SEARCH · PubMed Health

Results for “ADE”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 487 records · Page 27Linked to original sources

PubMed1991

[Frequency and character of side effects of anti-tubercular drugs].

The adverse drug effects (ADE) was found in 66.2% of patients during antituberculosis chemotherapy. The development of structural changes induced by antituberculous drugs was evidenced by histological examination of the biopsy specimens of the gastric mucosa, duodenum and liver. It is concluded that toxic and allergic components are simultaneously responsible for ADE on the digestive organs. Long-term health studies in subjects who were strucked off the dispensary register in group VII showed that ADE experienced during hospital treatment contributed to the formation of gastroenterologic abnormalities and nonspecific allergization of the body.

Adolescent↗

PubMed1988

Protection of mice against Japanese encephalitis virus by passive administration with monoclonal antibodies.

We have identified and characterized nine antigenic epitopes on the E envelope of Japanese encephalitis virus (JEV) by using mAb. Passive administration of most of the anti-JEV mAb protected mice from i.v. challenge with 1.5 x 10(3) plaque-forming units of JEV, JaGAr-01 strain. Some mAb, which possess high neutralization activity in vitro, showed high protection, and JEV-specific N mAb 503 was found the most protective. Even an injection of 2.5 micrograms/mouse of mAb 503 protected all mice from JEV infection. Furthermore, an injection of about 200 micrograms of mAb 503 on day 5 postinfection protected 82% of the mice, even when JEV was detected in more than 85% of the infected mouse brains. Synergism of protection was observed with mixtures of several mAb directed against different epitopes. Although in a murine macrophage cell line, all of the mAb groups showed antibody-dependent enhancement (ADE) of JEV infectivity in vitro, and only two flavivirus cross-reactive mAb groups showed ADE of dengue virus type 2. The ADE of JEV by mAb seems not to be harmful for in vivo protection experiments, except for two mAb groups: mAb 302 and 201 showed little or no protective activity against JEV infection and, rather, caused early death in infected mice.

Animals↗

PubMed1988

[Mutagenesis on cloned yeast genes. The mutation of the yeast gene comprising the plasmid and chromosome].

The cells of Saccharomyces cerevisiae were transformed by plasmid pYG-007 treated in vitro with o-methylhydroxylamine. The plasmid consists of a portion of the bacterial plasmid with genes of resistance to ampicillin, chloramphenicol and tetracycline, 2 mkm yeast DNA and yeast genes ADE2 and LEU2. The collection of mutants containing a mutant allele of ADE2 gene within the plasmid was obtained. Interallelic complementation and that induced by suppression were studied in these ade 2 mutants. It was shown that all these induced ade 2 mutations were base-pair substitutions. Using the mechanism of conversion we managed to transfer the plasmid ade 2 mutations into the chromosome. Three pairs of strains carrying similar mutation in plasmid and chromosome were created. Analysis of frequency of reversions induced by UV-light and hydroxylaminopurine in the mutant ade2 locus comprised in the plasmid and chromosome showed that the former induced reversions in plasmid alleles less effectively than the latter.

Alleles↗

PubMed1987

[Double ultrasonic scanning in the diagnosis of occlusive lesions of the brachiocephalic arteries in patients with atherosclerotic circulatory encephalopathy].

In a series of 84 patients with various stages of atherosclerotic circulatory encephalopathy (ADE) the authors studied the possibility of detecting by ultrasound double scanning (UDS) of occlusive lesions of the brachiocephalic arteries and compared the results with the findings provided by cerebral angiography (AG). In a study of 35 healthy subjects normal parameters of the spectrograms of the extracranial arteries were established. In 84 patients with ADE, ultrasound double scanning revealed stenoses and occlusions of the brachiocephalic arteries in 47 cases. They were confirmed by AG and were classified into five categories. Comparison of the data demonstrated that the diagnostic reliability of UDS versus AG was 95.9%. UDS makes it possible to diagnose accurately occlusive lesions of the brachiocephalic arteries in patients with ADE and to determine indications for AG and thus may be used for screening purposes.

Adult↗

PubMed1984

Alpha-adrenergic responsiveness correlates with epinephrine dose for arrhythmias during halothane anesthesia in dogs.

