are typically inactivating, suggesting that a loss of function causes the disease phenotype. In contrast, only non-inactivating mutations have been found in DFNA6/14 families, and these mutations are mainly located in the C-terminal protein domain. In this paper, we provide an overview of the currently known disease-causing and benign allele variants of WFS1 and propose a potential genotype-phenotype correlation for Wolfram syndrome and LFSNHI.

Alternative Splicing↗
PubMed2003

Structural and functional analysis of pt38, a 2.9kb plasmid of Streptococcus thermophilus yogurt strain.

The cryptic plasmid pt38 (2911 bp) of Streptococcus thermophilus ST2783, a strain isolated from Bulgarian yogurt, was subcloned and sequenced. Five ORFs (ORF1 to ORF5) were identified, although putative transcription initiation and termination signals, and Shine-Dalgarno sequence could only be localized for three of them (ORF1, ORF2, and ORF5). ORF2 would specify a 142-amino acid protein sharing a high degree of homology with plasmid-born low-molecular-weight heat stress proteins described in a variety of S. thermophilus strains. On the other hand, ORF1 would encode a 311-residue protein, which was found to be almost identical to the putative Rep proteins of previously sequenced S. thermophilus rolling circle-replicating plasmids. Intracellular single-stranded pt38 DNA was detected, showing that, in fact, the plasmid replicates via a rolling circle mechanism. A putative double-strand origin with significant homology to that of pC194, and a ssoA-type single-strand origin were also identified on the nucleotide sequence of pt38. A DNA region that can be transcribed into a small RNA (ctRNA) complementary to the leader segment of the rep (ORF1) mRNA is proposed to be involved in the control of plasmid replication. In vitro synthesis of this ctRNA was observed, and this constitutes the first report on the existence of such antisense RNAs, likely acting as regulatory elements, in S. thermophilus plasmids.

Base Sequence↗
PubMed2003

Temporal patterns of fruit fly (Drosophila) evolution revealed by mutation clocks.

Drosophila melanogaster has been a canonical model organism to study genetics, development, behavior, physiology, evolution, and population genetics for nearly a century. Despite this emphasis and the completion of its nuclear genome sequence, the timing of major speciation events leading to the origin of this fruit fly remain elusive because of the paucity of extensive fossil records and biogeographic data. Use of molecular clocks as an alternative has been fraught with non-clock-like accumulation of nucleotide and amino-acid substitutions. Here we present a novel methodology in which genomic mutation distances are used to overcome these limitations and to make use of all available gene sequence data for constructing a fruit fly molecular time scale. Our analysis of 2977 pairwise sequence comparisons from 176 nuclear genes reveals a long-term fruit fly mutation clock ticking at a rate of 11.1 mutations per kilobase pair per Myr. Genomic mutation clock-based timings of the landmark speciation events leading to the evolution of D. melanogaster show that it shared most recent common ancestry 5.4 MYA with D. simulans, 12.6 MYA with D. erecta+D. orena, 12.8 MYA with D. yakuba+D. teisseri, 35.6 MYA with the takahashii subgroup, 41.3 MYA with the montium subgroup, 44.2 MYA with the ananassae subgroup, 54.9 MYA with the obscura group, 62.2 MYA with the willistoni group, and 62.9 MYA with the subgenus Drosophila. These and other estimates are compatible with those known from limited biogeographic and fossil records. The inferred temporal pattern of fruit fly evolution shows correspondence with the cooling patterns of paleoclimate changes and habitat fragmentation in the Cenozoic.

Animals↗
PubMed2002

Cancerous hyper-mutagenesis in p53 genes is possibly associated with transcriptional bypass of DNA lesions.