The dose of epinephrine required to elicit ventricular arrhythmias during halothane anesthesia may depend on end-organ sensitivity. We determined whether the arrhythmogenic dose for epinephrine (ADE) could be correlated with either alpha- or beta-adrenergic responsiveness. After ADE was determined in 26 dogs anesthetized with 1.2 MAC halothane, an in vivo assessment of adrenergic responsiveness was made. The alpha-adrenergic responsiveness was defined as the dose of phenylephrine required to increase mean arterial pressure by 75% (alpha 75), while the dose of isoproterenol causing a 75% increase in heart rate was a measure of beta-adrenergic responsiveness (beta 75). The correlation coefficients for alpha 75 and beta 75 vs ADE then were determined by multiple linear regression analysis. There was a highly significant correlation with the alpha 75 (F = 9.06; P less than 0.01), while no relationship existed with beta 75 (F = 0.52; P greater than 0.05). Thus the alpha-adrenergic responsiveness in individual patients may be used to predict the threshold for epinephrine-induced arrhythmias during halothane anesthesia.

Anesthesia, General↗

PubMed1995

[Clinical characteristics and natural history of human immunodeficiency virus infection. Study in a Chilean population served at a multiprofessional pilot center].

Four hundred and eighty six infected adults (90.7% men) were prospectively followed from 1988 to 1993 at a multiprofessional center in Santiago, Chile. 87.8% of male patients (pts)--84% of them homo/bisexual--and 64.4% of women acquired the infection sexually. At the beginning of the follow up (F/U) 51% of men and 71% of women were asymptomatic and 30% of the total group had AIDS. (AIDS definition: CDC 1993, excluded CD4 lymphocyte count < 200 x mm3). 240/486 (49.4%) had developed AIDS at the end of the study (12/31/93). AIDS defining events (ADE) were: interstitial pneumonia (confirmed or suggestive as caused by P. carinii [PCP]), 25%; tuberculosis (all forms), 22.1%; wasting, 13.8%; Kaposi Sarcoma, 9.2%; esophageal candidiasis, 6.7%; isosporiasis, 5.4%. Of all PCP cases, 72% were ADE, the rest, post.AIDS'. As expected, AIDS pts continued having major complications (mainly bacterial pneumonias, PCPs, esophagitis, tuberculosis and diarrhea due to I. belli and Cryptosporidium. Less frequently, but also observed, were toxoplasmic encephalitis and cryptococcal meningitis). Known mortality (excluded abandonment of F/U) was 27% for the whole group and varied from 5.8%, 51.6% to 69.2% for the first, 4th and 6th year of F/U respectively. For II-III CDC pts the mortality was 5% and 57% and for IV CDC pts it was 38% and 100% during the first and 6th year of F/U respectively. 36%, 53%, 74% and 85% of the pts followed for 1, 3, 5 and 6 years respectively had developed AIDS by the end of 1993. Multifactorial causes with either diarrhea, wasting or both were responsible for the death in half the pts in whom this was known, 15% died of respiratory complications and 5.7% of cryptococcal meningitis. 80% of AIDS pts survived their ADE. This study has provided information about the clinical profile of the HIV infection and natural history of the disease in Chile.

Acquired Immunodeficiency Syndrome↗

PubMed1995

High prevalence of serum IgA HIV-1 infection-enhancing antibodies in HIV-infected persons. Masking by IgG.

IgA and IgG purified from sera of 20 HIV-infected persons were separately examined for ability to mediate Ab-dependent enhancement (ADE) of HIV-1 infection of U937 cells. Both isotypes were capable of enhancing infection of these cells. However, IgA from twice as many persons (14/20) displayed infection enhancement when compared with IgG. This activity was predominantly observed with IgA from asymptomatic HIV-seropositive subjects (9/9). Enhanced HIV infection by IgA was observed most often at concentrations equivalent to serum dilutions in the range 10(-3) to 10(-5) and could be inhibited by preincubation of U937 cells with a mAb specific for the Fc alpha receptor. Concentrations of IgG mediating ADE were generally present in sera at dilutions from 10(-4) to 10(-6). When IgG was adjusted to physiologic concentration and combined with an enhancing concentration of IgA, enhancement was not observed unless IgG was also present at a concentration which exhibited this activity. These results suggest that, in comparison with IgG, HIV-infected individuals more often produce IgA Abs reacting with enhancing determinants of HIV. IgA-mediated ADE of HIV infection may not play a significant role in facilitating systemic dissemination of HIV because of the presence of higher concentrations of IgG. However, the production of IgA HIV-enhancing Abs at mucosal sites, where fewer IgG plasma cells are present, could contribute to the pathogenesis of HIV infection and interfere with development of vaccines designed to induce HIV IgA Abs at mucosal surfaces.

Cell Line↗

PubMed1996

[Effect of dl-3-n-butylphthalide (NBP) on purine metabolites in striatum extracellular fluid in four-vessel occlusion rats].