The database of tumor-associated p53 base substitutions includes about 5% of tumors with two or more base substitutions. These multiplet base substitutions in one tumor are evidence for hyper-mutagenesis. Our retrospective analysis of this database indicates that most multiplets arise from a single transient hyper-mutagenic event in one cell that subsequently proliferated into a clonal tumor. The hyper-mutagenesis, 1.8 x 10(-4) substitutions per base pair, is detected as multiple mutations in p53 genes of tumors. It requires one strongly tumorigenic p53 substitution, usually missense, called the driver mutation. The occurrence frequencies of ancillary base substitutions, those that hitch-hike along with the driver mutation, are independent of their amino acid coding properties. In this respect, they act like neutral mutations. In support of this neutrality, we find that the frequency distribution of hitch-hiking CpG transitions along the p53 exons, their mutational spectrum, approximates the spontaneous pre-selection mutational spectrum of most human tissues and is correlated with the mutational spectrum of p53 pseudogenes in mammalian germ cells. The driver substitutions of multiplets predominantly originate along the transcribed strand while the ancillary substitutions tend to originate along the non-transcribed strand. This data is consistent with a model of time-dependent mutagenesis in non-dividing stem cells for generating multiple strand-asymmetric p53 mutations in tumors. By transcriptional bypass of DNA lesions with concomitant misincorporation, transcriptional mutagenesis generates a transient mutant p53 mRNA. The associated mutant p53 protein could allow the host cell a growth advantage, release from G1-arrest. Then, during subsequent DNA replication and misreading of the same lesion, the damaged base along the transcribed DNA strand would serve as the origin of the p53 base substitution that drives the hyper-mutagenic event leading to tumors with multiple p53 mutations.

Animals↗
PubMed2006

The HADHSC gene encoding short-chain L-3-hydroxyacyl-CoA dehydrogenase (SCHAD) and type 2 diabetes susceptibility: the DAMAGE study.

The short-chain l-3-hydroxyacyl-CoA dehydrogenase (SCHAD) protein is involved in the penultimate step of mitochondrial fatty acid oxidation. Previously, it has been shown that mutations in the corresponding gene (HADHSC) are associated with hyperinsulinism in infancy. The presumed function of the SCHAD enzyme in glucose-stimulated insulin secretion led us to the hypothesis that common variants in HADHSC on chromosome 4q22-26 might be associated with development of type 2 diabetes. In this study, we have performed a large-scale association study in four different cohorts from the Netherlands and Denmark (n = 7,365). Direct sequencing of HADHSC cDNA and databank analysis identified four tagging single nucleotide polymorphisms (SNPs) including one missense variant (P86L). Neither the SNPs nor haplotypes investigated were associated with the disease, enzyme function, or any relevant quantitative measure (all P > 0.1). The present study provides no evidence that the specific HADHSC variants or haplotypes examined do influence susceptibility to develop type 2 diabetes. We conclude that it is unlikely that variation in HADHSC plays a major role in the pathogenesis of type 2 diabetes in the examined cohorts.

3-Hydroxyacyl CoA Dehydrogenases↗
PubMed2006

Exhaustive assignment of compositional bias reveals universally prevalent biased regions: analysis of functional associations in human and Drosophila.

BACKGROUND: Compositionally biased (CB) regions are stretches in protein sequences made from mainly a distinct subset of amino acid residues; such regions are frequently associated with a structural role in the cell, or with protein disorder. RESULTS: We derived a procedure for the exhaustive assignment and classification of CB regions, and have applied it to thirteen metazoan proteomes. Sequences are initially scanned for the lowest-probability subsequences (LPSs) for single amino-acid types; subsequently, an exhaustive search for lowest probability subsequences (LPSs) for multiple residue types is performed iteratively until convergence, to define CB region boundaries. We analysed > 40,000 CB regions with > 20 million residues; strikingly, nine single-/double- residue biases are universally abundant, and are consistently highly ranked across both vertebrates and invertebrates. To home in subpopulations of CB regions of interest in human and D. melanogaster, we analysed CB region lengths, conservation, inferred functional categories and predicted protein disorder, and filtered for coiled coils and protein structures. In particular, we found that some of the universally abundant CB regions have significant associations to transcription and nuclear localization in Human and Drosophila, and are also predicted to be moderately or highly disordered. Focussing on Q-based biased regions, we found that these regions are typically only well conserved within mammals (appearing in 60-80% of orthologs), with shorter human transcription-related CB regions being unconserved outside of mammals; they are also preferentially linked to protein domains such as the homeodomain and glucocorticoid-receptor DNA-binding domain. In general, only approximately 40-50% of residues in these human and Drosophila CB regions have predicted protein disorder. CONCLUSION: This data is of use for the further functional characterization of genes, and for structural genomics initiatives.