The effects of NBP on concentrations of some purine metabolites in extracellular fluid of rat striatum during global ischemia and reperfusion were studied. Global ischemia was produced by the four-vessel occlusion method. Push-pull cannula was implanted stereotaxically into the striatum of rat and was perfused with Ringer's solution at a flow rate of 2.5 microliters.min-1. The level of adenosine(Ade), inosine(Ino), hypoxanthine(Hyp) and xanthine(Xan) in perfusates were measured with HPLC connected with a UV detector. The results indicate that the levels of ade, ino, hyp and xan were significantly increased (about 3-5 times of initial value) during cerebral ischemia and reperfusion. NBP at the dose of 20 or 40 mg.kg-1 given intra-peritoneally 20 min before ischemia was shown to depress the increase of ade, ino, hyp and xan during ischemia and reperfusion dose dependently. But no change in the level of purine metabolites was found in sham operated rats. It has been known that harmful free radicals were produced when xan and uric acid were formed by xanthine oxidase during reperfusion. This might be important for the development of ischemic injuries. Our findings suggest that the effect of NBP might be beneficial for protection against post-ischemic neuronal damage.

Adenosine↗

PubMed1996

An evaluation of the influence of medetomidine hydrochloride and atipamezole hydrochloride on the arrhythmogenic dose of epinephrine in dogs during halothane anesthesia.

Alterations in the arrhythmogenic dose of epinephrine (ADE) were determined following administration of medetomidine hydrochloride (750 micrograms/M2) and a saline placebo, or medetomidine hydrochloride (750 micrograms/M2), followed by specific medetomidine reversal agent, atipamezole hydrochloride (50 micrograms/kg) 20 min later, in halothane-anesthetized dogs (n = 6). ADE determinations were made prior to the administration of either treatment, 20 min and 4 h following medetomidine/saline or medetomidine/atipamezole administration. Epinephrine was infused for 3 min at increasing dose rates (2.5 and 5.0 micrograms/kg/min) until the arrhythmia criterion (4 or more intermittent or continuous premature ventricular contractions) was reached. The interinfusion interval was 20 min. There were no significant differences in the amount of epinephrine required to reach the arrhythmia criterion following the administration of either treatment. In addition, the ADE at each determination was not different between treatment groups. In this study, the administration of medetomidine to halothane-anesthetized dogs did not alter their arrhythmogenic response to infused epinephrine.

Adrenergic alpha-Agonists↗

PubMed1997

Evaluation of the arrhythmogenicity of a low dose of acepromazine: comparison with xylazine.

Alteration in the arrhythmogenic dose of epinephrine (ADE) was determined in 6 healthy dogs under halothane anesthesia following the administration of xylazine at 1.1 mg/kg i.v. and acepromazine at 0.025 mg/kg i.v. The order of treatment was randomly assigned with each dog receiving both treatments and testing was carried out on 2 separate occasions with at least a 1 wk interval. The ADE determinations were made prior to drug administration during halothane anesthesia (CNTL) and then 20 min and 4 h following drug treatment. Epinephrine was infused for 3 min at increasing dose rates (2.5, 5.0, 10.0 micrograms/kg/min) until the arrhythmia criterion (4 or more intermittent or continuous premature ventricular contractions) was reached within the 3 min of infusion or the 1 min following cessation. The interinfusion interval was 20 min. There was a significant difference (P = 0.0001) in the ADE determined following acepromazine administration at 20 min (20.95 micrograms/kg +/- 2.28 SEM) compared to CNTL (6.64 micrograms/kg +/- 1.09), xylazine at 20 min (5.82 micrograms/kg +/- 0.95) and 4 h (6.13 micrograms/kg +/- 1.05), and acepromazine at 4 h (7.32 micrograms/kg +/- 0.34). No other significant differences existed (P < 0.05). In this study we were unable to show any sensitization to epinephrine following xylazine administration during halothane anesthesia, while a protective effect was shown with a low dose of acepromazine.

Acepromazine↗

PubMed1997

Evaluating the potential effectiveness of using computerized information systems to prevent adverse drug events.

In this study a dynamic computer simulation model is used to estimate the effectiveness of various information systems applications designed to detect and prevent medication errors that result in adverse drug events (ADEs). The model simulates the four stages of the drug ordering and delivery system: prescribing, transcribing, dispensing and administering drugs. In this study we simulated interventions that have been demonstrated in prior studies to decrease error rates. The results demonstrated that a computerized information system that detected 26% of medication errors and prevented associated ADEs could save 1,226 days of excess hospitalization and $1.4 million in hospital costs annually. Those results suggest that such systems are potentially a cost-effective means of preventing ADEs in hospitals. The results demonstrated the importance of viewing adverse drug events from a systems perspective. Prevention efforts that focus on a single stage of the process had limited impact on the overall error rate. This study suggests that system-wide changes to the drug-ordering and delivery system are required to significantly reduce adverse drug events in a hospital setting.

Clinical Pharmacy Information Systems↗

PubMed1998

Effect of isoflurane on epinephrine-induced arrhythmias in ischemic-reperfused dog hearts.

Although isoflurane protects the myocardium and facilitates functional recovery after ischemia and reperfusion, its mechanism of action is still unclear. We hypothesized that isoflurane maintains intracellular Ca2+ homeostasis, thus attenuating epinephrine-induced arrhythmogenicity in in vivo models of myocardial ischemia and reperfusion. Adult mongrel dogs, anesthetized with urethane and chloralose, underwent 15 minutes of left anterior descending coronary artery occlusion followed by reperfusion. In addition to a sham group (without occlusion, n = 5) and a control group (with occlusion, n = 7), a third group (n = 5) received 1.5% isoflurane before ischemia was induced; a fourth (n = 7), isoflurane after reperfusion; and a fifth (n = 5), isoflurane and verapamil (100 micrograms/kg) after reperfusion. Isoflurane administered before ischemia increased the arrhythmogenic dose of epinephrine (ADE), but had no effect on ADE when administered after reperfusion. The addition of verapamil further increased the ADE. These results indicate that isoflurane has a cardioprotective effect during ischemia and reperfusion by, at least in part, the reduction of Ca2+ influx.

Anesthetics, Inhalation↗

PubMed2004

The epidemiology of prescribing errors: the potential impact of computerized prescriber order entry.

BACKGROUND: Adverse drug events (ADEs) are the most common cause of injury to hospitalized patients and are often preventable. Medication errors resulting in preventable ADEs most commonly occur at the prescribing stage. OBJECTIVES: To describe the epidemiology of medication prescribing errors averted by pharmacists and to assess the likelihood that these errors would be prevented by implementing computerized prescriber order entry (CPOE). METHODS: At a 700-bed academic medical center in Chicago, Ill, clinical staff pharmacists saved all orders that contained a prescribing error for a week in early 2002. Pharmacist investigators subsequently classified drug class, error type, proximal cause, phase of hospitalization, and potential for patient harm and rated the likelihood that CPOE would have prevented the prescribing error. RESULTS: A total of 1111 prescribing errors were identified (62.4 errors per 1000 medication orders), most occurring on admission (64%). Of these, 30.8% were rated clinically significant and were most frequently related to anti-infective medication orders, incorrect dose, and medication knowledge deficiency. Of all verified prescribing errors, 64.4% were rated as likely to be prevented with CPOE (including 43% of the potentially harmful errors), 13.2% unlikely to be prevented with CPOE, and 22.4% possibly prevented with CPOE depending on specific CPOE system characteristics. CONCLUSIONS: Prescribing errors are common in the hospital setting. While CPOE systems could improve practitioner prescribing, design and implementation of a CPOE system should focus on errors with the greatest potential for patient harm. Pharmacist involvement, in addition to a CPOE system with advanced clinical decision support, is vital for achieving maximum medication safety.

Clinical Pharmacy Information Systems↗

PubMed1983

Computed tomography in acute disseminated encephalomyelitis.

Computed tomographic (CT) scans were obtained for eleven patients with acute disseminated encephalomyelitis (ADE). Four patients had normal CT scans despite repeated examination. Abnormalities were found in seven patients and included cortical-enhancing lesions, low-density lesions in the deep white matter and basal ganglia, and edema of the brainstem. These findings support the hypothesis that both vascular injury and demyelination are involved in the pathogenesis of ADE. A delay between the onset of clinical signs and the appearance of lesions on CT scan was common. Clinical improvement was accompanied by improvement in CT abnormalities. There was a limited correlation between the clinical course and the anatomical distribution and type of abnormality seen on CT scan.

Acute Disease↗

PubMed1991

Direct observation of the alkylation products of deoxyguanosine and DNA by fast atom bombardment mass spectrometry.