Animals↗
PubMed2004

Identification of Krit1B: a novel alternative splicing isoform of cerebral cavernous malformation gene-1.

Cerebral cavernous malformations (CCM) are vascular malformations, mostly located in the central nervous system, which occur in 0.1-0.5% of the population. They are characterized by abnormally enlarged and often leaking capillary cavities without intervening neural parenchyma. Some are clinically silent, whereas others cause seizures, intracerebral haemorrhage or focal neurological deficits. These vascular malformations can arise sporadically or may be inherited as an autosomal dominant condition with incomplete penetrance. At least 45% of families affected with cerebral cavernous malformations harbour a mutation in Krev interaction trapped-1 (Krit1) gene (cerebral cavernous malformation gene-1, CCM1). This gene contains 16 coding exons which encode a 736-amino acid protein containing three ankyrin repeats and a FERM domain. Neither the CCM1 pathogenetic mechanisms nor the function of the Krit1 protein are understood so far, although several hypotheses have been inferred from the predicted consequences of Krit1 mutations as well as from the identification of Krit1 as a binding partner of Rap1A, ICAP1A and microtubules. Here, we report the identification of Krit1B, a novel Krit1 isoform characterized by the alternative splicing of the 15th coding exon. We show that the Krit1B splice isoform is widely expressed in mouse cell lines and tissues, whereas its expression is highly restricted in human. In addition, we developed a real-time PCR strategy to accurately quantify the relative ratio of the two Krit1 alternative transcripts in different tissues, demonstrating a Krit1B/Krit1A ratio up to 20% in mouse thymus, but significantly lower ratios in other tissues. Bioinformatic analysis using exon/gene-prediction, comparative alignment and structure analysis programs supported the existence of Krit1 alternative transcripts lacking the 15th coding exon and showed that the splicing out of this exon occurs outside of potentially important Krit1 structural domains but in a region required for association with Rap1A, suggesting a subtle, yet important effect on the protein function. Our results indicate that maintenance of a proper ratio between Krit1A and Krit1B could be functionally relevant and suggest that the novel Krit1B isoform might expand our understanding of the role of Krit1 in CCM1 pathogenesis.

Alternative Splicing↗
PubMed2004

Electronic structures of A- and B-type DNA crystals.

The electronic band structures and total density of states based on a density-functional theory are performed on four deoxyribonucleic acid (DNA) molecules: namely, A- and B-type DNA where a single pitch is formed by 11 and 10 base pairs, respectively, of Poly (dA) *Poly (dT) and Poly (dG) *Poly (dC). Poly (dA) *Poly (dT) is a DNA where one single strand consists only of adenine (A) and the other single strand consists only of thymine (T), while Poly (dG) *Poly (dC) is a DNA where one single strand consists only of guanine (G) and the other of cytosine (C). A- and B-Poly (dA) *Poly (dT) and A- and B-Poly (dG) *Poly (dC) DNA. Compared in the same structure, the band gap of Poly (dA) *Poly (dT) is larger than that of Poly (dG) *Poly (dC). The highest occupied molecular orbitals (HOMO's) of Poly (dA) *Poly (dT) and Poly (dG) *Poly (dC) are formed by adenine's and guanine's HOMO, respectively, regardless of the structure type. On the other hand, the lowest unoccupied molecular orbitals (LUMO's) of DNA of both types are formed by the orbitals of Na and P O4, though the LUMO's of B-Poly (dA) *Poly (dT) and B-Poly (dG) *Poly (dG) are formed by thymine's and cytosine's LUMO when the DNA-DNA distance is more than 3 nm. The minimum energy gap between the valence edge and the empty state of Na and PO4 is 0.9 eV in A-Poly (dG) *Poly (dC). The narrow bandwidth of the valence and conduction bands show that the conduction arises not from band transport but a hopping mechanism in the presence of doping.