By the methods of fast atom bombardment (FAB) mass spectrometry, thin-layer chromatography and ultraviolet absorption spectroscopy adducts have been studied which are formed by an antitumour alkylating drug thiotepa both in a model system, containing only deoxyguanosine (dGuo), and in DNA. Analysis of the model reaction mixture (dGuo + thiotepa) by FAB mass spectrometry permitted observation of adducts dGuo thiotepa, 2dGuo thiotepa, and also the products of their further modification in solution, which occurs by hydrolysis of the glycosidic bond and also by opening of the imidazole ring. In the case of DNA FAB mass spectrometry made it possible to characterize adducts of thiotepa with guanosine (Gua) and adenosine (Ade) without their preliminary purification. The site of alkylation of Gua in both dGuo and DNA is N7, and that of Ade in DNA is N3. The application of the results to the study of the molecular mechanism of the antitumour action of thiotepa is discussed.

Alkylating Agents↗

PubMed1998

Formation of 8-hydroxyguanine and 2,6-diamino-4-hydroxy-5-formamidopyrimidine in DNA by riboflavin mediated photosensitization.

Calf thymus DNA was photoirradiated in the presence of riboflavin. Altered bases were detected and quantified by the GC/MS-SIM method after hydrolysis and derivatization of DNA. Seven types of modified purine bases were detected in control DNA. Among them, the yields of 8-OH-Gua and FapyGua increased significantly in DNA photo-irradiated with riboflavin, whereas the yields of xanthine, 8-OH-Ade, 2-OH-Ade, FapyAde and hypoxanthine were not affected. A dose dependent increase in the formation of 8-OH-Gua was observed with increasing riboflavin concentration for 30 min irradiation. On the other hand, FapyGua reached plateau at 10 micrograms/ml of riboflavin for 30 min irradiation. Our results indicate that guanine moiety in DNA is the most susceptible to riboflavin mediated photosensitization.

Animals↗

PubMed1999

C1q autoantibodies in HIV infection: correlation to elevated levels of autoantibodies against 60-kDa heat-shock proteins.

Antibodies to solid phase C1q (C1qAb) were determined in 295 serum samples from 132 HIV-infected subjects and in sera from 140 HIV-seronegative healthy individuals as control. An ELISA method applied for the determination of C1qAb in other diseases was used. In part of these sera, other autoantibodies (antibodies reacting with 60-kDa human heat shock protein (hsp60) or mycobacterial hsp65; IgA and IgG class antibodies against the Fab and F(ab')2 moieties of IgG) as well as complement-mediated antibody-dependent enhancement/neutralization (C'-ADE) were also determined. Increased amount of C1qAb was found in HIV-infected subjects as compared with HIV-seronegative controls (P = 0.0138). In 17 of 132 (13.0%) seropositive individuals but only in 7/140 (5.0%) samples from the controls, the amount of C1qAb exceeded the upper limit (95th percentile) of the normal values (P = 0.031). The amount of C1qAb significantly decreased during a follow-up period of 65 months. C1qAb levels were found to strongly correlate to hsp60/65 autoantibodies but did not correlate or only weakly correlated to the amount of anti-Fab or anti-F(ab')2 autoantibodies measured in the same serum samples. Anti-C1q antibodies recognized the solid phase hsp60/65. Three predicted epitope regions of M. paratuberculosis hsp65 were able to bind efficiently C1q antibodies. An inverse correlation was found between C1qAb and C'-ADE, neutralization was more frequent in the sera with detectable C1qAb, whereas sera without C1qAb more likely enhanced HIV infection in vitro.

Antigens, Bacterial↗

PubMed1993

Determination of conformational transition rates in the trp promoter by 1H NMR rotating-frame T1 and cross-relaxation rate measurements.

Rotating-frame relaxation measurements have been used in conjunction with spin-spin relaxation rate constants to investigate a conformational transition previously observed in the -10 region of the trp promoter d(CGTACTAGTTAACTAGTACG)2 (Lefèvre, Lane, Jardetzky 1987). The transition is localised to the sub-sequence TAAC, and is in fast exchange on the chemical shift time-scale. The rate constant for the exchange process has been determined from measurements of the rotating-frame relaxation rate constant as a function of the spin-lock field strength, and is approximately 5000 s-1 at 30 degrees C. Measurements have also been made as a function of temperature and in two different magnetic fields: the results are fully consistent with those expected for the exchange contribution in a two-site system. A similar transition has been observed in d(GTGATTGACAATTA).d(CACTAACTGTTAAT), which contains the -35 region of the trp promoter. This has been investigated in the same way, and has been found to undergo exchange at a faster rate under comparable conditions. In addition, the cross-relaxation rate constants for Ade C2H-Ade C2H pairs have been measured as a function of temperature, and these indicate that certain internuclear distances in YAAY subsequences increase with increasing temperature. These changes in distance are consistent with a flattening of propellor twist of the AT base-pairs. The occurrence of conformational transitions in YAAY subsequences depends on the flanking sequence.

Base Sequence↗