Base Pairing↗
PubMed1993

Whose DNA is it anyway? Relationships between families and researchers.

DNA obtained for research may, at a later time, become crucial for carrier and prenatal diagnosis. Continuing rapid advances in human genetics make this scenario more and more common. The following case illustrates some of the problems that may occur when DNA donors and researchers do not establish a verbal or written agreement at the time the DNA is obtained. The legal and ethical ramifications of this situation are examined through case discussion and review of the literature. We propose that even in the absence of a verbal or written agreement, researchers continue to have a responsibility to share any significant information obtained from linkage studies with donor families if such information becomes available. If the DNA specimens become critical for prenatal or carrier testing at a later time, we feel that the family has a right to request and receive aliquots of such specimens. The research unit should have the right to charge a storage fee for DNA banking. Clear agreement between donor and researcher at the time of specimen collection may avoid legal and ethical problems in the future.

Contracts↗
PubMed2005

Analysis of NF1 transcriptional regulatory elements.

Mutations of the NF1 locus cause neurofibromatosis 1 (NF1), a clinically variable autosomal dominant disease. Expression of neurofibromin, the protein product of the NF1 gene, is regulated in a tissue- and developmentally-specific fashion, but the basis for this regulation is not understood. We used phylogenetic footprinting and other bioinformatic methods to identify potential transcriptional regulatory regions in the 5' upstream region and intron 1 of the NF1 gene from human, mouse, rat, and pufferfish. Three genomic segments that have equal or higher homology than the coding region were found in the NF1 5' upstream region, and four more very highly homologous regions were found in intron 1. Five of these highly homologous regions are confidently predicted to contain transcription factor binding sites. One highly homologous segment in the 5' upstream region spans the transcription start site and contains several potential transcription factor binding sites. This segment includes a novel 24-bp sequence (acttccggtggggtgtcatggcgg) that lies 310-333 bp upstream of the translation initiation site. This sequence, which is identical in human, mouse, and rat and differs by only 1-bp in Fugu, may contain the core promoter element for NF1 transcription.

5' Flanking Region↗
PubMed2005

DNA pooling analysis of 21 norepinephrine transporter gene SNPs with attention deficit hyperactivity disorder: no evidence for association.

The norepinephrine system is known to play a role in attentional and cognitive-energetic mechanisms and is thought to be important in attention deficit hyperactivity disorder (ADHD). Stimulant medications are known to alter the activity of norepinephrine as well as dopamine in the synapse and the highly selective norepinephrine reuptake inhibitor, atomoxetine, is an effective treatment for ADHD symptoms. This study set out to investigate whether common polymorphisms within the norepinephrine transporter gene (NET1) are associated with DSM-IV ADHD combined subtype, using a sample that has previously shown association with genes that affect the synaptic release and uptake of neurotransmitters; DAT1 and SNAP-25. We identified 21 single nucleotide polymorphisms (SNPs) from publicly available databases that had minor allele frequencies > or =5% and span the NET1 genomic region, including those analyzed in previous studies of ADHD. DNA pooling was used to screen for associations using two case pools (n = 180 cases) and four control pools (n = 334 controls). We identified three SNPs that showed suggestive evidence for association using either case-control or within family tests of association, however, none of these were significant after adjustment for the number of markers analyzed. We conclude that none of the markers show significant evidence of association with ADHD although we cannot rule out small genetic effects.

Algorithms↗